Darwin Core List of Terms

Title: Darwin Core List of Terms
Date version issued: 2026-05-26
Date created: 2020-08-12
Part of TDWG Standard: http://www.tdwg.org/standards/450
This version: http://rs.tdwg.org/dwc/doc/list/2026-05-26
Latest version: http://rs.tdwg.org/dwc/doc/list/
Previous version: http://rs.tdwg.org/dwc/doc/list/2025-07-10
Abstract: Darwin Core is a vocabulary standard for transmitting information about biodiversity. This document lists all terms in namespaces currently used in the vocabulary.
Contributors: John Wieczorek (VertNet), Peter Desmet (Instituut voor Natuur- en Bosonderzoek (INBO)), Steve Baskauf (Vanderbilt University Libraries), Tim Robertson (Global Biodiversity Information Facility), Markus Döring (Global Biodiversity Information Facility), Quentin Groom (Botanic Garden Meise), Stijn Van Hoey (Instituut voor Natuur- en Bosonderzoek (INBO)), David Bloom (VertNet), Paula Zermoglio (VertNet), Robert Guralnick (University of Florida), John Deck (Genomic Biodiversity Working Group), Gail Kampmeier (Illinois Natural History Survey), Dave Vieglais (KU Natural History Museum), Renato De Giovanni (Centro de Referência em Informação Ambiental), Campbell Webb (TDWG RDF/OWL Task Group), Paul J. Morris (Harvard University Herbaria/Museum of Comparative Zoölogy), Mark Schildhauer (National Center for Ecological Analysis and Synthesis), Sophia Ratcliffe (National Biodiversity Network Trust), Teresa J. Mayfield-Meyer (The University of New Mexico, Arctos), Christian Bölling (Museum für Naturkunde Berlin - Leibniz-Institut für Evolutions- und Biodiversitätsforschung)
Creator: Darwin Core Maintenance Group
Bibliographic citation: Darwin Core Maintenance Group. 2026. Darwin Core List of Terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/2026-05-26

1 Introduction (Informative)

This document contains terms that are part of the most recent version of the Darwin Core vocabulary (http://rs.tdwg.org/version/dwc/2026-05-26).

This document includes terms in four namespaces that contain recommended terms: dwc:, dwciri:, dc:, and dcterms:. However, some terms in these namespaces are deprecated or superseded and should no longer be used. Deprecation or supersession is noted in the term metadata. Namespaces that contain only deprecated terms are not included in this document, but metadata about those terms can be retrieved by dereferencing their IRIs.

For a simplified list that contains only the currently recommended terms, see the Darwin Core Quick Reference Guide.

1.1 Status of the content of this document

Sections 1 and 3 are non-normative.

Section 2 is normative.

In Section 4, the values of the Term IRI and Definition are normative. The values of Term Name are non-normative, although one can expect that the namespace abbreviation prefix is one commonly used for the term namespace. Label and the values of all other properties (such as Examples and Notes) are non-normative.

1.2 RFC 2119 key words

The key words “MUST”, “MUST NOT”, “REQUIRED”, “SHALL”, “SHALL NOT”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY”, and “OPTIONAL” in this document are to be interpreted as described in BCP 14 [RFC 2119] and [RFC 8174] when, and only when, they appear in all capitals, as shown here.

1.3 Namespace abbreviations

The following namespace abbreviations are used in this document:

abbreviation	IRI
dwc:	http://rs.tdwg.org/dwc/terms/
dwciri:	http://rs.tdwg.org/dwc/iri/
dc:	http://purl.org/dc/elements/1.1/
dcterms:	http://purl.org/dc/terms/

2 Use of Terms

Due to the requirements of Section 1.4.3 of the Darwin Core RDF Guide, terms in the dwciri: namespace MUST be used with IRI values. Terms in the dwc: and dc: namespaces are generally expected to have string literal values. Values for terms in the dcterms: namespace will depend on the details of the term. See Section 3 of the Darwin Core RDF Guide for details.

3 Term indices

3.1 index_by_term_name

see_also_index_by_label

classes

Record level

Dublin Core legacy namespace

dc:language | dc:type

Dublin Core terms namespace

Agent

dwc:agentID | dwc:agentRemarks | dwc:agentType

Assertion

Bibliographic Resource

dwc:referenceID | dwc:referenceRemarks | dwc:referenceType

Event

Geological Context

Identification

Location

Material Entity

Material Sample

dwc:materialSampleID

Measurement or Fact

Media

no_terms_organized_in_class

Molecular Protocol

dwc:assayType | dwc:molecularProtocolID

Nucleotide Analysis

dwc:processedTotalReadCount | dwc:readCount

Nucleotide Sequence

dwc:nucleotideSequenceRemarks | dwc:sequence

Occurrence

Organism

Organism Interaction

dwc:organismInteractionDescription | dwc:organismInteractionID | dwc:organismInteractionType

Protocol

dwc:protocolDescription | dwc:protocolID | dwc:protocolReferences | dwc:protocolRemarks | dwc:protocolType

Provenance

ac:fundingAttribution | dwc:fundingAttributionID | dwc:projectID | dwc:projectTitle

Resource Relationship

Taxon

Usage Policy

no_terms_organized_in_class

IRI-value terms

3.2 index_by_label

see_also_index_by_term_name

classes

Record level

Dublin Core legacy namespace

Language | Type

Dublin Core terms namespace

Agent

Agent ID | Agent Remarks | Agent Type

Assertion

Bibliographic Resource

Reference ID | Reference Remarks | Reference Type

Event

Geological Context

Identification

Location

Material Entity

Material Sample

Material Sample ID

Measurement or Fact

Media

no_terms_organized_in_class

Molecular Protocol

Assay Type | Molecular Protocol ID

Nucleotide Analysis

Processed Total Read Count | Read Count

Nucleotide Sequence

Nucleotide Sequence Remarks | Sequence

Occurrence

Organism

Organism Interaction

Organism Interaction Description | Organism Interaction ID | Organism Interaction Type

Protocol

Protocol Description | Protocol ID | Protocol References | Protocol Remarks | Protocol Type

Provenance

Funding Attribution | Funding Attribution ID | Project ID | Project Title

Resource Relationship

Taxon

Usage Policy

no_terms_organized_in_class

IRI-value terms

4 vocabulary

term_name dwc:acceptedNameUsage
term_iri	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsage-2025-06-12
label	Accepted Name Usage
definition	The full name, with authorship and date information if known, of the currently valid (zoological) or accepted (botanical) dwc:Taxon.
notes	The full scientific name, with authorship and date information if known, of the accepted (botanical) or valid (zoological) name in cases where the provided dwc:scientificName is considered by the reference indicated in the dwc:nameAccordingTo property, or of the content provider, to be a synonym or misapplied name. When applied to a dwc:Organism or dwc:Occurrence, this term should be used in cases where a content provider regards the provided dwc:scientificName to be inconsistent with the taxonomic perspective of the content provider. For example, there are many discrepancies within specimen collections and observation datasets between the recorded name (e.g., the most recent identification from an expert who examined a specimen, or a field identification for an observed dwc:Organism), and the name asserted by the content provider to be taxonomically accepted.
examples	`Tamias minimus` (valid name for `Eutamias minimus`)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:acceptedNameUsageID
term_iri	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsageID-2023-06-28
label	Accepted Name Usage ID
definition	An identifier for the name usage (documented meaning of the name according to a source) of the currently valid (zoological) or accepted (botanical) taxon.
notes	This term should be used for synonyms or misapplied names to refer to the dwc:taxonID of a dwc:Taxon record that represents the accepted (botanical) or valid (zoological) name. For Darwin Core Archives the related record should be present locally in the same archive.
examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
abcd_equivalence	not in ABCD
type	property

term_name dwc:acceptedScientificName
term_iri	http://rs.tdwg.org/dwc/terms/acceptedScientificName
modified	2009-09-21
label	Accepted Scientific Name
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
definition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
abcd_equivalence	not in ABCD
type	property

term_name dwc:acceptedScientificNameID
term_iri	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
modified	2009-08-24
label	Accepted Scientific Name ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
definition	A unique identifier for the acceptedScientificName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:AcceptedTaxon
term_iri	http://rs.tdwg.org/dwc/terms/AcceptedTaxon
modified	2009-04-24
label	Accepted Taxon
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
definition	The currently valid (zoological) or accepted (botanical) name for the ScientificName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:AcceptedTaxonID
term_iri	http://rs.tdwg.org/dwc/terms/AcceptedTaxonID
modified	2009-04-24
label	Accepted Taxon ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
definition	A global unique identifier for the parent to the AcceptedTaxon.
abcd_equivalence	not in ABCD
type	property

term_name dwc:acceptedTaxonID
term_iri	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
modified	2009-09-21
label	Accepted Taxon ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
definition	An identifier for the name of the currently valid (zoological) or accepted (botanical) taxon. See acceptedTaxon.
notes	Example: "8fa58e08-08de-4ac1-b69c-1235340b7001"
abcd_equivalence	not in ABCD
type	property

term_name dwc:acceptedTaxonName
term_iri	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
modified	2009-07-06
label	Accepted Taxon Name
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedScientificName
definition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
abcd_equivalence	not in ABCD
type	property

term_name dwc:acceptedTaxonNameID
term_iri	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
modified	2009-07-06
label	Accepted Taxon Name ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
definition	A unique identifier for the acceptedTaxonName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:AccessConstraints
term_iri	http://rs.tdwg.org/dwc/terms/AccessConstraints
modified	2009-09-21
label	Access Constraints
	term_deprecated
term_replaced_by	http://purl.org/dc/terms/accessRights
definition	A description of constraints on the use of the data as shared or access to further data that is not shared.
notes	Example: "not-for-profit use only".
abcd_equivalence	DataSets/DataSet/Units/Unit/IPRStatements
type	property

term_name dcterms:accessRights
term_iri	http://purl.org/dc/terms/accessRights
modified	2023-06-28
term_version_iri	http://dublincore.org/usage/terms/history/#accessRights-002
label	Access Rights
definition	Information about who can access the resource or an indication of its security status.
notes	Access Rights may include information regarding access or restrictions based on privacy, security, or other policies.
examples	`not-for-profit use only` (string literal example) `https://www.fieldmuseum.org/field-museum-natural-history-conditions-and-suggested-norms-use-collections-data-and-images` (URI example)
abcd_equivalence	not in ABCD
type	property

term_name dwc:accordingTo
term_iri	http://rs.tdwg.org/dwc/terms/accordingTo
modified	2020-08-06
label	According To
	term_deprecated
definition	Abstract term to attribute information to a source.
abcd_equivalence	not in ABCD
type	property

term_name dwc:accuracy
term_iri	http://rs.tdwg.org/dwc/terms/accuracy
modified	2009-04-24
label	Accuracy
	term_deprecated
definition	Abstract term to capture error information about a measurement or fact.
abcd_equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property

term_name dcterms:Agent
term_iri	http://purl.org/dc/terms/Agent
modified	2026-05-26
term_version_iri	http://dublincore.org/usage/terms/history/#Agent-001
label	Agent
definition	A resource that acts or has the power to act.
notes	A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
examples	`a person` `a team of participants on an expedition` `a funding agency` `a particular bioacoustic monitoring installation` `a software instance` `a particular camera trap`
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:agentID
term_iri	http://rs.tdwg.org/dwc/terms/agentID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/agentID-2026-05-26
label	Agent ID
definition	An identifier for a dcterms:Agent.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:agentRemarks
term_iri	http://rs.tdwg.org/dwc/terms/agentRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/agentRemarks-2026-05-26
label	Agent Remarks
definition	Comments or notes about a dcterms:Agent.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:agentRoleOrder
term_iri	http://rs.tdwg.org/dwc/terms/agentRoleOrder
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/agentRoleOrder-2026-05-26
label	Agent Role Order
definition	A numerical position of an AgentRole in a set of AgentRoles.
notes	One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
examples	`1` `2`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:agentType
term_iri	http://rs.tdwg.org/dwc/terms/agentType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/agentType-2026-05-26
label	Agent Type
definition	A category that best matches the nature of a dcterms:Agent.
notes	Recommended best practice is to use a controlled vocabulary.
examples	`person` `group` `organization` `camera`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:assayType
term_iri	http://rs.tdwg.org/dwc/iri/assayType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/assayType-2026-05-26
label	Assay Type (IRI)
definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assayType
term_iri	http://rs.tdwg.org/dwc/terms/assayType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assayType-2026-05-26
label	Assay Type
definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`targeted` `metabarcoding` `other`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Assertion
term_iri	http://rs.tdwg.org/dwc/terms/Assertion
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Assertion-2026-05-26
label	Assertion
definition	A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
abcd_equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:assertionBy
term_iri	http://rs.tdwg.org/dwc/iri/assertionBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/assertionBy-2026-05-26
label	Assertion By (IRI)
definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionBy
term_iri	http://rs.tdwg.org/dwc/terms/assertionBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionBy-2026-05-26
label	Assertion By
definition	A name for a dcterms:Agent responsible for making a dwc:Assertion.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey` `ChatGPT` `Notes From Nature` `ROV SuBastian`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionEffectiveDate
term_iri	http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionEffectiveDate-2026-05-26
label	Assertion Effective Date
definition	A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionError
term_iri	http://rs.tdwg.org/dwc/terms/assertionError
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionError-2026-05-26
label	Assertion Error
definition	A description of the potential error associated with a dwc:assertionValue.
examples	`0.01` `normal distribution with variation of 2 m`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionID
term_iri	http://rs.tdwg.org/dwc/terms/assertionID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionID-2026-05-26
label	Assertion ID
definition	An identifier for a dwc:Assertion.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionMadeDate
term_iri	http://rs.tdwg.org/dwc/terms/assertionMadeDate
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionMadeDate-2026-05-26
label	Assertion Made Date
definition	A date on which a dwc:Assertion was created.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionProtocols
term_iri	http://rs.tdwg.org/dwc/terms/assertionProtocols
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionProtocols-2026-05-26
label	Assertion Protocols
definition	Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
abcd_equivalence	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionReferences
term_iri	http://rs.tdwg.org/dwc/terms/assertionReferences
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionReferences-2026-05-26
label	Assertion References
definition	A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionRemarks
term_iri	http://rs.tdwg.org/dwc/terms/assertionRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionRemarks-2026-05-26
label	Assertion Remarks
definition	Comments or notes about a dwc:Assertion.
examples	`tip of tail missing` `error determined by independently calibrated measurements` `error provided is from the manufacturer’s standard instrument specification`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:assertionType
term_iri	http://rs.tdwg.org/dwc/iri/assertionType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/assertionType-2026-05-26
label	Assertion Type (IRI)
definition	A category that best matches the nature of a dwc:Assertion.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionType
term_iri	http://rs.tdwg.org/dwc/terms/assertionType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionType-2026-05-26
label	Assertion Type
definition	A category that best matches the nature of a dwc:Assertion.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`tailLength` `waterTemperature` `trapLineLength` `surveyArea` `trapType`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:assertionUnit
term_iri	http://rs.tdwg.org/dwc/iri/assertionUnit
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/assertionUnit-2026-05-26
label	Assertion Unit (IRI)
definition	A unit associated with the value in dwc:assertionValue.
notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://www.ontology-of-units-of-measure.org/resource/om-2/metre` `http://www.ontology-of-units-of-measure.org/resource/om-2/second-Time`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionUnit
term_iri	http://rs.tdwg.org/dwc/terms/assertionUnit
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionUnit-2026-05-26
label	Assertion Unit
definition	A unit associated with the value in dwc:assertionValue.
notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`m` `s` `g` `ml` `%` `individuals`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:assertionValue
term_iri	http://rs.tdwg.org/dwc/terms/assertionValue
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/assertionValue-2026-05-26
label	Assertion Value
definition	An asserted value.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`45` `20` `1` `14.5` `UV-light` `Hamon grab`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:assertionValue
term_iri	http://rs.tdwg.org/dwc/iri/assertionValue
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/assertionValue-2026-05-26
label	Assertion Value (IRI)
definition	An asserted value.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:associatedMedia
term_iri	http://rs.tdwg.org/dwc/terms/associatedMedia
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedMedia-2023-06-28
label	Associated Media
definition	A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of media associated with the dwc:Occurrence.
examples	`https://arctos.database.museum/media/10520962 \| https://arctos.database.museum/media/10520964`
abcd_equivalence	DataSets/DataSet/Units/Unit/MultimediaObjects
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:associatedOccurrences
term_iri	http://rs.tdwg.org/dwc/terms/associatedOccurrences
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedOccurrences-2023-06-28
label	Associated Occurrences
definition	A list (concatenated and separated) of identifiers of other dwc:Occurrence records and their associations to this dwc:Occurrence.
notes	This term can be used to provide a list of associations to other dwc:Occurrences. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`"parasite collected from":"https://arctos.database.museum/guid/MSB:Mamm:215895?seid=950760"` `"encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3175067" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177393" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177394" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177392" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3609139"`
abcd_equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:associatedOrganisms
term_iri	http://rs.tdwg.org/dwc/terms/associatedOrganisms
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedOrganisms-2023-06-28
label	Associated Organisms
definition	A list (concatenated and separated) of identifiers of other dwc:Organisms and the associations of this dwc:Organism to each of them.
notes	This term can be used to provide a list of associations to other dwc:Organisms. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`"sibling of":"http://arctos.database.museum/guid/DMNS:Mamm:14171"` `"parent of":"http://arctos.database.museum/guid/MSB:Mamm:196208" \| "parent of":"http://arctos.database.museum/guid/MSB:Mamm:196523" \| "sibling of":"http://arctos.database.museum/guid/MSB:Mamm:142638"`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

term_name dwc:associatedReferences
term_iri	http://rs.tdwg.org/dwc/terms/associatedReferences
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedReferences-2023-06-28
label	Associated References
definition	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the dwc:Occurrence.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Note also that the intended usage of the term dcterms:references in Darwin Core when applied to a dwc:Occurrence is to point to the definitive source representation of that dwc:Occurrence if one is available. Note also that the intended usage of dcterms:bibliographicCitation in Darwin Core when applied to a dwc:Occurrence is to provide the preferred way to cite the dwc:Occurrence itself.
examples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
abcd_equivalence	DataSets/DataSet/Units/Unit/UnitReferences
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:associatedSequences
term_iri	http://rs.tdwg.org/dwc/terms/associatedSequences
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedSequences-2026-05-26
label	Associated Sequences
definition	A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity.
examples	`http://www.ncbi.nlm.nih.gov/nuccore/U34853.1` `http://www.ncbi.nlm.nih.gov/nuccore/GU328060 \| http://www.ncbi.nlm.nih.gov/nuccore/AF326093`
abcd_equivalence	DataSets/DataSet/Units/Unit/Sequences/Sequence/ID-in-Database + constant
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:associatedTaxa
term_iri	http://rs.tdwg.org/dwc/terms/associatedTaxa
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/associatedTaxa-2023-06-28
label	Associated Taxa
definition	A list (concatenated and separated) of identifiers or names of dwc:Taxon records and the associations of this dwc:Occurrence to each of them.
notes	This term can be used to provide a list of associations to dwc:Taxon records other than the one defined in the dwc:Occurrence. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. This term is not apt for establishing relationships between dwc:Taxon records, only between specific dwc:Occurrences of a dwc:Organism with other dwc:Taxon records. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`"host":"Quercus alba"` `"host":"gbif.org/species/2879737"` `"parasitoid of":"Cyclocephala signaticollis" \| "predator of":"Apis mellifera"`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:basionym
term_iri	http://rs.tdwg.org/dwc/terms/basionym
modified	2009-09-21
label	Basionym
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/originalNameUsage
definition	The basionym (botany) or basonym (bacteriology) of the scientificName.
notes	Example: "Pinus abies"
abcd_equivalence	not in ABCD
type	property

term_name dwc:basionymID
term_iri	http://rs.tdwg.org/dwc/terms/basionymID
modified	2009-09-21
label	Basionym ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/originalNameUsageID
definition	A unique identifier for the basionym (botany) or basonym (bacteriology) of the scientificName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:basisOfRecord
term_iri	http://rs.tdwg.org/dwc/terms/basisOfRecord
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/basisOfRecord-2023-09-13
label	Basis Of Record
definition	The specific nature of the data record.
notes	Recommended best practice is to use a controlled vocabulary such as the set of local names of the identifiers for classes in Darwin Core.
examples	`MaterialEntity` `PreservedSpecimen` `FossilSpecimen` `LivingSpecimen` `MaterialSample` `Event` `HumanObservation` `MachineObservation` `Taxon` `Occurrence` `MaterialCitation`
abcd_equivalence	DataSets/DataSet/Units/Unit/RecordBasis
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2009-12-07_2
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:bed
term_iri	http://rs.tdwg.org/dwc/terms/bed
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/bed-2023-09-13
label	Bed
definition	The full name of the lithostratigraphic bed from which the dwc:MaterialEntity was collected.
examples	`Harlem coal`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:behavior
term_iri	http://rs.tdwg.org/dwc/terms/behavior
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/behavior-2026-05-26
label	Behavior
definition	A behavior shown by a dwc:Organism.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`roosting` `foraging` `running`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:behavior
term_iri	http://rs.tdwg.org/dwc/iri/behavior
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/behavior-2026-05-26
label	Behavior (IRI)
definition	A behavior shown by a dwc:Organism.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dcterms:bibliographicCitation
term_iri	http://purl.org/dc/terms/bibliographicCitation
modified	2023-06-28
term_version_iri	http://dublincore.org/usage/terms/history/#bibliographicCitation-002
label	Bibliographic Citation
definition	A bibliographic reference for the resource.
notes	From Dublin Core, "Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible." The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself - "how to cite this record". Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource - "where to find the as-close-to-original reference", if one is available.
examples	`Museum of Vertebrate Zoology, UC Berkeley. MVZ Mammal Collection (Arctos). Record ID: http://arctos.database.museum/guid/MVZ:Mamm:165861?seid=101356. Source: http://ipt.vertnet.org:8080/ipt/resource.do?r=mvz_mammal.` (Occurrence example) `https://www.gbif.org/species/2439608 Source: GBIF Taxonomic Backbone` (Taxon example) `Rand, K.M., Logerwell, E.A. The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s. Polar Biol 34, 475–488 (2011). https://doi.org/10.1007/s00300-010-0900-2` (Event example)
abcd_equivalence	not in ABCD
type	property

term_name dcterms:BibliographicResource
term_iri	http://purl.org/dc/terms/BibliographicResource
modified	2026-05-26
term_version_iri	http://dublincore.org/usage/terms/history/#BibliographicResource-001
label	Bibliographic Resource
definition	A book, article, or other documentary resource.
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:binomial
term_iri	http://rs.tdwg.org/dwc/terms/binomial
modified	2009-04-24
label	Binomial
	term_deprecated
definition	The combination of genus and first (species) epithet of the scientificName.
notes	Example: "Ctenomys sociabilis"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa/TaxonIdentified/ScientificName/FullScientificNameString
type	property

term_name dwciri:caste
term_iri	http://rs.tdwg.org/dwc/iri/caste
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/caste-2026-05-26
label	Caste (IRI)
definition	A social caste of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:caste
term_iri	http://rs.tdwg.org/dwc/terms/caste
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/caste-2026-05-26
label	Caste
definition	A social caste of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`queen` `male alate` `intercaste` `minor worker` `soldier` `ergatoid`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:catalogNumber
term_iri	http://rs.tdwg.org/dwc/terms/catalogNumber
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/catalogNumber-2026-05-26
label	Catalog Number
definition	An identifier (preferably unique) for a resource within a collection.
examples	`145732` `145732a` `2008.1334` `R-4313`
abcd_equivalence	DataSets/DataSet/Units/Unit/UnitID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:CatalogNumberNumeric
term_iri	http://rs.tdwg.org/dwc/terms/CatalogNumberNumeric
modified	2009-04-24
label	Catalog Number Numeric
	term_deprecated
definition	The numeric value of the catalogNumber, used to facilitate numerical sorting and searching by ranges.
abcd_equivalence	DataSets/DataSet/Units/Unit/UnitIDNumeric
type	property

term_name dwc:causeOfDeath
term_iri	http://rs.tdwg.org/dwc/terms/causeOfDeath
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/causeOfDeath-2025-06-12
label	Cause Of Death
definition	An indication of the known or suspected cause of death of a dwc:Organism.
notes	The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events).
examples	`trap` `poison` `starvation` `drowning` `shooting` `old age` `vehicle collision` `disease` `herbicide` `burning` `infanticide`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:class
term_iri	http://rs.tdwg.org/dwc/terms/class
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/class-2023-06-28
label	Class
definition	The full scientific name of the class in which the dwc:Taxon is classified.
examples	`Mammalia` `Hepaticopsida`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = classis
type	property

term_name dwc:collectionCode
term_iri	http://rs.tdwg.org/dwc/terms/collectionCode
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/collectionCode-2026-05-26
label	Collection Code
definition	A name, acronym, coden, or initialism identifying a collection.
examples	`Mammals` `Hildebrandt` `EBIRD` `VP`
abcd_equivalence	DataSets/DataSet/Units/Unit/SourceID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:collectionID
term_iri	http://rs.tdwg.org/dwc/terms/collectionID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/collectionID-2026-05-26
label	Collection ID
definition	An identifier for a collection.
notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
examples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`
abcd_equivalence	DataSets/DataSet/Units/Unit/SourceID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:continent
term_iri	http://rs.tdwg.org/dwc/terms/continent
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/continent-2023-06-28
label	Continent
definition	The name of the continent in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`Africa` `Antarctica` `Asia` `Europe` `North America` `Oceania` `South America`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Continent
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:coordinatePrecision
term_iri	http://rs.tdwg.org/dwc/terms/coordinatePrecision
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/coordinatePrecision-2023-06-28
label	Coordinate Precision
definition	A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude.
examples	`0.00001` (normal GPS limit for decimal degrees) `0.000278` (nearest second) `0.01667` (nearest minute) `1.0` (nearest degree)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/ISOAccuracy or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/AccuracyStatement
type	property

term_name dwc:coordinateUncertaintyInMeters
term_iri	http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/coordinateUncertaintyInMeters-2026-05-26
label	Coordinate Uncertainty In Meters
definition	A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term.
notes	Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
examples	`30` (reasonable lower limit on or after 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `100` (reasonable lower limit before 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `71` (uncertainty for a UTM coordinate having 100 meter precision and a known spatial reference system)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinateErrorDistanceInMeters
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:country
term_iri	http://rs.tdwg.org/dwc/terms/country
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/country-2023-06-28
label	Country
definition	The name of the country or major administrative unit in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`Denmark` `Colombia` `España`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Country/Name
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:countryCode
term_iri	http://rs.tdwg.org/dwc/terms/countryCode
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/countryCode-2026-05-26
label	Country Code
definition	The standard code for the country in which the dcterms:Location occurs.
notes	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`AR` `SV` `XZ` `ZZ`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Country/ISO3166Code
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:county
term_iri	http://rs.tdwg.org/dwc/terms/county
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/county-2023-06-28
label	Second Order Division
definition	The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`Missoula` `Los Lagos` `Mataró`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= County
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:cultivarEpithet
term_iri	http://rs.tdwg.org/dwc/terms/cultivarEpithet
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/cultivarEpithet-2026-05-26
label	Cultivar Epithet
definition	Part of the name of a cultivar, cultivar group or grex that follows the dwc:scientificName.
notes	According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
examples	`King Edward` (for scientificName `Solanum tuberosum 'King Edward'` and taxonRank `cultivar`) `Mishmiense` (for scientificName `Rhododendron boothii Mishmiense Group` and taxonRank `cultivar group`) `Atlantis` (for scientificName `Paphiopedilum Atlantis grex` and taxonRank `grex`)
abcd_equivalence	http://rs.tdwg.org/abcd/terms/cultivarName or http://rs.tdwg.org/abcd/terms/cultivarGroupName or http://rs.tdwg.org/abcd/terms/breed (ABCD 3.0)
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:dataGeneralizations
term_iri	http://rs.tdwg.org/dwc/terms/dataGeneralizations
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/dataGeneralizations-2023-06-28
label	Data Generalizations
definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Coordinates generalized from original GPS coordinates to the nearest half degree grid cell`.
abcd_equivalence	not in ABCD
type	property

term_name dwciri:dataGeneralizations
term_iri	http://rs.tdwg.org/dwc/iri/dataGeneralizations
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/dataGeneralizations-2025-07-10
label	Data Generalizations (IRI)
definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:Dataset
term_iri	http://rs.tdwg.org/dwc/terms/Dataset
modified	2009-09-11
label	Dataset
	term_deprecated
definition	The category of information pertaining to a logical set of records.
abcd_equivalence	DataSets/DataSet
type	class

term_name dwc:datasetID
term_iri	http://rs.tdwg.org/dwc/terms/datasetID
modified	2017-10-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/datasetID-2017-10-06
label	Dataset ID
definition	An identifier for the set of data. May be a global unique identifier or an identifier specific to a collection or institution.
examples	`b15d4952-7d20-46f1-8a3e-556a512b04c5`
abcd_equivalence	DataSets/DataSet/DataSetGUID
type	property

term_name dwc:datasetName
term_iri	http://rs.tdwg.org/dwc/terms/datasetName
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/datasetName-2026-05-26
label	Dataset Name
definition	A name of a source dataset.
examples	`Grinnell Resurvey Mammals` `Lacey Ctenomys Recaptures`
abcd_equivalence	DataSets/DataSet/Units/Unit/SourceID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:dateIdentified
term_iri	http://rs.tdwg.org/dwc/terms/dateIdentified
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/dateIdentified-2025-06-12
label	Date Identified
definition	The date on which the subject was determined as representing the dwc:Taxon.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Date/DateText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:day
term_iri	http://rs.tdwg.org/dwc/terms/day
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/day-2023-06-28
label	Day
definition	The integer day of the month on which the dwc:Event occurred.
examples	`9` `28`
abcd_equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
type	property

term_name dwc:decimalLatitude
term_iri	http://rs.tdwg.org/dwc/terms/decimalLatitude
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/decimalLatitude-2026-05-26
label	Decimal Latitude
definition	A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
notes	Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
examples	`-41.0983423`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LatitudeDecimal
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:decimalLongitude
term_iri	http://rs.tdwg.org/dwc/terms/decimalLongitude
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/decimalLongitude-2026-05-26
label	Decimal Longitude
definition	A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
notes	Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
examples	`-121.1761111`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LongitudeDecimal
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:degreeOfEstablishment
term_iri	http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/degreeOfEstablishment-2023-06-28
label	Degree of Establishment
definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`native` `captive` `cultivated` `released` `failing` `casual` `reproducing` `established` `colonising` `invasive` `widespreadInvasive`
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_27
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:degreeOfEstablishment
term_iri	http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/degreeOfEstablishment-2025-07-10
label	Degree of Establishment (IRI)
definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://rs.tdwg.org/dwcdoe/values/d003` `http://rs.tdwg.org/dwcdoe/values/d005`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_27
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:digitalSpecimenID
term_iri	http://rs.tdwg.org/dwc/terms/digitalSpecimenID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/digitalSpecimenID-2026-05-26
label	Digital Specimen ID
definition	An identifier for a Digital Specimen resource.
notes	A Digital Specimen is defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity.
examples	`https://doi.org/10.3535/M42-Z4P-DRD` `https://doi.org/10.3535/M42-Z4P-DRD?urlappend=/1` `https://doi.org/10.3535/M42-Z4P-DRD?locatt=/1` `doi:10.3535/M42-Z4P-DRD`
abcd_equivalence	Note: /DataSets/DataSet/Units/Unit/UnitGUID could be used. A new term /DataSets/DataSet/Units/Unit/SpecimenUnit/digitalSpecimenID would make it distinguishable from URIs that identify the physical object or catalogue record.
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:discipline
term_iri	http://rs.tdwg.org/dwc/iri/discipline
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/iri/version/discipline-2025-06-12
label	Discipline (IRI)
definition	The primary branch or branches of knowledge represented by the record.
notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:discipline
term_iri	http://rs.tdwg.org/dwc/terms/discipline
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/discipline-2026-05-26
label	Discipline
definition	The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( `\|` ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Botany` `Botany \| Virology \| Taxonomy`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:disposition
term_iri	http://rs.tdwg.org/dwc/iri/disposition
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/disposition-2026-05-26
label	Disposition (IRI)
definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:disposition
term_iri	http://rs.tdwg.org/dwc/terms/disposition
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/disposition-2026-05-26
label	Disposition
definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`in collection` `missing` `on loan` `used up` `destroyed` `deaccessioned`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/Disposition
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:DwCType
term_iri	http://rs.tdwg.org/dwc/terms/DwCType
modified	2014-10-23
label	Darwin Core Type
	term_deprecated
definition	The set of classes specified by the Darwin Core Type Vocabulary, used to categorize the nature or genre of the resource.
abcd_equivalence	not in ABCD
type	http://purl.org/dc/dcam/VocabularyEncodingScheme

term_name dwc:dynamicProperties
term_iri	http://rs.tdwg.org/dwc/terms/dynamicProperties
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/dynamicProperties-2023-06-28
label	Dynamic Properties
definition	A list of additional measurements, facts, characteristics, or assertions about the record. Meant to provide a mechanism for structured content.
notes	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
examples	`{"heightInMeters":1.5}` `{"targusLengthInMeters":0.014, "weightInGrams":120}` `{"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}` `{"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}` `{"aspectHeading":277, "slopeInDegrees":6}` `{"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:earliestAgeOrLowestStage
term_iri	http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/earliestAgeOrLowestStage-2023-09-13
label	Earliest Age Or Lowest Stage
definition	The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Atlantic` `Boreal` `Skullrockian`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:EarliestDateCollected
term_iri	http://rs.tdwg.org/dwc/terms/EarliestDateCollected
modified	2009-04-24
label	Earliest Date Collected
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventDate
definition	The earliest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
type	property

term_name dwc:earliestEonOrLowestEonothem
term_iri	http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/earliestEonOrLowestEonothem-2026-05-26
label	Earliest Eon Or Lowest Eonothem
definition	The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Phanerozoic` `Proterozoic` `Precambrian`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:earliestEpochOrLowestSeries
term_iri	http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/earliestEpochOrLowestSeries-2023-09-13
label	Earliest Epoch Or Lowest Series
definition	The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Holocene` `Pleistocene` `Ibexian Series`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:earliestEraOrLowestErathem
term_iri	http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/earliestEraOrLowestErathem-2023-09-13
label	Earliest Era Or Lowest Erathem
definition	The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Cenozoic` `Mesozoic`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:earliestGeochronologicalEra
term_iri	http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/iri/version/earliestGeochronologicalEra-2023-09-13
label	Earliest Geochronological Era
definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:earliestPeriodOrLowestSystem
term_iri	http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/earliestPeriodOrLowestSystem-2023-09-13
label	Earliest Period Or Lowest System
definition	The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Neogene` `Tertiary` `Quaternary`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:endDayOfYear
term_iri	http://rs.tdwg.org/dwc/terms/endDayOfYear
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/endDayOfYear-2026-05-26
label	End Day Of Year
definition	The latest integer day of the year on which a dwc:Event occurred.
notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberEnd
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:EndTimeOfDay
term_iri	http://rs.tdwg.org/dwc/terms/EndTimeOfDay
modified	2009-04-24
label	End Time of Day
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventTime
definition	The time of day when the event ended, expressed as decimal hours from midnight, local time.
notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/TimeOfDayEnd
type	property

term_name dwciri:establishmentMeans
term_iri	http://rs.tdwg.org/dwc/iri/establishmentMeans
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/establishmentMeans-2025-07-10
label	Establishment Means (IRI)
definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_25
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:establishmentMeans
term_iri	http://rs.tdwg.org/dwc/terms/establishmentMeans
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/establishmentMeans-2026-05-26
label	Establishment Means
definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`native` `nativeEndemic` `nativeReintroduced` `introduced` `introducedAssistedColonisation` `vagrant` `uncertain`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/EstablishmentMeans
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_25
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Event
term_iri	http://rs.tdwg.org/dwc/terms/Event
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Event-2026-05-26
label	Event
definition	An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
examples	`a material collecting event` `a bird observation` `a camera trap image capture` `an organism occurrence` `a biotic survey`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:EventAttribute
term_iri	http://rs.tdwg.org/dwc/terms/EventAttribute
modified	2009-04-24
label	Event Attribute
	term_deprecated
definition	Container class for information about attributes related to a given sampling event.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	class

term_name dwc:EventAttributeAccuracy
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeAccuracy
modified	2009-04-24
label	Event Attribute Accuracy
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
definition	The description of the error associated with the EventAttributeValue.
notes	Example: "0.01", "normal distribution with variation of 2 m"
abcd_equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property

term_name dwc:EventAttributeDeterminedBy
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedBy
modified	2009-04-24
label	Event Attribute Determined By
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
definition	The agent responsible for having determined the value of the measurement or characteristic of the sampling event.
notes	Example: "Robert Hijmans"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
type	property

term_name dwc:EventAttributeDeterminedDate
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedDate
modified	2009-04-24
label	Event Attribute Determined Date
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
definition	The date on which the the measurement or characteristic of the sampling event was made.
notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
type	property

term_name dwc:EventAttributeID
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeID
modified	2009-04-24
label	Event Attribute ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementID
definition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
abcd_equivalence	not in ABCD
type	property

term_name dwc:EventAttributeRemarks
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeRemarks
modified	2009-04-24
label	Event Attribute Remarks
	term_deprecated
definition	Comments or notes accompanying the measurement or characteristic of the sampling event.
notes	Example: "temperature taken at 15:00"
abcd_equivalence	not in ABCD
type	property

term_name dwc:eventAttributes
term_iri	http://rs.tdwg.org/dwc/terms/eventAttributes
modified	2009-10-09
label	Event Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements or characteristics of the Event.
notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	property

term_name dwc:EventAttributeType
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeType
modified	2009-04-24
label	Event Attribute Type
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementType
term_replaced_by	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
definition	The nature of the measurement or characteristic of the sampling event. Recommended best practice is to use a controlled vocabulary.
notes	Example: "Temperature"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property

term_name dwc:EventAttributeUnit
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeUnit
modified	2009-04-24
label	Event Attribute Unit
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
definition	The units for the value of the measurement or characteristic of the sampling event. Recommended best practice is to use International System of Units (SI) units.
notes	Example: "C"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property

term_name dwc:EventAttributeValue
term_iri	http://rs.tdwg.org/dwc/terms/EventAttributeValue
modified	2009-04-24
label	Event Attribute
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
definition	The value of the measurement or characteristic of the sampling event.
notes	Example: "22"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
type	property

term_name dwciri:eventCategory
term_iri	http://rs.tdwg.org/dwc/iri/eventCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/eventCategory-2026-05-26
label	Event Category (IRI)
definition	A broad category that best matches the nature of a dwc:Event.
notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:eventCategory
term_iri	http://rs.tdwg.org/dwc/terms/eventCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventCategory-2026-05-26
label	Event Category
definition	A broad category that best matches the nature of a dwc:Event.
notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: `Event`, `MaterialGathering`, `Occurrence`, `OrganismInteraction`, or `Survey`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Event` `MaterialGathering` `Occurrence` `OrganismInteraction` `Survey`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:eventDate
term_iri	http://rs.tdwg.org/dwc/terms/eventDate
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventDate-2026-05-26
label	Event Date
definition	A date-time or time interval during which a dwc:Event occurred.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:eventID
term_iri	http://rs.tdwg.org/dwc/terms/eventID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventID-2023-06-28
label	Event ID
definition	An identifier for the set of information associated with a dwc:Event (something that occurs at a place and time). May be a global unique identifier or an identifier specific to the data set.
examples	`INBO:VIS:Ev:00009375`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
type	property

term_name dwc:EventMeasurement
term_iri	http://rs.tdwg.org/dwc/terms/EventMeasurement
modified	2009-10-09
label	Event Measurement
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
definition	The category of information pertaining to measurements associated with an event.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	class

term_name dwc:eventMeasurementAccuracy
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
modified	2009-10-09
label	Event Measurement Accuracy
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementAccuracy
definition	The description of the error associated with the EventAttributeValue.
notes	Example: "0.01", "normal distribution with variation of 2 m"
abcd_equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property

term_name dwc:eventMeasurementDeterminedBy
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
modified	2009-10-09
label	Event Measurement Determined By
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
definition	The agent responsible for having determined the value of the measurement or characteristic of the event.
notes	Example: "Robert Hijmans"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
type	property

term_name dwc:eventMeasurementDeterminedDate
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
modified	2009-10-09
label	Event Measurement Determined Date
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
definition	The date on which the the measurement or characteristic of the event was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
type	property

term_name dwc:eventMeasurementID
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementID
modified	2009-10-09
label	Event Measurement ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementID
definition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
abcd_equivalence	not in ABCD
type	property

term_name dwc:eventMeasurementRemarks
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementRemarks
modified	2009-10-09
label	Event Measurement Remarks
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementRemarks
definition	Comments or notes accompanying the measurement or characteristic of the event.
notes	Example: "temperature taken at 15:00"
abcd_equivalence	not in ABCD
type	property

term_name dwc:eventMeasurementType
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementType
modified	2009-10-09
label	Event Measurement Type
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementType
definition	The nature of the measurement or characteristic of the event. Recommended best practice is to use a controlled vocabulary.
notes	Example: "temperature"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property

term_name dwc:eventMeasurementUnit
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
modified	2009-10-09
label	Event Measurement Unit
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementUnit
definition	The units for the value of the measurement or characteristic of the event. Recommended best practice is to use International System of Units (SI) units.
notes	Example: "C"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property

term_name dwc:eventMeasurementValue
term_iri	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
modified	2009-10-09
label	Event Measurement Value
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementValue
definition	The value of the measurement or characteristic of the event.
notes	Example: "22"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
type	property

term_name dwc:eventRemarks
term_iri	http://rs.tdwg.org/dwc/terms/eventRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventRemarks-2023-06-28
label	Event Remarks
definition	Comments or notes about the dwc:Event.
examples	`After the recent rains the river is nearly at flood stage.`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Notes
type	property

term_name dwc:eventTime
term_iri	http://rs.tdwg.org/dwc/terms/eventTime
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventTime-2025-06-12
label	Event Time
definition	The time or interval during which a dwc:Event occurred.
notes	Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019.
examples	`14:07-06:00` (at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `08:40:21Z` (at or after 8:40:21am and before 8:41:22am UTC) `13:00:00Z/15:30:00Z` (at or after 1pm and before 3:30pm UTC)
abcd_equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:eventType
term_iri	http://rs.tdwg.org/dwc/iri/eventType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/eventType-2026-05-26
label	Event Type (IRI)
definition	A narrow category that best matches the nature of a dwc:Event.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:eventType
term_iri	http://rs.tdwg.org/dwc/terms/eventType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/eventType-2026-05-26
label	Event Type
definition	A narrow category that best matches the nature of a dwc:Event.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`bioBlitz` `cameraTrapDeployment` `expedition` `project` `siteVisit` `trawl`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:family
term_iri	http://rs.tdwg.org/dwc/terms/family
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/family-2023-06-28
label	Family
definition	The full scientific name of the family in which the dwc:Taxon is classified.
examples	`Felidae` `Monocleaceae`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = familia
type	property

term_name dwc:feedbackURL
term_iri	http://rs.tdwg.org/dwc/terms/feedbackURL
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/feedbackURL-2025-06-12
label	Feedback URL
definition	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
notes	Recommended best practice is to optionally include query strings that act to pre-populate web page form elements and communicate the context.
examples	`https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:fieldNotes
term_iri	http://rs.tdwg.org/dwc/iri/fieldNotes
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/iri/version/fieldNotes-2023-06-28
label	Field Notes (IRI)
definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
notes	The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
abcd_equivalence	not in ABCD
type	property

term_name dwc:fieldNotes
term_iri	http://rs.tdwg.org/dwc/terms/fieldNotes
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/fieldNotes-2023-06-28
label	Field Notes
definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Notes available in the Grinnell-Miller Library.`
abcd_equivalence	DataSets/DataSet/Units/Unit/FieldNotes
type	property

term_name dwc:fieldNumber
term_iri	http://rs.tdwg.org/dwc/terms/fieldNumber
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/fieldNumber-2026-05-26
label	Field Number
definition	An identifier given to a dwc:Event in the field.
notes	Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`RV Sol 87-03-08`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:fieldNumber
term_iri	http://rs.tdwg.org/dwc/iri/fieldNumber
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/fieldNumber-2026-05-26
label	Field Number (IRI)
definition	An identifier given to a dwc:Event in the field.
notes	Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:footprintSpatialFit
term_iri	http://rs.tdwg.org/dwc/terms/footprintSpatialFit
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/footprintSpatialFit-2026-05-26
label	Footprint Spatial Fit
definition	A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
examples	`0` `1` `1.5708`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/FootprintSpatialFit
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:footprintSRS
term_iri	http://rs.tdwg.org/dwc/terms/footprintSRS
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/footprintSRS-2025-06-12
label	Footprint SRS
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`EPSG:4326` `GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]]` (WKT for the standard WGS84 Spatial Reference System EPSG:4326) `not recorded`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:footprintSRS
term_iri	http://rs.tdwg.org/dwc/iri/footprintSRS
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/iri/version/footprintSRS-2025-06-12
label	Footprint SRS (IRI)
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:footprintWKT
term_iri	http://rs.tdwg.org/dwc/terms/footprintWKT
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/footprintWKT-2026-05-26
label	Footprint WKT
definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
notes	A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
examples	`POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))` (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/FootprintWKT (ABCD v2.06b)
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:footprintWKT
term_iri	http://rs.tdwg.org/dwc/iri/footprintWKT
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/footprintWKT-2025-07-10
label	Footprint WKT (IRI)
definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:formation
term_iri	http://rs.tdwg.org/dwc/terms/formation
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/formation-2023-09-13
label	Formation
definition	The full name of the lithostratigraphic formation from which the dwc:MaterialEntity was collected.
examples	`Notch Peak Formation` `House Limestone` `Fillmore Formation`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:FossilSpecimen
term_iri	http://rs.tdwg.org/dwc/terms/FossilSpecimen
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/FossilSpecimen-2023-09-18
label	Fossil Specimen
definition	A preserved specimen that is a fossil.
examples	`a body fossil` `a coprolite` `a gastrolith` `an ichnofossil` `a piece of a petrified tree`
abcd_equivalence	RecordBasisEnum/FossileSpecimen
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwciri:fromLithostratigraphicUnit
term_iri	http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/fromLithostratigraphicUnit-2015-03-27
label	From Lithostratigraphic Unit
definition	Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property

term_name dwciri:fundingAttribution
term_iri	http://rs.tdwg.org/dwc/iri/fundingAttribution
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/fundingAttribution-2025-07-10
label	Funding Attribution (IRI)
definition	An organization or agency that provided funding for a project.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name ac:fundingAttribution
term_iri	http://rs.tdwg.org/ac/terms/fundingAttribution
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/ac/terms/version/fundingAttribution-2020-01-27
label	Funding Attribution
definition	Text description of organizations or individuals who funded the creation of the resource.
notes	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`Artsdatabanken` `National Science Foundation` `Norges forskningsråd` `Ocean Census \| Nippon Foundation`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:fundingAttributionID
term_iri	http://rs.tdwg.org/dwc/terms/fundingAttributionID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/fundingAttributionID-2026-05-26
label	Funding Attribution ID
definition	An identifier for a dcterms:Agent that financially supported a project.
notes	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Generalizations
term_iri	http://rs.tdwg.org/dwc/terms/Generalizations
modified	2009-04-24
label	Generalizations
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/dataGeneralizations
definition	Actions taken to make the data as shared less specific or complete than in its original form. Suggests that alternative data of highly quality may be available on request.
notes	Examples: "Coordinates generalized from original GPS coordinates to the nearest half degree grid cell", "locality information given only to nearest county".
abcd_equivalence	not in ABCD
type	property

term_name dwc:genericName
term_iri	http://rs.tdwg.org/dwc/terms/genericName
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/genericName-2023-06-28
label	Generic Name
definition	The genus part of the dwc:scientificName without authorship.
notes	For synonyms the accepted genus and the genus part of the name may be different. The term dwc:genericName should be used together with dwc:specificEpithet to form a binomial and with dwc:infraspecificEpithet to form a trinomial. The term dwc:genericName should only be used for combinations. Uninomials of generic rank do not have a dwc:genericName.
examples	`Felis` (for scientificName `Felis concolor`, with accompanying values of `Puma concolor` in acceptedNameUsage and `Puma` in genus)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:genus
term_iri	http://rs.tdwg.org/dwc/terms/genus
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/genus-2023-06-28
label	Genus
definition	The full scientific name of the genus in which the dwc:Taxon is classified.
examples	`Puma` `Monoclea`
abcd_equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Viral/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/GenusOrMonomial}
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:geodeticDatum
term_iri	http://rs.tdwg.org/dwc/terms/geodeticDatum
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/geodeticDatum-2025-06-12
label	Geodetic Datum
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value.
examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/SpatialDatum
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:geodeticDatum
term_iri	http://rs.tdwg.org/dwc/iri/geodeticDatum
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/iri/version/geodeticDatum-2025-06-12
label	Geodetic Datum (IRI)
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value `not recorded`.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:GeologicalContext
term_iri	http://rs.tdwg.org/dwc/terms/GeologicalContext
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/GeologicalContext-2026-05-26
label	Geological Context
definition	A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity.
examples	`a particular lithostratigraphic layer` `a specific chronostratigraphic unit`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:geologicalContextID
term_iri	http://rs.tdwg.org/dwc/terms/geologicalContextID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/geologicalContextID-2023-06-28
label	Geological Context ID
definition	An identifier for the set of information associated with a dwc:GeologicalContext (the location within a geological context, such as stratigraphy). May be a global unique identifier or an identifier specific to the data set.
examples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`
abcd_equivalence	not in ABCD
type	property

term_name dwc:georeferencedBy
term_iri	http://rs.tdwg.org/dwc/terms/georeferencedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferencedBy-2026-05-26
label	Georeferenced By
definition	A name for a dcterms:Agent responsible for providing a georeference.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Brad Millen (ROM)` `Kristina Yamamoto \| Janet Fang`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:georeferencedBy
term_iri	http://rs.tdwg.org/dwc/iri/georeferencedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/georeferencedBy-2026-05-26
label	Georeferenced By (IRI)
definition	An IRI identifying a dcterms:Agent responsible for providing a georeference.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:georeferencedDate
term_iri	http://rs.tdwg.org/dwc/terms/georeferencedDate
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferencedDate-2025-06-12
label	Georeferenced Date
definition	The date on which the dcterms:Location was georeferenced.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2011-10-16_9
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:georeferenceProtocol
term_iri	http://rs.tdwg.org/dwc/iri/georeferenceProtocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/georeferenceProtocol-2026-05-26
label	Georeference Protocol (IRI)
definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:georeferenceProtocol
term_iri	http://rs.tdwg.org/dwc/terms/georeferenceProtocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferenceProtocol-2026-05-26
label	Georeference Protocol
definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinateMethod
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:georeferenceRemarks
term_iri	http://rs.tdwg.org/dwc/terms/georeferenceRemarks
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferenceRemarks-2025-06-12
label	Georeference Remarks
definition	Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
examples	`Assumed distance by road (Hwy. 101)`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceRemarks
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:georeferenceSources
term_iri	http://rs.tdwg.org/dwc/terms/georeferenceSources
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferenceSources-2026-05-26
label	Georeference Sources
definition	A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`GeoLocate`, `GeoPick` `https://www.geonames.org/` `USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceSources
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:georeferenceSources
term_iri	http://rs.tdwg.org/dwc/iri/georeferenceSources
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/georeferenceSources-2026-05-26
label	Georeference Sources (IRI)
definition	An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
notes	Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:georeferenceVerificationStatus
term_iri	http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/georeferenceVerificationStatus-2025-07-10
label	Georeference Verification Status (IRI)
definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:georeferenceVerificationStatus
term_iri	http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/georeferenceVerificationStatus-2023-06-28
label	Georeference Verification Status
definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`unable to georeference` `requires georeference` `requires verification` `verified by data custodian` `verified by contributor`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceVerificationStatus
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

term_name dwc:group
term_iri	http://rs.tdwg.org/dwc/terms/group
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/group-2023-09-13
label	Group
definition	The full name of the lithostratigraphic group from which the dwc:MaterialEntity was collected.
examples	`Bathurst` `Lower Wealden`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:habitat
term_iri	http://rs.tdwg.org/dwc/terms/habitat
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/habitat-2023-06-28
label	Habitat
definition	A category or description of the habitat in which the dwc:Event occurred.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`oak savanna` `pre-cordilleran steppe`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Biotope/Text
type	property

term_name dwciri:habitat
term_iri	http://rs.tdwg.org/dwc/iri/habitat
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/habitat-2025-07-10
label	Habitat (IRI)
definition	A category or description of the habitat in which the dwc:Event occurred.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:higherClassification
term_iri	http://rs.tdwg.org/dwc/terms/higherClassification
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/higherClassification-2023-06-28
label	Higher Classification
definition	A list (concatenated and separated) of taxa names terminating at the rank immediately superior to the referenced dwc:Taxon.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from the highest taxonomic rank to the lowest.
examples	`Plantae \| Tracheophyta \| Magnoliopsida \| Ranunculales \| Ranunculaceae \| Ranunculus` `Animalia` `Animalia \| Chordata \| Vertebrata \| Mammalia \| Theria \| Eutheria \| Rodentia \| Hystricognatha \| Hystricognathi \| Ctenomyidae \| Ctenomyini \| Ctenomys`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:higherGeography
term_iri	http://rs.tdwg.org/dwc/terms/higherGeography
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/higherGeography-2023-06-28
label	Higher Geography
definition	A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from least specific to most specific.
examples	`North Atlantic Ocean` `South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos` with accompanying values `South America` (continent) `Argentina` (country), `Neuquén` (first order division), and `Los Lagos` (second order division)
abcd_equivalence	{DataSets/DataSet/Units/Unit/Gathering/LocalityText or DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName}
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:higherGeographyID
term_iri	http://rs.tdwg.org/dwc/terms/higherGeographyID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/higherGeographyID-2023-06-28
label	Higher Geography ID
definition	An identifier for the geographic region within which the dcterms:Location occurred.
notes	Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
examples	`http://vocab.getty.edu/tgn/1002002` (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).
abcd_equivalence	not in ABCD
type	property

term_name dwc:HigherTaxon
term_iri	http://rs.tdwg.org/dwc/terms/HigherTaxon
modified	2009-08-24
label	Higher Taxon
	term_deprecated
definition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than the ScientificName.
notes	Example: "Animalia, Chordata, Vertebrata, Mammalia, Theria, Eutheria, Rodentia, Hystricognatha, Hystricognathi, Ctenomyidae, Ctenomyini, Ctenomys".
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
type	property

term_name dwc:higherTaxonconceptID
term_iri	http://rs.tdwg.org/dwc/terms/higherTaxonconceptID
modified	2009-08-24
label	Higher Taxon Concept ID
	term_deprecated
definition	A unique identifier for the taxon concept less specific than that given in the taxonConceptID.
abcd_equivalence	not in ABCD
type	property

term_name dwc:HigherTaxonID
term_iri	http://rs.tdwg.org/dwc/terms/HigherTaxonID
modified	2009-08-24
label	Higher Taxon ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
definition	A global unique identifier for the parent to the taxon.
abcd_equivalence	not in ABCD
type	property

term_name dwc:higherTaxonName
term_iri	http://rs.tdwg.org/dwc/terms/higherTaxonName
modified	2009-08-24
label	Higher Taxon Name
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/higherClassification
definition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than that given in the scientificName.
notes	Example: "Animalia; Chordata; Vertebrata; Mammalia; Theria; Eutheria; Rodentia; Hystricognatha; Hystricognathi; Ctenomyidae; Ctenomyini; Ctenomys"
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
type	property

term_name dwc:higherTaxonNameID
term_iri	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
modified	2009-08-24
label	Higher Taxon Name ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/parentNameUsageID
definition	A unique identifier for the name of the next higher rank than the scientificName in a taxonomic classification. See higherTaxonName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:highestBiostratigraphicZone
term_iri	http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/highestBiostratigraphicZone-2023-09-13
label	Highest Biostratigraphic Zone
definition	The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Blancan`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:HumanObservation
term_iri	http://rs.tdwg.org/dwc/terms/HumanObservation
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/HumanObservation-2023-09-18
label	Human Observation
definition	An output of a human observation process.
examples	`evidence of a dwc:Occurrence taken from field notes or literature` `a record of a dwc:Occurrence without physical evidence or evidence captured with a machine`
abcd_equivalence	RecordBasisEnum/HumanObservation
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwc:Identification
term_iri	http://rs.tdwg.org/dwc/terms/Identification
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Identification-2026-05-26
label	Identification
definition	A classification of a resource according to a classification scheme.
notes	For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
examples	`a subspecies determination of an organism` `a nomenclatural act designating a specimen as a holotype`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:identificationAttributes
term_iri	http://rs.tdwg.org/dwc/terms/identificationAttributes
modified	2009-10-09
label	Identification Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Identification.
notes	Example: "natureOfID=expert identification; identificationEvidence=cytochrome B sequence"
abcd_equivalence	not in ABCD
type	property

term_name dwc:identificationID
term_iri	http://rs.tdwg.org/dwc/terms/identificationID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationID-2026-05-26
label	Identification ID
definition	An identifier for a dwc:Identification.
notes	Recommended best practice is to use a globally unique identifier.
examples	`9992`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:identificationQualifier
term_iri	http://rs.tdwg.org/dwc/iri/identificationQualifier
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/identificationQualifier-2025-07-10
label	Identification Qualifier (IRI)
definition	A controlled value to express the determiner's doubts about the dwc:Identification.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:identificationQualifier
term_iri	http://rs.tdwg.org/dwc/terms/identificationQualifier
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationQualifier-2023-06-28
label	Identification Qualifier
definition	A brief phrase or a standard term ("cf.", "aff.") to express the determiner's doubts about the dwc:Identification.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`aff. agrifolia var. oxyadenia` (for `Quercus aff. agrifolia var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank) `cf. var. oxyadenia` (for `Quercus agrifolia cf. var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank)
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/IdentificationQualifier
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

term_name dwc:identificationReferences
term_iri	http://rs.tdwg.org/dwc/terms/identificationReferences
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationReferences-2026-05-26
label	Identification References
definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/References
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:identificationRemarks
term_iri	http://rs.tdwg.org/dwc/terms/identificationRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationRemarks-2023-06-28
label	Identification Remarks
definition	Comments or notes about the dwc:Identification.
examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Notes
type	property

term_name dwc:identificationType
term_iri	http://rs.tdwg.org/dwc/terms/identificationType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationType-2026-05-26
label	Identification Type
definition	A category that best matches the nature of a dwc:Identification.
notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`geography` `taxonomicRevision` `functionalAttributes` `nucleotideAnalysis` `karyotype` `media` `relationship` `features` `fineFeatures` `unknown`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:identificationType
term_iri	http://rs.tdwg.org/dwc/iri/identificationType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/identificationType-2026-05-26
label	Identification Type (IRI)
definition	A category that best matches the nature of a dwc:Identification.
notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:identificationVerificationStatus
term_iri	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identificationVerificationStatus-2026-05-26
label	Identification Verification Status
definition	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`0` (unverified in HISPID/ABCD)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2011-10-16_10
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:identificationVerificationStatus
term_iri	http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/identificationVerificationStatus-2026-05-26
label	Identification Verification Status (IRI)
definition	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:identifiedBy
term_iri	http://rs.tdwg.org/dwc/terms/identifiedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identifiedBy-2026-05-26
label	Identified By
definition	A name for a dcterms:Agent responsible for making a dwc:Identification.
notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey` `MegaDetector V5`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Identifiers/IdentifiersText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:identifiedBy
term_iri	http://rs.tdwg.org/dwc/iri/identifiedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/identifiedBy-2026-05-26
label	Identified By (IRI)
definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:identifiedByID
term_iri	http://rs.tdwg.org/dwc/terms/identifiedByID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/identifiedByID-2026-05-26
label	Identified By ID
definition	An identifier for a dcterms:Agent responsible for making a dwc:Identification.
notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:inCollection
term_iri	http://rs.tdwg.org/dwc/iri/inCollection
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/inCollection-2015-03-27
label	In Collection
definition	Use to link any subject resource that is part of a collection to the collection containing the resource.
notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property

term_name dwciri:inDataset
term_iri	http://rs.tdwg.org/dwc/iri/inDataset
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/inDataset-2015-03-27
label	In Dataset
definition	Use to link a subject dataset record to the dataset which contains it.
notes	A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property

term_name dwciri:inDescribedPlace
term_iri	http://rs.tdwg.org/dwc/iri/inDescribedPlace
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/inDescribedPlace-2015-03-27
label	In Described Place
definition	Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
examples	`http://vocab.getty.edu/tgn/1019987`
abcd_equivalence	not in ABCD
type	property

term_name dwc:individualCount
term_iri	http://rs.tdwg.org/dwc/terms/individualCount
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/individualCount-2023-06-28
label	Individual Count
definition	The number of individuals present at the time of the dwc:Occurrence.
examples	`0` `1` `25`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue
type	property

term_name dwc:individualID
term_iri	http://rs.tdwg.org/dwc/terms/individualID
modified	2014-10-23
label	Individual ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/organismID
definition	An identifier for an individual or named group of individual organisms represented in the Occurrence. Meant to accommodate resampling of the same individual or group for monitoring purposes. May be a global unique identifier or an identifier specific to a data set.
notes	Examples: "U.amer. 44", "Smedley", "Orca J 23"
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/NamedIndividual or DataSets/DataSet/Units/Unit/ObservationUnit/ObservationUnitIdentifiers/ObservationUnitIdentifier or DataSets/DataSet/Units/Unit/SpecimenUnit/Accessions/AccessionNumber
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwciri:informationWithheld
term_iri	http://rs.tdwg.org/dwc/iri/informationWithheld
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/informationWithheld-2026-05-26
label	Information Withheld (IRI)
definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:informationWithheld
term_iri	http://rs.tdwg.org/dwc/terms/informationWithheld
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/informationWithheld-2026-05-26
label	Information Withheld
definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
abcd_equivalence	DataSets/DataSet/Units/Unit/InformationWithheld
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:infragenericEpithet
term_iri	http://rs.tdwg.org/dwc/terms/infragenericEpithet
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/infragenericEpithet-2023-06-28
label	Infrageneric Epithet
definition	The infrageneric part of a binomial name at ranks above species but below genus.
notes	The term dwc:infragenericEpithet should be used in conjunction with dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank and dwc:scientificNameAuthorship to represent the individual elements of the complete dwc:scientificName. It can be used to indicate the subgenus placement of a species, which in zoology is often given in parentheses. Can also be used to share infrageneric names such as botanical sections (e.g., `Vicia sect. Cracca`).
examples	`Abacetillus` (for scientificName `Abacetus (Abacetillus) ambiguus`) `Cracca` (for scientificName `Vicia sect. Cracca`)
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Bacterial/Subgenus (for bacterial names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/Subgenus (for zoological names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet (for botanical names)
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:infraspecificEpithet
term_iri	http://rs.tdwg.org/dwc/terms/infraspecificEpithet
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/infraspecificEpithet-2026-05-26
label	Infraspecific Epithet
definition	The name of the lowest or terminal infraspecific of the dwc:scientificName.
notes	In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string `Indigofera charlieriana subsp. sessilis var. scaberrima` is `scaberrima` and the dwc:scientificName is `Indigofera charlieriana var. scaberrima`. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
examples	`concolor` (for scientificName `Puma concolor concolor`) `oxyadenia` (for scientificName `Quercus agrifolia var. oxyadenia`) `laxa` (for scientificName `Cheilanthes hirta f. laxa`) `scaberrima` (for scientificName `Indigofera charlieriana var. scaberrima`)
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SubspeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/SecondEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SubspeciesEpithet
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:institutionCode
term_iri	http://rs.tdwg.org/dwc/terms/institutionCode
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/institutionCode-2026-05-26
label	Institution Code
definition	A name (or acronym) in use by an institution having custody of a resource.
notes	The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
examples	`MVZ` `FMNH` `CLO` `UCMP` `National Museum of Kenya` `Kew Gardens`
abcd_equivalence	DataSets/DataSet/Units/Unit/SourceInstitutionID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:institutionID
term_iri	http://rs.tdwg.org/dwc/terms/institutionID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/institutionID-2026-05-26
label	Institution ID
definition	An identifier for an organization.
notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
examples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://www.gbif.org/grscicoll/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`
abcd_equivalence	DataSets/DataSet/Units/Unit/SourceInstitutionID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:isAcceptedIdentification
term_iri	http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/isAcceptedIdentification-2026-05-26
label	Is Accepted Identification
definition	An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
examples	`true` `false`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:island
term_iri	http://rs.tdwg.org/dwc/terms/island
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/island-2023-06-28
label	Island
definition	The name of the island on or near which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
examples	`Nosy Be` `Bikini Atoll` `Vancouver` `Viti Levu` `Zanzibar`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:islandGroup
term_iri	http://rs.tdwg.org/dwc/terms/islandGroup
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/islandGroup-2023-06-28
label	Island Group
definition	The name of the island group in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
examples	`Alexander Archipelago` `Archipiélago Diego Ramírez` `Seychelles`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island group
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:kingdom
term_iri	http://rs.tdwg.org/dwc/terms/kingdom
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/kingdom-2023-06-28
label	Kingdom
definition	The full scientific name of the kingdom in which the dwc:Taxon is classified.
examples	`Animalia` `Archaea` `Bacteria` `Chromista` `Fungi` `Plantae` `Protozoa` `Viruses`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = regnum
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dcterms:language
term_iri	http://purl.org/dc/terms/language
modified	2008-01-14
term_version_iri	http://dublincore.org/usage/terms/history/#languageT-001
label	Language
definition	A language of the resource.
notes	Recommended best practice is to use an IRI from the Library of Congress ISO 639-2 scheme http://id.loc.gov/vocabulary/iso639-2
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

term_name dc:language
term_iri	http://purl.org/dc/elements/1.1/language
modified	2023-06-28
term_version_iri	http://dublincore.org/usage/terms/history/#language-007
label	Language
definition	A language of the resource.
notes	Recommended best practice is to use a controlled vocabulary such as RFC 5646. This term has an equivalent in the dcterms: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`en` (for English) `es` (for Spanish)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

term_name dwc:latestAgeOrHighestStage
term_iri	http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/latestAgeOrHighestStage-2023-09-13
label	Latest Age Or Highest Stage
definition	The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Atlantic` `Boreal` `Skullrockian`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:LatestDateCollected
term_iri	http://rs.tdwg.org/dwc/terms/LatestDateCollected
modified	2009-04-24
label	Latest Date Collected
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventDate
definition	The latest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
type	property

term_name dwc:latestEonOrHighestEonothem
term_iri	http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/latestEonOrHighestEonothem-2026-05-26
label	Latest Eon Or Highest Eonothem
definition	The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Phanerozoic` `Proterozoic` `Precambrian`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:latestEpochOrHighestSeries
term_iri	http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/latestEpochOrHighestSeries-2023-09-13
label	Latest Epoch Or Highest Series
definition	The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Holocene` `Pleistocene` `Ibexian Series`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:latestEraOrHighestErathem
term_iri	http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/latestEraOrHighestErathem-2023-09-13
label	Latest Era Or Highest Erathem
definition	The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Cenozoic` `Mesozoic`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:latestGeochronologicalEra
term_iri	http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/iri/version/latestGeochronologicalEra-2023-09-13
label	Latest Geochronological Era
definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:latestPeriodOrHighestSystem
term_iri	http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/latestPeriodOrHighestSystem-2023-09-13
label	Latest Period Or Highest System
definition	The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Neogene` `Tertiary` `Quaternary`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dcterms:license
term_iri	http://purl.org/dc/terms/license
modified	2023-06-28
term_version_iri	http://dublincore.org/usage/terms/history/#license-002
label	License
definition	A legal document giving official permission to do something with the resource.
examples	`http://creativecommons.org/publicdomain/zero/1.0/legalcode` `http://creativecommons.org/licenses/by/4.0/legalcode`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-11-06_17
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:lifeStage
term_iri	http://rs.tdwg.org/dwc/terms/lifeStage
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/lifeStage-2026-05-26
label	Life Stage
definition	An age class or life stage of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`zygote` `larva` `juvenile` `adult` `seedling` `flowering` `fruiting`
abcd_equivalence	DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalSexualStage or DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalLiveStages/MycologicalLiveStage or DataSets/DataSet/Units/Unit/ZoologicalUnit/PhasesOrStages/PhaseOrStage
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:lifeStage
term_iri	http://rs.tdwg.org/dwc/iri/lifeStage
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/lifeStage-2026-05-26
label	Life Stage (IRI)
definition	An age class or life stage of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:lithostratigraphicTerms
term_iri	http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/lithostratigraphicTerms-2025-06-12
label	Lithostratigraphic Terms
definition	The combination of all lithostratigraphic names for the rock from which the dwc:MaterialEntity was collected.
examples	`Pleistocene-Weichselien`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy/LithostratigraphicTerms
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:LivingSpecimen
term_iri	http://rs.tdwg.org/dwc/terms/LivingSpecimen
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/LivingSpecimen-2023-09-18
label	Living Specimen
definition	A specimen that is alive.
examples	`a living plant in a botanical garden` `a living animal in a zoo`
abcd_equivalence	RecordBasisEnum/LivingSpecimen
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwc:locality
term_iri	http://rs.tdwg.org/dwc/terms/locality
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/locality-2023-06-28
label	Locality
definition	The specific description of the place.
notes	Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description.
examples	`Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)` `Queets Rainforest, Olympic National Park`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dcterms:Location
term_iri	http://purl.org/dc/terms/Location
modified	2023-09-18
term_version_iri	http://dublincore.org/usage/terms/history/#Location-001
label	Location
definition	A spatial region or named place.
examples	`the municipality of San Carlos de Bariloche, Río Negro, Argentina` `the place defined by a georeference`
abcd_equivalence	not in ABCD
type	class

term_name dwciri:locationAccordingTo
term_iri	http://rs.tdwg.org/dwc/iri/locationAccordingTo
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/locationAccordingTo-2025-07-10
label	Location According To (IRI)
definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:locationAccordingTo
term_iri	http://rs.tdwg.org/dwc/terms/locationAccordingTo
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/locationAccordingTo-2023-06-28
label	Location According To
definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Getty Thesaurus of Geographic Names` `GADM`
abcd_equivalence	not in ABCD
type	property

term_name dwc:locationAttributes
term_iri	http://rs.tdwg.org/dwc/terms/locationAttributes
modified	2014-10-23
label	Location Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the location.
notes	Example: "aspectheading=277; slopeindegrees=6"
abcd_equivalence	not in ABCD
type	property

term_name dwc:locationID
term_iri	http://rs.tdwg.org/dwc/terms/locationID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/locationID-2026-05-26
label	Location ID
definition	An identifier for a dcterms:Location.
notes	Recommended best practice is to use a globally unique identifier.
examples	`https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:locationRemarks
term_iri	http://rs.tdwg.org/dwc/terms/locationRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/locationRemarks-2023-06-28
label	Location Remarks
definition	Comments or notes about the dcterms:Location.
examples	`under water since 2005`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
type	property

term_name dwc:lowestBiostratigraphicZone
term_iri	http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/lowestBiostratigraphicZone-2023-09-13
label	Lowest Biostratigraphic Zone
definition	The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
examples	`Maastrichtian`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:MachineObservation
term_iri	http://rs.tdwg.org/dwc/terms/MachineObservation
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MachineObservation-2023-09-18
label	Machine Observation
definition	An output of a machine observation process.
examples	`a photograph` `a video` `an audio recording` `a remote sensing image` `a dwc:Occurrence record based on telemetry`
abcd_equivalence	RecordBasisEnum/MachineObservation
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwc:MaterialCitation
term_iri	http://rs.tdwg.org/dwc/terms/MaterialCitation
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MaterialCitation-2023-09-18
label	Material Citation
definition	A reference to or citation of one, a part of, or multiple specimens in scholarly publications.
notes	This class constitutes a new value for the controlled vocabulary in the recommendations for basisOfRecord. When importing Darwin Core Archives of literature-based datasets to GBIF, the basisOfRecord should be changed from "Occurrence", "PreservedSpecimen" or "Literature" to "MaterialCitation".
examples	`a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication` `a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication`
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

term_name dwc:MaterialEntity
term_iri	http://rs.tdwg.org/dwc/terms/MaterialEntity
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MaterialEntity-2026-05-26
label	Material Entity
definition	An entity that can be identified, exists for some period of time, and consists in whole or in part of physical matter while it exists.
notes	The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
examples	`the entire contents of a trawl` `a subset of the contents of a trawl` `the body of a fish` `the stomach contents of a fish` `a rock containing fossils` `a fossil within a rock` `an herbarium sheet with its attached plant specimen` `a flower on a plant specimen` `a pollen grain` `a specific water sample` `an isolated molecule of DNA`
abcd_equivalence	not in ABCD (Specimen Unit, when used to denote a class of things, appears to be a broadly construed subclass.)
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:materialEntityCategory
term_iri	http://rs.tdwg.org/dwc/iri/materialEntityCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/materialEntityCategory-2026-05-26
label	Material Entity Category (IRI)
definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:materialEntityCategory
term_iri	http://rs.tdwg.org/dwc/terms/materialEntityCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/materialEntityCategory-2026-05-26
label	Material Entity Category
definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
notes	Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`liveOrganism`, `deadOrganism`, `partOfOrganism`, `nonMolecularBiologicalExtract`, `molecularBiologicalExtract`, `mineral`, `rock`, `fossil`, `chemical`, `humanArtifactWithBiologicalConstituent`, `humanArtifactWithoutBiologicalConstituent`, and `mixed`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:materialEntityID
term_iri	http://rs.tdwg.org/dwc/terms/materialEntityID
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/materialEntityID-2023-09-13
label	Material Entity ID
definition	An identifier for a particular instance of a dwc:MaterialEntity.
notes	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (the dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
examples	`06809dc5-f143-459a-be1a-6f03e63fc083`
abcd_equivalence	Unit/UnitGUID or Unit/UnitID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:materialEntityRemarks
term_iri	http://rs.tdwg.org/dwc/terms/materialEntityRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/materialEntityRemarks-2026-05-26
label	Material Entity Remarks
definition	Comments or notes about a dwc:MaterialEntity.
examples	`found in association with charred remains` `some original fragments missing`
abcd_equivalence	DataSets/DataSet/Units/Unit/Notes
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:materialEntityType
term_iri	http://rs.tdwg.org/dwc/iri/materialEntityType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/materialEntityType-2026-05-26
label	Material Entity Type (IRI)
definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:materialEntityType
term_iri	http://rs.tdwg.org/dwc/terms/materialEntityType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/materialEntityType-2026-05-26
label	Material Entity Type
definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
abcd_equivalence	skos:closeMatch to /DataSets/DataSet/Units/Unit/KindOfUnit. ABCD structural considerations prevent an exactMatch.
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:MaterialSample
term_iri	http://rs.tdwg.org/dwc/terms/MaterialSample
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MaterialSample-2023-09-13
label	Material Sample
definition	A material entity that represents an entity of interest in whole or in part.
examples	`a whole organism preserved in a collection` `a part of an organism isolated for some purpose` `a soil sample` `a marine microbial sample`
abcd_equivalence	DataSets/DataSet/Units/Unit
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2013-10-09_11
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:materialSampleID
term_iri	http://rs.tdwg.org/dwc/terms/materialSampleID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/materialSampleID-2023-06-28
label	Material Sample ID
definition	An identifier for the dwc:MaterialSample (as opposed to a particular digital record of the dwc:MaterialSample). In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:materialSampleID globally unique.
notes	Recommended best practice is to use a persistent, globally unique identifier.
examples	`06809dc5-f143-459a-be1a-6f03e63fc083`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2013-10-09_13

term_name dwc:maximumDepthInMeters
term_iri	http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/maximumDepthInMeters-2026-05-26
label	Maximum Depth In Meters
definition	The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
examples	`0` `200`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:maximumDistanceAboveSurfaceInMeters
term_iri	http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/maximumDistanceAboveSurfaceInMeters-2023-06-28
label	Maximum Distance Above Surface In Meters
definition	The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
type	property

term_name dwc:maximumElevationInMeters
term_iri	http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/maximumElevationInMeters-2026-05-26
label	Maximum Elevation In Meters
definition	The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
examples	`-205` `1236`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:measurementAccuracy
term_iri	http://rs.tdwg.org/dwc/terms/measurementAccuracy
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementAccuracy-2023-06-28
label	Measurement Accuracy
definition	The description of the potential error associated with the dwc:measurementValue.
examples	`0.01` `normal distribution with variation of 2 m`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:measurementDeterminedBy
term_iri	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedBy-2023-06-28
label	Measurement Determined By
definition	A list (concatenated and separated) of names of people, groups, or organizations who determined the value of the dwc:MeasurementOrFact.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwciri:measurementDeterminedBy
term_iri	http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/measurementDeterminedBy-2025-07-10
label	Measurement Determined By (IRI)
definition	A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:measurementDeterminedDate
term_iri	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedDate-2025-06-12
label	Measurement Determined Date
definition	The date on which the dwc:MeasurementOrFact was made.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:measurementID
term_iri	http://rs.tdwg.org/dwc/terms/measurementID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementID-2023-06-28
label	Measurement ID
definition	An identifier for the dwc:MeasurementOrFact (information pertaining to measurements, facts, characteristics, or assertions). May be a global unique identifier or an identifier specific to the data set.
examples	`9c752d22-b09a-11e8-96f8-529269fb1459`
abcd_equivalence	not in ABCD
type	property

term_name dwc:measurementMethod
term_iri	http://rs.tdwg.org/dwc/terms/measurementMethod
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementMethod-2023-06-28
label	Measurement Method
definition	A description of or reference to (publication, URI) the method or protocol used to determine the measurement, fact, characteristic, or assertion.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`minimum convex polygon around burrow entrances` (for a home range area) `barometric altimeter` (for an elevation)
abcd_equivalence	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:measurementMethod
term_iri	http://rs.tdwg.org/dwc/iri/measurementMethod
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/measurementMethod-2025-07-10
label	Measurement Method (IRI)
definition	The method or protocol used to determine the measurement, fact, characteristic, or assertion.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:MeasurementOrFact
term_iri	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MeasurementOrFact-2023-09-13
label	Measurement Or Fact
definition	A measurement of or fact about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
abcd_equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:measurementRemarks
term_iri	http://rs.tdwg.org/dwc/terms/measurementRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementRemarks-2023-06-28
label	Measurement Remarks
definition	Comments or notes accompanying the dwc:MeasurementOrFact.
examples	`tip of tail missing`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:measurementType
term_iri	http://rs.tdwg.org/dwc/iri/measurementType
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/measurementType-2025-07-10
label	Measurement Type (IRI)
definition	The nature of the measurement, fact, characteristic, or assertion.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:measurementType
term_iri	http://rs.tdwg.org/dwc/terms/measurementType
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementType-2023-06-28
label	Measurement Type
definition	The nature of the measurement, fact, characteristic, or assertion.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`tail length` `temperature` `trap line length` `survey area` `trap type`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:measurementUnit
term_iri	http://rs.tdwg.org/dwc/terms/measurementUnit
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementUnit-2023-06-28
label	Measurement Unit
definition	The units associated with the dwc:measurementValue.
notes	Recommended best practice is to use the International System of Units (SI). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`m` `g` `l` `°C` `mm` `km²` `%` `hh:mm:ss`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:measurementUnit
term_iri	http://rs.tdwg.org/dwc/iri/measurementUnit
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/iri/version/measurementUnit-2023-06-28
label	Measurement Unit (IRI)
definition	The units associated with the dwc:measurementValue.
notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
abcd_equivalence	not in ABCD
type	property

term_name dwc:measurementValue
term_iri	http://rs.tdwg.org/dwc/terms/measurementValue
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/measurementValue-2023-06-28
label	Measurement Value
definition	The value of the measurement, fact, characteristic, or assertion.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`45` `20` `1` `14.5` `UV-light`
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:measurementValue
term_iri	http://rs.tdwg.org/dwc/iri/measurementValue
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/measurementValue-2025-07-10
label	Measurement Value (IRI)
definition	The value of the measurement, fact, characteristic, or assertion.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name ac:Media
term_iri	http://rs.tdwg.org/ac/terms/Media
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/ac/terms/version/Media-2026-02-24
label	Media Entity
definition	A digital or physical media resource.
notes	An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
examples	`dcmi:Sound` `dcmi:StillImage` `dcmi:MovingImage` `dcmi:InteractiveResource` `ac:Digital3DResource`
abcd_equivalence	This term is equivalent to the ABCD term http://rs.tdwg.org/abcd/terms/MultimediaObject .
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:member
term_iri	http://rs.tdwg.org/dwc/terms/member
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/member-2023-09-13
label	Member
definition	The full name of the lithostratigraphic member from which the dwc:MaterialEntity was collected.
examples	`Lava Dam Member` `Hellnmaria Member`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:minimumDepthInMeters
term_iri	http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/minimumDepthInMeters-2026-05-26
label	Minimum Depth In Meters
definition	The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
examples	`0` `100`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:minimumDistanceAboveSurfaceInMeters
term_iri	http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/minimumDistanceAboveSurfaceInMeters-2023-06-28
label	Minimum Distance Above Surface In Meters
definition	The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue
type	property

term_name dwc:minimumElevationInMeters
term_iri	http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/minimumElevationInMeters-2026-05-26
label	Minimum Elevation In Meters
definition	The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
examples	`-100` `802`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dcterms:modified
term_iri	http://purl.org/dc/terms/modified
modified	2025-06-12
term_version_iri	http://dublincore.org/usage/terms/history/#modified-003
label	Date Modified
definition	Date on which the resource was changed.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55

term_name dwc:MolecularProtocol
term_iri	http://rs.tdwg.org/dwc/terms/MolecularProtocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/MolecularProtocol-2026-05-26
label	Molecular Protocol
definition	A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
examples	`a standard DNA barcoding workflow using Sanger sequencing` `a shotgun metagenomics pipeline for microbial community profiling` `a high-throughput amplicon sequencing protocol targeting 16S rRNA`
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:molecularProtocolID
term_iri	http://rs.tdwg.org/dwc/terms/molecularProtocolID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/molecularProtocolID-2026-05-26
label	Molecular Protocol ID
definition	An identifier for a dwc:MolecularProtocol.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:month
term_iri	http://rs.tdwg.org/dwc/terms/month
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/month-2023-06-28
label	Month
definition	The integer month in which the dwc:Event occurred.
examples	`1` (January) `10` (October)
abcd_equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
type	property

term_name dwc:municipality
term_iri	http://rs.tdwg.org/dwc/terms/municipality
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/municipality-2023-06-28
label	Third Order Division
definition	The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`Holzminden` `Araçatuba` `Ga-Segonyana`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:nameAccordingTo
term_iri	http://rs.tdwg.org/dwc/terms/nameAccordingTo
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/nameAccordingTo-2026-05-26
label	Name According To
definition	The reference to the source in which the specific taxon concept circumscription is defined or implied - traditionally signified by the Latin "sensu" or "sec." (from secundum, meaning "according to"). For taxa that result from identifications, a reference to the keys, monographs, experts and other sources should be given.
notes	This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by `sensu` or `sec.`, it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
examples	`Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236.` (as the full citation of the Franz & Cardona-Duque (2013) in Perelleschus splendida sec. Franz & Cardona-Duque (2013))
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:nameAccordingToID
term_iri	http://rs.tdwg.org/dwc/terms/nameAccordingToID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/nameAccordingToID-2023-06-28
label	Name According To ID
definition	An identifier for the source in which the specific taxon concept circumscription is defined or implied. See dwc:nameAccordingTo.
examples	`https://doi.org/10.1016/S0269-915X(97)80026-2`
abcd_equivalence	not in ABCD
type	property

term_name dwc:namePublicationID
term_iri	http://rs.tdwg.org/dwc/terms/namePublicationID
modified	2009-09-21
label	Name Publication ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/namePublishedInID
definition	A resolvable globally unique identifier for the original publication of the scientificName.
notes	Example: "http://hdl.handle.net/10199/7"
abcd_equivalence	not in ABCD
type	property

term_name dwc:namePublishedIn
term_iri	http://rs.tdwg.org/dwc/terms/namePublishedIn
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/namePublishedIn-2023-06-28
label	Name Published In
definition	A reference for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedIn should be empty.
examples	`Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:namePublishedInID
term_iri	http://rs.tdwg.org/dwc/terms/namePublishedInID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/namePublishedInID-2023-06-28
label	Name Published In ID
definition	An identifier for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedInID should be empty.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dwc:namePublishedInYear
term_iri	http://rs.tdwg.org/dwc/terms/namePublishedInYear
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/namePublishedInYear-2023-06-28
label	Name Published In Year
definition	The four-digit year in which the dwc:scientificName was published.
examples	`1915` `2008`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2011-10-16_8
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:nomenclaturalCode
term_iri	http://rs.tdwg.org/dwc/terms/nomenclaturalCode
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/nomenclaturalCode-2023-06-28
label	Nomenclatural Code
definition	The nomenclatural code (or codes in the case of an ambiregnal name) under which the dwc:scientificName is constructed.
notes	Recommended best practice is to use a controlled vocabulary.
examples	`ICN` `ICZN` `BC` `ICNCP` `BioCode`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/Code
type	property

term_name dwc:nomenclaturalStatus
term_iri	http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/nomenclaturalStatus-2023-06-28
label	Nomenclatural Status
definition	The status related to the original publication of the name and its conformance to the relevant rules of nomenclature. It is based essentially on an algorithm according to the business rules of the code. It requires no taxonomic opinion.
examples	`nom. ambig.` `nom. illeg.` `nom. subnud.`
abcd_equivalence	(DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation) pro parte
type	property

term_name dwc:NucleotideAnalysis
term_iri	http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/NucleotideAnalysis-2026-05-26
label	Nucleotide Analysis
definition	A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:NucleotideSequence
term_iri	http://rs.tdwg.org/dwc/terms/NucleotideSequence
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/NucleotideSequence-2026-05-26
label	Nucleotide Sequence
definition	A digital representation of a nucleotide sequence.
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:nucleotideSequenceRemarks
term_iri	http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/nucleotideSequenceRemarks-2026-05-26
label	Nucleotide Sequence Remarks
definition	Comments or notes about a dwc:NucleotideSequence.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:objectQuantity
term_iri	http://rs.tdwg.org/dwc/terms/objectQuantity
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/objectQuantity-2026-05-26
label	Object Quantity
definition	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
notes	An dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:objectQuantityType
term_iri	http://rs.tdwg.org/dwc/iri/objectQuantityType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/objectQuantityType-2026-05-26
label	Object Quantity Type (IRI)
definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:objectQuantityType
term_iri	http://rs.tdwg.org/dwc/terms/objectQuantityType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/objectQuantityType-2026-05-26
label	Object Quantity Type
definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Occurrence
term_iri	http://rs.tdwg.org/dwc/terms/Occurrence
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Occurrence-2026-05-26
label	Occurrence
definition	A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
notes	In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
examples	`a wolf pack on the shore of Kluane Lake in 1988` `a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23` `a fungus in Central Park in the summer of 1929` `a male lance-tailed manakin in a courtship display on Isla Boca Brava`
abcd_equivalence	DataSets/DataSet/Units/Unit
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:occurrenceAttributes
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceAttributes
modified	2009-10-09
label	Occurrence Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Occurrence.
notes	Examples: "Tragus length: 14mm; Weight: 120g", "Height: 1-1.5 meters tall; flowers yellow; uncommon".
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts
type	property

term_name dwc:occurrenceDetails
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceDetails
modified	2009-10-09
label	Occurrence Details
	term_deprecated
definition	A reference (publication, URI) to the most detailed information available about the Occurrence.
notes	Example: "http://mvzarctos.berkeley.edu/guid/MVZ:Mamm:165861"
abcd_equivalence	DataSets/DataSet/Units/Unit/RecordURI
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2011-10-16_7

term_name dwc:occurrenceID
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/occurrenceID-2026-05-26
label	Occurrence ID
definition	An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
notes	In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
examples	`https://arctos.database.museum/guid/MSB:Mamm:231731?seid=966527` `3854b337a-da0b-483f-a1c7-107403bdbb40` `http://n2t.net/ark:/65665/3854b337a-da0b-483f-a1c7-107403bdbb40`
abcd_equivalence	DataSets/DataSet/Units/Unit/UnitGUID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:OccurrenceMeasurement
term_iri	http://rs.tdwg.org/dwc/terms/OccurrenceMeasurement
modified	2009-10-09
label	Occurrence Measurement
	term_deprecated
definition	The category of information pertaining to measurements accociated with an occurrence.
abcd_equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
type	class

term_name dwc:occurrenceMeasurementAccuracy
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
modified	2009-10-09
label	Occurrence Measurement Accuracy
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementAccuracy
definition	The description of the error associated with the occurrenceAttributeValue.
notes	Example: "0.01", "normal distribution with variation of 2 m"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property

term_name dwc:occurrenceMeasurementDeterminedBy
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
modified	2009-10-09
label	Occurrence Measurement Determined By
	term_deprecated
definition	The agent responsible for having determined the value of the measurement or characteristic of the occurrence.
notes	Example: "Javier de la Torre"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
type	property

term_name dwc:occurrenceMeasurementDeterminedDate
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
modified	2009-10-09
label	Occurrence Measurement Determined Date
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
definition	The date on which the the measurement or characteristic of the occurrence was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
type	property

term_name dwc:occurrenceMeasurementID
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementID
modified	2009-10-09
label	Occurrence Measurement ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementID
definition	An identifier for the occurrence attribute. May be a global unique identifier or an identifier specific to the data set.
abcd_equivalence	not in ABCD
type	property

term_name dwc:occurrenceMeasurementRemarks
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementRemarks
modified	2009-10-09
label	Occurrence Measurement Remarks
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementRemarks
definition	Comments or notes accompanying the measurement or characteristic of the occurrence.
notes	Example: "tip of tail missing"
abcd_equivalence	not in ABCD
type	property

term_name dwc:occurrenceMeasurementType
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementType
modified	2009-10-09
label	Occurrence Measurement Type
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementType
definition	The nature of the measurement or characteristic of the occurrence. Recommended best practice is to use a controlled vocabulary.
notes	Example: "tail length"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property

term_name dwc:occurrenceMeasurementUnit
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
modified	2009-10-09
label	Occurrence Measurement Unit
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementUnit
definition	The units for the value of the measurement or characteristic of the occurrence. Recommended best practice is to use International System of Units (SI) units.
notes	Example: "mm"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property

term_name dwc:occurrenceMeasurementValue
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
modified	2009-10-09
label	Occurrence Measurement Value
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/measurementValue
definition	The value of the measurement or characteristic of the occurrence.
notes	Example: "45"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
type	property

term_name dwc:occurrenceRemarks
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/occurrenceRemarks-2023-06-28
label	Occurrence Remarks
definition	Comments or notes about the dwc:Occurrence.
examples	`found dead on road`
abcd_equivalence	DataSets/DataSet/Units/Unit/Notes
type	property

term_name dwciri:occurrenceStatus
term_iri	http://rs.tdwg.org/dwc/iri/occurrenceStatus
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/occurrenceStatus-2026-05-26
label	Occurrence Status (IRI)
definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:occurrenceStatus
term_iri	http://rs.tdwg.org/dwc/terms/occurrenceStatus
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/occurrenceStatus-2026-05-26
label	Occurrence Status
definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
notes	For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`detected` `notDetected`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:order
term_iri	http://rs.tdwg.org/dwc/terms/order
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/order-2023-06-28
label	Order
definition	The full scientific name of the order in which the dwc:Taxon is classified.
examples	`Carnivora` `Monocleales`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = ordo
type	property

term_name dwc:Organism
term_iri	http://rs.tdwg.org/dwc/terms/Organism
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Organism-2026-05-26
label	Organism
definition	A particular organism or defined group of organisms considered to be taxonomically homogeneous.
notes	Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
examples	`a specific bird` `a specific wolf pack` `a specific instance of a bacterial culture` `a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection`
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismID
term_iri	http://rs.tdwg.org/dwc/terms/organismID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismID-2023-06-28
label	Organism ID
definition	An identifier for the dwc:Organism instance (as opposed to a particular digital record of the dwc:Organism). May be a globally unique identifier or an identifier specific to the data set.
examples	`http://arctos.database.museum/guid/WNMU:Mamm:1249`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

term_name dwc:OrganismInteraction
term_iri	http://rs.tdwg.org/dwc/terms/OrganismInteraction
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/OrganismInteraction-2026-05-26
label	Organism Interaction
definition	An interaction between two dwc:Organisms during a dwc:Event.
notes	Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
examples	`a bee visiting a flower` `a Mallophora ruficauda hunting an Apis mellifera in flight` `a viral infection in a plant` `a female spider mating with a male spider` `a lion cub nursing from its mother` `a mosquito sucking blood from a chimpanzee's arm` `a slug eating a fungus growing on decomposing stump (2 interactions)`
abcd_equivalence	/abcd:DataSets/abcd:DataSet/abcd:Units/abcd:Unit/abcd:Associations/abcd:UnitAssociation
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismInteractionDescription
term_iri	http://rs.tdwg.org/dwc/terms/organismInteractionDescription
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismInteractionDescription-2026-05-26
label	Organism Interaction Description
definition	A verbatim description of a dwc:OrganismInteraction.
examples	`Mallophora ruficauda captured an Apis mellifera worker in flight.`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismInteractionID
term_iri	http://rs.tdwg.org/dwc/terms/organismInteractionID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismInteractionID-2026-05-26
label	Organism Interaction ID
definition	An identifier for a dwc:OrganismInteraction.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismInteractionType
term_iri	http://rs.tdwg.org/dwc/terms/organismInteractionType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismInteractionType-2026-05-26
label	Organism Interaction Type
definition	A category that best matches the nature of a dwc:OrganismInteraction.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`visitedFlowerOf` `parasitized` `matedWith` `wasAttachedTo`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:organismInteractionType
term_iri	http://rs.tdwg.org/dwc/iri/organismInteractionType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/organismInteractionType-2026-05-26
label	Organism Interaction Type (IRI)
definition	A category that best matches the nature of a dwc:OrganismInteraction.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismName
term_iri	http://rs.tdwg.org/dwc/terms/organismName
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismName-2023-06-28
label	Organism Name
definition	A textual name or label assigned to a dwc:Organism instance.
examples	`Huberta` `Boab Prison Tree` `J pod`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

term_name dwc:organismQuantity
term_iri	http://rs.tdwg.org/dwc/terms/organismQuantity
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismQuantity-2023-06-28
label	Organism Quantity
definition	A number or enumeration value for the quantity of dwc:Organisms.
notes	A dwc:organismQuantity must have a corresponding dwc:organismQuantityType.
examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

term_name dwciri:organismQuantityType
term_iri	http://rs.tdwg.org/dwc/iri/organismQuantityType
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/organismQuantityType-2015-03-27
label	Organism Quantity Type (IRI)
definition	The type of quantification system used for the quantity of organisms.
notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
abcd_equivalence	not in ABCD
type	property

term_name dwc:organismQuantityType
term_iri	http://rs.tdwg.org/dwc/terms/organismQuantityType
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismQuantityType-2023-06-28
label	Organism Quantity Type
definition	The type of quantification system used for the quantity of dwc:Organisms.
notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

term_name dwc:organismRemarks
term_iri	http://rs.tdwg.org/dwc/terms/organismRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismRemarks-2023-06-28
label	Organism Remarks
definition	Comments or notes about the dwc:Organism instance.
examples	`One of a litter of six`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

term_name dwciri:organismScope
term_iri	http://rs.tdwg.org/dwc/iri/organismScope
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/organismScope-2026-05-26
label	Organism Scope (IRI)
definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
notes	Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:organismScope
term_iri	http://rs.tdwg.org/dwc/terms/organismScope
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/organismScope-2023-06-28
label	Organism Scope
definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
notes	Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. To describe the kind of dwc:Organism using a URI object in RDF, use rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type) instead.
examples	`multicellular organism` `virus` `clone` `pack` `colony`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

term_name dwc:originalNameUsage
term_iri	http://rs.tdwg.org/dwc/terms/originalNameUsage
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/originalNameUsage-2023-06-28
label	Original Name Usage
definition	The taxon name, with authorship and date information if known, as it originally appeared when first established under the rules of the associated dwc:nomenclaturalCode. The basionym (botany) or basonym (bacteriology) of the dwc:scientificName or the senior/earlier homonym for replaced names.
notes	The full scientific name, with authorship and date information if known, of the name usage in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would indicate the basionym of a record representing a subsequent combination. Unlike basionyms, however, this term can apply to scientific names at all ranks.
examples	`Pinus abies` `Gasterosteus saltatrix Linnaeus 1768`
abcd_equivalence	not in ABCD
type	property

term_name dwc:originalNameUsageID
term_iri	http://rs.tdwg.org/dwc/terms/originalNameUsageID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/originalNameUsageID-2023-06-28
label	Original Name Usage ID
definition	An identifier for the name usage (documented meaning of the name according to a source) in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
notes	This term should be used to refer to the dwc:taxonID of a dwc:Taxon record that represents the usage of the terminal element of the dwc:scientificName as originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would establish the relationship between a record representing a subsequent combination and the record for its corresponding basionym. Unlike basionyms, however, this term can apply to scientific names at all ranks. For Darwin Core Archives the related record should be present locally in the same archive.
examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
abcd_equivalence	not in ABCD
type	property

term_name dwc:otherCatalogNumbers
term_iri	http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/otherCatalogNumbers-2026-05-26
label	Other Catalog Numbers
definition	A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`FMNH:Mammal:1234` `NPS YELLO6778 \| MBG 33424`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/History/PreviousUnitsText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:ownerInstitutionCode
term_iri	http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/ownerInstitutionCode-2026-05-26
label	Owner Institution Code
definition	A name (or acronym) in use by an institution having ownership of a resource.
examples	`NPS` `APN` `InBio`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:parentEventID
term_iri	http://rs.tdwg.org/dwc/terms/parentEventID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/parentEventID-2026-05-26
label	Parent Event ID
definition	An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
notes	Recommended best practice is to use a globally unique identifier.
examples	`A1` (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - `A1:1`, `A1:2`).
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:parentMeasurementID
term_iri	http://rs.tdwg.org/dwc/terms/parentMeasurementID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/parentMeasurementID-2023-06-28
label	Parent Measurement ID
definition	An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts.
notes	May be a globally unique identifier or an identifier specific to the data set.
examples	`9c752d22-b09a-11e8-96f8-529269fb1459` `E1_E1_O1_M1`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dwc:parentNameUsage
term_iri	http://rs.tdwg.org/dwc/terms/parentNameUsage
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/parentNameUsage-2023-06-28
label	Parent Name Usage
definition	The full name, with authorship and date information if known, of the direct, most proximate higher-rank parent dwc:Taxon (in a classification) of the most specific element of the dwc:scientificName.
examples	`Rubiaceae` `Gruiformes` `Testudinae`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
type	property

term_name dwc:parentNameUsageID
term_iri	http://rs.tdwg.org/dwc/terms/parentNameUsageID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/parentNameUsageID-2023-06-28
label	Parent Name Usage ID
definition	An identifier for the name usage (documented meaning of the name according to a source) of the direct, most proximate higher-rank parent taxon (in a classification) of the most specific element of the dwc:scientificName.
notes	This term should be used for accepted names to refer to the dwc:taxonID of a dwc:Taxon record that represents the next higher taxon rank in the same taxonomic classification. For Darwin Core Archives the related record should be present locally in the same archive.
examples	`tsn:41074` (ITIS) `urn:lsid:ipni.org:names:30001404-2` (IPNI) `2704173` (GBIF) `6T8N` (COL)
abcd_equivalence	not in ABCD
type	property

term_name dwciri:pathway
term_iri	http://rs.tdwg.org/dwc/iri/pathway
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/pathway-2025-07-10
label	Pathway (IRI)
definition	The process by which a dwc:Organism came to be in a given place at a given time.
notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
examples	`http://rs.tdwg.org/dwcpw/values/p002` `http://rs.tdwg.org/dwcpw/values/p046`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_23
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:pathway
term_iri	http://rs.tdwg.org/dwc/terms/pathway
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/pathway-2023-06-28
label	Pathway
definition	The process by which a dwc:Organism came to be in a given place at a given time.
notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`releasedForUse` `otherEscape` `transportContaminant` `transportStowaway` `corridor` `unaided`
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2020-10-13_23

term_name dwc:phylum
term_iri	http://rs.tdwg.org/dwc/terms/phylum
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/phylum-2023-06-28
label	Phylum
definition	The full scientific name of the phylum or division in which the dwc:Taxon is classified.
examples	`Chordata` (phylum) `Bryophyta` (division)
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = phylum
type	property

term_name dwc:pointRadiusSpatialFit
term_iri	http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/pointRadiusSpatialFit-2026-05-26
label	Point Radius Spatial Fit
definition	A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
examples	`0` `1` `1.5708`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/PointRadiusSpatialFit
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:preferredSpatialRepresentation
term_iri	http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/preferredSpatialRepresentation-2026-05-26
label	Preferred Spatial Representation
definition	An indication of which spatial representation best represents the dcterms:Location.
examples	`point-radius` `footprint`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:preferredSpatialRepresentation
term_iri	http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/preferredSpatialRepresentation-2026-05-26
label	Preferred Spatial Representation (IRI)
definition	An indication of which spatial representation best represents the dcterms:Location.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:preparations
term_iri	http://rs.tdwg.org/dwc/terms/preparations
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/preparations-2026-05-26
label	Preparations
definition	A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`fossil` `cast` `photograph` `DNA extract` `skin \| skull \| skeleton` `whole animal (EtOH) \| tissue (EDTA)`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/Preparations/PreparationsText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:preparations
term_iri	http://rs.tdwg.org/dwc/iri/preparations
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/preparations-2025-07-10
label	Preparations (IRI)
definition	A preparation or preservation method for a specimen.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:PreservedSpecimen
term_iri	http://rs.tdwg.org/dwc/terms/PreservedSpecimen
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/PreservedSpecimen-2023-09-18
label	Preserved Specimen
definition	A specimen that has been preserved.
examples	`a plant on an herbarium sheet` `a cataloged lot of fish in a jar`
abcd_equivalence	RecordBasisEnum/PreservedSpecimen
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwc:PreviousIdentifications
term_iri	http://rs.tdwg.org/dwc/terms/PreviousIdentifications
modified	2009-04-24
label	Previous Identifications
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/previousIdentifications
definition	A list (concatenated and separated) of previous ScientificNames to which the sample was identified.
notes	Example: "Anthus correndera".
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
type	property

term_name dwc:previousIdentifications
term_iri	http://rs.tdwg.org/dwc/terms/previousIdentifications
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/previousIdentifications-2023-06-28
label	Previous Identifications
definition	A list (concatenated and separated) of previous assignments of names to the dwc:Organism.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`Chalepidae` `Pinus abies` `Anthus sp., field ID by G. Iglesias \| Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwc:processedTotalReadCount
term_iri	http://rs.tdwg.org/dwc/terms/processedTotalReadCount
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/processedTotalReadCount-2026-05-26
label	Processed Total Read Count
definition	The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
examples	`50638`, `345987`, `764032`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:projectID
term_iri	http://rs.tdwg.org/dwc/terms/projectID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/projectID-2026-05-26
label	Project ID
definition	A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
notes	A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`https://arvenetternansen.com/` `https://doi.org/10.26259/3b15eca7` `https://doi.org/10.3030/101180559` `OC202405` `RCN276730` `RCN276730 \| Artsproject_7-24`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:projectTitle
term_iri	http://rs.tdwg.org/dwc/terms/projectTitle
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/projectTitle-2026-05-26
label	Project Title
definition	A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
notes	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`Arctic Deep` `Scalidophora i Noreg` `The Nansen Legacy` `Underwater Oases of the Mar del Plata Canyon: Talud Continental IV`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Project/ProjectTitle
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Protocol
term_iri	http://rs.tdwg.org/dwc/terms/Protocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Protocol-2026-05-26
label	Protocol
definition	A method used during an action.
examples	`a pitfall trap method for sampling ground-dwelling arthropods` `a point-radius georeferencing method` `a linear regression model to estimate body mass from skeletal measurements` `a Bayesian phylogenetic inference method`
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:protocolDescription
term_iri	http://rs.tdwg.org/dwc/terms/protocolDescription
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/protocolDescription-2026-05-26
label	Protocol Description
definition	A detailed description of a dwc:Protocol.
examples	`Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:protocolID
term_iri	http://rs.tdwg.org/dwc/terms/protocolID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/protocolID-2026-05-26
label	Protocol ID
definition	An identifier for a dwc:Protocol.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:protocolReferences
term_iri	http://rs.tdwg.org/dwc/terms/protocolReferences
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/protocolReferences-2026-05-26
label	Protocol References
definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:protocolRemarks
term_iri	http://rs.tdwg.org/dwc/terms/protocolRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/protocolRemarks-2026-05-26
label	Protocol Remarks
definition	Comments or notes about a dwc:Protocol.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:protocolType
term_iri	http://rs.tdwg.org/dwc/terms/protocolType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/protocolType-2026-05-26
label	Protocol Type
definition	A category that best matches the nature of a dwc:Protocol.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`measurement` `georeference` `chronometricAge` `chronometricAgeConversion` `samplingEffort`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:protocolType
term_iri	http://rs.tdwg.org/dwc/iri/protocolType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/protocolType-2026-05-26
label	Protocol Type (IRI)
definition	A category that best matches the nature of a dwc:Protocol.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:Provenance
term_iri	http://rs.tdwg.org/dwc/terms/Provenance
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Provenance-2026-05-26
label	Provenance
definition	Information about an entity’s origins.
notes	This is a convenience class to group related properties.
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:readCount
term_iri	http://rs.tdwg.org/dwc/terms/readCount
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/readCount-2026-05-26
label	Read Count
definition	The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
examples	`325` `73591` `8302`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:recordedBy
term_iri	http://rs.tdwg.org/dwc/terms/recordedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/recordedBy-2026-05-26
label	Recorded By
definition	A name for a dcterms:Agent responsible for recording a dwc:Occurrence.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `Megatherium Club` `The Natural History Society of Northumbria` `ROV SuBastian`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/GatheringAgents/GatheringAgentsText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:recordedBy
term_iri	http://rs.tdwg.org/dwc/iri/recordedBy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/recordedBy-2026-05-26
label	Recorded By (IRI)
definition	An IRI identifying a dcterms:Agent responsible for recording a dwc:Occurrence.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:recordedByID
term_iri	http://rs.tdwg.org/dwc/terms/recordedByID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/recordedByID-2026-05-26
label	Recorded By ID
definition	An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:recordNumber
term_iri	http://rs.tdwg.org/dwc/iri/recordNumber
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/iri/version/recordNumber-2023-06-28
label	Record Number (IRI)
definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
notes	The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
abcd_equivalence	not in ABCD
type	property

term_name dwc:recordNumber
term_iri	http://rs.tdwg.org/dwc/terms/recordNumber
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/recordNumber-2023-06-28
label	Record Number
definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`OPP 7101`
abcd_equivalence	DataSets/DataSet/Units/Unit/CollectorsFieldNumber
type	property

term_name dwc:referenceID
term_iri	http://rs.tdwg.org/dwc/terms/referenceID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/referenceID-2026-05-26
label	Reference ID
definition	An identifier for a dcterms:BibliographicResource.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:referenceRemarks
term_iri	http://rs.tdwg.org/dwc/terms/referenceRemarks
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/referenceRemarks-2026-05-26
label	Reference Remarks
definition	Comments or notes about a dcterms:BibliographicResource.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dcterms:references
term_iri	http://purl.org/dc/terms/references
modified	2026-05-26
term_version_iri	http://dublincore.org/usage/terms/history/#references-003
label	References
definition	A related resource that is referenced, cited, or otherwise pointed to by the described resource.
notes	From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
examples	`http://arctos.database.museum/guid/MVZ:Mamm:165861` (MaterialEntity example) `https://www.catalogueoflife.org/data/taxon/32664 (Taxon example)`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2011-10-16_7
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:referenceType
term_iri	http://rs.tdwg.org/dwc/terms/referenceType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/referenceType-2026-05-26
label	Reference Type
definition	A category that best matches the nature of a dcterms:BibliographicResource.
notes	Recommended best practice is to use a controlled vocabulary.
examples	`book`, `bookSection`, `journalArticle`, `thesis` `proceedingsPaper` `report` `poster` `fieldNotebook` `log` `oralCommunication`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:RelatedBasisOfRecord
term_iri	http://rs.tdwg.org/dwc/terms/RelatedBasisOfRecord
modified	2009-01-26
label	Related Basis of Record
	term_deprecated
definition	The nature of the related resource. Recommended best practice is to use the same controlled vocabulary as for basisOfRecord.
notes	Example: "PreservedSpecimen"
abcd_equivalence	not in ABCD
type	property

term_name dwc:relatedResourceID
term_iri	http://rs.tdwg.org/dwc/terms/relatedResourceID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relatedResourceID-2026-05-26
label	Related Resource ID
definition	An identifier for the related resource (the object) of a dwc:ResourceRelationship.
notes	Recommended best practice is to use a globally unique identifier.
examples	`dc609808-b09b-11e8-96f8-529269fb1459`
abcd_equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:relatedResourceType
term_iri	http://rs.tdwg.org/dwc/terms/relatedResourceType
modified	2009-10-09
label	Related Resource Type
	term_deprecated
definition	The type of the related resource. Recommended best practice is to use a controlled vocabulary.
notes	Examples: "StillImage", "MovingImage", "Sound", PhysicalObject", "PreservedSpecimen", FossilSpecimen", LivingSpecimen", "HumanObservation", "MachineObservation", "Location", "Taxonomy", "NomeclaturalChecklist", "Publication"
abcd_equivalence	not in ABCD
type	property

term_name dwc:relationshipAccordingTo
term_iri	http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
modified	2018-09-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relationshipAccordingTo-2018-09-06
label	Relationship According To
definition	The source (person, organization, publication, reference) establishing the relationship between the two resources.
examples	`Julie Woodruff`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:relationshipEstablishedDate
term_iri	http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relationshipEstablishedDate-2025-06-12
label	Relationship Established Date
definition	The date-time on which the relationship between the two resources was established.
notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:relationshipOfResource
term_iri	http://rs.tdwg.org/dwc/terms/relationshipOfResource
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relationshipOfResource-2023-06-28
label	Relationship Of Resource
definition	The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID).
notes	Recommended best practice is to use a controlled vocabulary.
examples	`same as` `duplicate of` `mother of` `offspring of` `sibling of` `parasite of` `host of` `valid synonym of` `located within` `pollinator of members of taxon` `pollinated specific plant` `pollinated by members of taxon` `on slab with`
abcd_equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociationType
type	property

term_name dwc:relationshipOfResourceID
term_iri	http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relationshipOfResourceID-2023-06-28
label	Relationship Of Resource ID
definition	An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID.
notes	Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology.
examples	`http://purl.obolibrary.org/obo/RO_0002456` (for the relation `pollinated by`) `http://purl.obolibrary.org/obo/RO_0002455` (for the relation `pollinates`) `https://www.inaturalist.org/observation_fields/879` (for the relation `eaten by`)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

term_name dwc:relationshipRemarks
term_iri	http://rs.tdwg.org/dwc/terms/relationshipRemarks
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/relationshipRemarks-2023-06-28
label	Relationship Remarks
definition	Comments or notes about the relationship between the two resources.
examples	`mother and offspring collected from the same nest` `pollinator captured in the act`
abcd_equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/Comments
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwciri:reproductiveCondition
term_iri	http://rs.tdwg.org/dwc/iri/reproductiveCondition
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/reproductiveCondition-2026-05-26
label	Reproductive Condition (IRI)
definition	A reproductive condition of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:reproductiveCondition
term_iri	http://rs.tdwg.org/dwc/terms/reproductiveCondition
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/reproductiveCondition-2026-05-26
label	Reproductive Condition
definition	A reproductive condition of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`non-reproductive` `pregnant` `in bloom` `fruit-bearing`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:resourceID
term_iri	http://rs.tdwg.org/dwc/terms/resourceID
modified	2018-09-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/resourceID-2018-09-06
label	Resource ID
definition	An identifier for the resource that is the subject of the relationship.
examples	`f809b9e0-b09b-11e8-96f8-529269fb1459`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:ResourceRelationship
term_iri	http://rs.tdwg.org/dwc/terms/ResourceRelationship
modified	2023-09-13
term_version_iri	http://rs.tdwg.org/dwc/terms/version/ResourceRelationship-2023-09-13
label	Resource Relationship
definition	A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another.
notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
examples	`an instance of a dwc:Organism is the mother of another instance of a dwc:Organism` `a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence` `a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity`
abcd_equivalence	DataSets/DataSet/Units/Unit/Associations
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

term_name dwc:resourceRelationshipID
term_iri	http://rs.tdwg.org/dwc/terms/resourceRelationshipID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/resourceRelationshipID-2026-05-26
label	Resource Relationship ID
definition	An identifier for a dwc:ResourceRelationship.
notes	Recommended best practice is to use a globally unique identifier.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dcterms:rights
term_iri	http://purl.org/dc/terms/rights
modified	2008-01-14
label	Rights
	term_deprecated
term_replaced_by	http://purl.org/dc/terms/license
definition	Information about rights held in and over the resource.
notes	Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-11-06_17
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dcterms:rightsHolder
term_iri	http://purl.org/dc/terms/rightsHolder
modified	2008-01-14
term_version_iri	http://dublincore.org/usage/terms/history/#rightsHolder-002
label	Rights Holder
definition	A person or organization owning or managing rights over the resource.
examples	`The Regents of the University of California`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:Sample
term_iri	http://rs.tdwg.org/dwc/terms/Sample
modified	2009-04-29
label	Sample
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/Occurrence
definition	Container class for information about the results of a sampling event (specimen, observation, etc.)
abcd_equivalence	DataSets/DataSet/Units/Unit
type	class

term_name dwc:SampleAttribute
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttribute
modified	2009-04-29
label	Sample Attribute
	term_deprecated
definition	Container class for information about attributes related to a given sample.
abcd_equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
type	class

term_name dwc:SampleAttributeAccuracy
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeAccuracy
modified	2009-04-29
label	Sample Attribute Accuracy
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
definition	The description of the error associated with the SampleAttributeValue.
notes	Example: "0.01", "normal distribution with variation of 2 m"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
type	property

term_name dwc:SampleAttributeDeterminedBy
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedBy
modified	2009-04-29
label	Sample Attribute Determined By
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
definition	The agent responsible for having determined the value of the measurement or characteristic of the sample.
notes	Example: "Javier de la Torre"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
type	property

term_name dwc:SampleAttributeDeterminedDate
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedDate
modified	2009-04-29
label	Sample Attribute Determined Date
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
definition	The date on which the the measurement or characteristic of the sample was made.
notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
type	property

term_name dwc:SampleAttributeRemarks
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeRemarks
modified	2009-04-29
label	Sample Attribute Remarks
	term_deprecated
definition	Comments or notes accompanying the measurement or characteristic of the sample.
notes	Example: "tip of tail missing"
abcd_equivalence	not in ABCD
type	property

term_name dwc:SampleAttributeUnit
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeUnit
modified	2009-04-29
label	Sample Attribute Unit
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
definition	The units for the value of the measurement or characteristic of the sample. Recommended best practice is to use International System of Units (SI) units.
notes	Example: "mm"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
type	property

term_name dwc:SampleAttributeValue
term_iri	http://rs.tdwg.org/dwc/terms/SampleAttributeValue
modified	2009-04-29
label	Sample Attribute Value
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
definition	The value of the measurement or characteristic of the sample.
notes	Example: "45"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
type	property

term_name dwciri:sampledSubstrateCategory
term_iri	http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateCategory-2026-05-26
label	Sampled Substrate Category (IRI)
definition	A category or type of substrate sampled during a dwc:Event.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:sampledSubstrateCategory
term_iri	http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateCategory-2026-05-26
label	Sampled Substrate Category
definition	A category or type of substrate sampled during a dwc:Event.
notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`vegetation` `soil` `ocean`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:sampledSubstrateLayer
term_iri	http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateLayer-2026-05-26
label	Sampled Substrate Layer
definition	A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`forest floor` `herbaceous \| shrub` `understory` `canopy` `organic (O)` `surface (A)` `eluviated (E)` `subsoil (B)` `parent material (C)` `bedrock (R)` `epipelagic \| mesopelagic` `bathypelagic` `abysopelagic` `hadalpelagic`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:sampledSubstrateLayer
term_iri	http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateLayer-2026-05-26
label	Sampled Substrate Layer (IRI)
definition	An IRI identifying a substrate layer sampled during a dwc:Event.
notes	Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:SampleRemarks
term_iri	http://rs.tdwg.org/dwc/terms/SampleRemarks
modified	2009-04-29
label	Sample Remarks
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
definition	Comments or notes about the sample or record.
notes	Example: "found dead on road"
abcd_equivalence	DataSets/DataSet/Units/Unit/Notes
type	property

term_name dwc:sampleSizeUnit
term_iri	http://rs.tdwg.org/dwc/terms/sampleSizeUnit
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sampleSizeUnit-2023-06-28
label	Sample Size Unit
definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
notes	A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., `5` for dwc:sampleSizeValue with `m` for dwc:sampleSizeUnit. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`minute` `hour` `day` `metre` `square metre` `cubic metre`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

term_name dwciri:sampleSizeUnit
term_iri	http://rs.tdwg.org/dwc/iri/sampleSizeUnit
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/sampleSizeUnit-2025-07-10
label	Sampling Size Unit (IRI)
definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
notes	A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:sampleSizeValue
term_iri	http://rs.tdwg.org/dwc/terms/sampleSizeValue
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sampleSizeValue-2023-06-28
label	Sample Size Value
definition	A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
notes	A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit.
examples	`5` (sampleSizeValue) with `metre` (sampleSizeUnit)
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

term_name dwc:SamplingAttributeID
term_iri	http://rs.tdwg.org/dwc/terms/SamplingAttributeID
modified	2009-04-29
label	Sample Attribute ID
	term_deprecated
definition	An identifier for the sampling attribute. May be a global unique identifier or an identifier specific to the data set.
abcd_equivalence	not in ABCD
type	property

term_name dwc:SamplingAttributeType
term_iri	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
modified	2009-04-29
label	Sample Attribute Type
	term_deprecated
definition	The nature of the measurement or characteristic of the sample. Recommended best practice is to use a controlled vocabulary.
notes	Example: "tail length"
abcd_equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
type	property

term_name dwc:samplingEffort
term_iri	http://rs.tdwg.org/dwc/terms/samplingEffort
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/samplingEffort-2023-06-28
label	Sampling Effort
definition	The amount of effort expended during a dwc:Event.
examples	`40 trap-nights` `10 observer-hours` `10 km by foot` `30 km by car`
abcd_equivalence	not in ABCD
type	property

term_name dwc:SamplingEvent
term_iri	http://rs.tdwg.org/dwc/terms/SamplingEvent
modified	2009-04-29
label	Sampling Event
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/Event
definition	Container class for information about the conditions and methods of acquisition of samples.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering
type	class

term_name dwc:SamplingEventAttributes
term_iri	http://rs.tdwg.org/dwc/terms/SamplingEventAttributes
modified	2009-04-29
label	Sampling Event Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements or characteristics of the sampling event.
notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
type	property

term_name dwc:SamplingEventID
term_iri	http://rs.tdwg.org/dwc/terms/SamplingEventID
modified	2009-04-29
label	Sampling Event ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventID
definition	An identifier for the sampling event. May be a global unique identifier or an identifier specific to the data set.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
type	property

term_name dwc:SamplingEventRemarks
term_iri	http://rs.tdwg.org/dwc/terms/SamplingEventRemarks
modified	2009-04-29
label	Sampling Event Remarks
	term_deprecated
definition	Comments or notes about the sampling event.
notes	Example: "found dead on road"
abcd_equivalence	not in ABCD
type	property

term_name dwc:SamplingLocation
term_iri	http://rs.tdwg.org/dwc/terms/SamplingLocation
modified	2009-04-29
label	Sampling Location
	term_deprecated
definition	Container class for information about the location where a sampling event occurred.
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/LocalityText
type	class

term_name dwc:SamplingLocationID
term_iri	http://rs.tdwg.org/dwc/terms/SamplingLocationID
modified	2009-04-29
label	Sampling Location ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/locationID
definition	An identifier for the sampling location. May be a global unique identifier or an identifier specific to the data set.
notes	Example: "MVZ:LocID:12345"
abcd_equivalence	not in ABCD
type	property

term_name dwc:SamplingLocationRemarks
term_iri	http://rs.tdwg.org/dwc/terms/SamplingLocationRemarks
modified	2009-04-29
label	Sampling Location Remarks
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/locationRemarks
definition	Comments or notes about the sampling location.
notes	Example: "under water since 2005"
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
type	property

term_name dwc:samplingProtocol
term_iri	http://rs.tdwg.org/dwc/terms/samplingProtocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/samplingProtocol-2026-05-26
label	Sampling Protocol
definition	The names of, references to, or descriptions of the methods or protocols used during a dwc:Event.
notes	Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`UV light trap` `mist net` `bottom trawl` `ad hoc observation \| point count` `Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x` `Takats et al. 2001. Guidelines for Nocturnal Owl Monitoring in North America. Beaverhill Bird Observatory and Bird Studies Canada, Edmonton, Alberta. 32 pp., http://www.bsc-eoc.org/download/Owl.pdf`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Method
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:samplingProtocol
term_iri	http://rs.tdwg.org/dwc/iri/samplingProtocol
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/samplingProtocol-2026-05-26
label	Sampling Protocol (IRI)
definition	The methods or protocols used during a dwc:Event, denoted by an IRI.
notes	Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:scientificName
term_iri	http://rs.tdwg.org/dwc/terms/scientificName
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/scientificName-2026-05-26
label	Scientific Name
definition	The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
notes	This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign `×` (Unicode `U+00D7`, HTML `×`) to identify a hybrid, not `x` or `X`, if possible.
examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship) `×Agropogon littoralis (Sm.) C. E. Hubb.` `Mentha ×smithiana R. A. Graham` `Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/FullScientificNameString
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:scientificNameAuthorship
term_iri	http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/scientificNameAuthorship-2023-06-28
label	Scientific Name Authorship
definition	The authorship information for the dwc:scientificName formatted according to the conventions of the applicable dwc:nomenclaturalCode.
examples	`(Torr.) J.T. Howell` `(Martinovský) Tzvelev` `(Györfi, 1952)`
abcd_equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/ParentheticalAuthorTeamAndYear + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/AuthorTeamAndYear} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeamParenthesis + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeam} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamOriginalAndYear + [= or] DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamParenthesisAndYear}
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:scientificNameID
term_iri	http://rs.tdwg.org/dwc/terms/scientificNameID
modified	2017-10-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/scientificNameID-2017-10-06
label	Scientific Name ID
definition	An identifier for the nomenclatural (not taxonomic) details of a scientific name.
examples	`urn:lsid:ipni.org:names:37829-1:1.3`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

term_name dwc:scientificNameRank
term_iri	http://rs.tdwg.org/dwc/terms/scientificNameRank
modified	2009-09-21
label	Scientific Name Rank
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/taxonRank
definition	The taxonomic rank of the most specific name in the scientificName. Recommended best practice is to use a controlled vocabulary.
notes	Examples: "subsp.", "var.", "forma", "species", "genus"
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
type	property

term_name dwc:sequence
term_iri	http://rs.tdwg.org/dwc/terms/sequence
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sequence-2026-05-26
label	Sequence
definition	A string representing nucleotide base pairs.
notes	Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
examples	`TCTATCCTCAATTATAGGTCATAATTCACCATCAG`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:sex
term_iri	http://rs.tdwg.org/dwc/terms/sex
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/sex-2026-05-26
label	Sex
definition	A sex of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`female` `male` `hermaphrodite`
abcd_equivalence	DataSets/DataSet/Units/Unit/Sex
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:sex
term_iri	http://rs.tdwg.org/dwc/iri/sex
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/sex-2026-05-26
label	Sex (IRI)
definition	A sex of a dwc:Organism.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:siteNumber
term_iri	http://rs.tdwg.org/dwc/iri/siteNumber
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/siteNumber-2026-05-26
label	Site Number (IRI)
definition	An identifier for a named site.
notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:siteNumber
term_iri	http://rs.tdwg.org/dwc/terms/siteNumber
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/siteNumber-2026-05-26
label	Site Number
definition	An identifier for a named site.
notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`USGS CENO LOC 21387` `UCM 2025001`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:specificEpithet
term_iri	http://rs.tdwg.org/dwc/terms/specificEpithet
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/specificEpithet-2023-06-28
label	Specific Epithet
definition	The name of the first or species epithet of the dwc:scientificName.
examples	`concolor` `gottschei`
abcd_equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SpeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SpeciesEpithet}
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:startDayOfYear
term_iri	http://rs.tdwg.org/dwc/terms/startDayOfYear
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/startDayOfYear-2026-05-26
label	Start Day Of Year
definition	The earliest integer day of the year on which a dwc:Event occurred.
notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberBegin
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:StartTimeOfDay
term_iri	http://rs.tdwg.org/dwc/terms/StartTimeOfDay
modified	2009-04-24
label	Start Time of Day
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/eventTime
definition	The time of day when the event began, expressed as decimal hours from midnight, local time.
notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
abcd_equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
type	property

term_name dwc:stateProvince
term_iri	http://rs.tdwg.org/dwc/terms/stateProvince
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/stateProvince-2023-06-28
label	First Order Division
definition	The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
examples	`Montana` `Minas Gerais` `Córdoba`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= State or = Province (etc.)
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:subfamily
term_iri	http://rs.tdwg.org/dwc/terms/subfamily
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/subfamily-2023-06-28
label	Subfamily
definition	The full scientific name of the subfamily in which the dwc:Taxon is classified.
examples	`Periptyctinae` `Orchidoideae` `Sphindociinae`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName if DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonRank == "subfamilia"
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

term_name dwc:subgenus
term_iri	http://rs.tdwg.org/dwc/terms/subgenus
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/subgenus-2025-06-12
label	Subgenus
definition	The full scientific name of the subgenus in which the dwc:Taxon is classified.
notes	A value for this term should be a complete subgenus name as required by the appropriate nomenclatural code.
examples	`Abacetus (Parastygis)` `Dicranum subgen. Orthodicranum`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:subtribe
term_iri	http://rs.tdwg.org/dwc/terms/subtribe
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/subtribe-2023-06-28
label	Subtribe
definition	The full scientific name of the subtribe in which the dwc:Taxon is classified.
examples	`Plotinini` `Typhaeini`
abcd_equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dwc:superfamily
term_iri	http://rs.tdwg.org/dwc/terms/superfamily
modified	2023-07-07
term_version_iri	http://rs.tdwg.org/dwc/terms/version/superfamily-2023-07-07
label	Superfamily
definition	The full scientific name of the superfamily in which the dwc:Taxon is classified.
notes	A taxonomic category subordinate to an order and superior to a family. According to ICZN article 29.2, the suffix `-oidea` is used for a superfamily name.
examples	`Achatinoidea` `Cerithioidea` `Helicoidea` `Hypsibioidea` `Valvatoidea` `Zonitoidea`
abcd_equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: superfamilia)
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dwc:Taxon
term_iri	http://rs.tdwg.org/dwc/terms/Taxon
modified	2023-09-18
term_version_iri	http://rs.tdwg.org/dwc/terms/version/Taxon-2023-09-18
label	Taxon
definition	A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026) considered by taxonomists to form a homogeneous unit.
examples	`the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820`
abcd_equivalence	no simple equivalent in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

term_name dwc:taxonAccordingTo
term_iri	http://rs.tdwg.org/dwc/terms/taxonAccordingTo
modified	2009-09-21
label	Taxon According To
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/nameAccordingTo
definition	Information about the authorship of this taxon concept which uses the scientificName in their sense (secundum, sensu). Could be a publication (identification key), institution or team of individuals.
abcd_equivalence	not in ABCD
type	property

term_name dwc:taxonAttributes
term_iri	http://rs.tdwg.org/dwc/terms/taxonAttributes
modified	2009-10-09
label	Taxon Attributes
	term_deprecated
definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the taxon.
notes	Example: "iucnstatus=vulnerable; distribution=Neuquen, Argentina"
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/InformalNameString
type	property

term_name dwc:taxonConceptID
term_iri	http://rs.tdwg.org/dwc/terms/taxonConceptID
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonConceptID-2023-06-28
label	Taxon Concept ID
definition	An identifier for the taxonomic concept to which the record refers - not for the nomenclatural details of a dwc:Taxon.
examples	`8fa58e08-08de-4ac1-b69c-1235340b7001`
abcd_equivalence	not in ABCD
type	property

term_name dwc:taxonFormula
term_iri	http://rs.tdwg.org/dwc/terms/taxonFormula
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonFormula-2026-05-26
label	Taxon Formula
definition	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
notes	Recommended best practice is to use a controlled vocabulary.
examples	`A` `not A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:taxonFormula
term_iri	http://rs.tdwg.org/dwc/iri/taxonFormula
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/taxonFormula-2026-05-26
label	Taxon Formula (IRI)
definition	A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:TaxonID
term_iri	http://rs.tdwg.org/dwc/terms/TaxonID
modified	2009-04-24
label	Taxon ID
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/taxonNameID
definition	A global unique identifier for the taxon (name in a classification).
abcd_equivalence	not in ABCD
type	property

</tbody> </table>

term_name dwc:taxonID
term_iri	http://rs.tdwg.org/dwc/terms/taxonID
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonID-2026-05-26
label	Taxon ID
definition	An identifier for a dwc:Taxon.
examples	`8fa58e08-08de-4ac1-b69c-1235340b7001</li>` `32567</code>` `https://www.gbif.org/species/212 </ul></td> </tr>`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:taxonNameID
term_iri	http://rs.tdwg.org/dwc/terms/taxonNameID
modified	2009-07-06
label	Taxon Name ID
	term_deprecated
definition	A unique identifier for the scientificName.
abcd_equivalence	not in ABCD
type	property

term_name dwc:taxonomicStatus
term_iri	http://rs.tdwg.org/dwc/terms/taxonomicStatus
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonomicStatus-2023-06-28
label	Taxonomic Status
definition	The status of the use of the dwc:scientificName as a label for a taxon. Requires taxonomic opinion to define the scope of a dwc:Taxon. Rules of priority then are used to define the taxonomic status of the nomenclature contained in that scope, combined with the experts opinion. It must be linked to a specific taxonomic reference that defines the concept.
notes	Recommended best practice is to use a controlled vocabulary.
examples	`invalid` `misapplied` `homotypic synonym` `accepted`
abcd_equivalence	not in ABCD
type	property

term_name dwc:taxonRank
term_iri	http://rs.tdwg.org/dwc/terms/taxonRank
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonRank-2026-05-26
label	Taxon Rank
definition	The taxonomic rank of the most specific name in the dwc:scientificName.
notes	Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
abcd_equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:taxonRemarks
term_iri	http://rs.tdwg.org/dwc/terms/taxonRemarks
modified	2017-10-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/taxonRemarks-2017-10-06
label	Taxon Remarks
definition	Comments or notes about the taxon or name.
examples	`this name is a misspelling in common use`
abcd_equivalence	not in ABCD
type	property

term_name dwciri:toDigitalSpecimen
term_iri	http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/iri/version/toDigitalSpecimen-2025-06-12
label	To Digital Specimen
definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
notes	Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:toTaxon
term_iri	http://rs.tdwg.org/dwc/iri/toTaxon
modified	2015-03-27
term_version_iri	http://rs.tdwg.org/dwc/iri/version/toTaxon-2015-03-27
label	To Taxon
definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
notes	A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
abcd_equivalence	not in ABCD
type	property

term_name dwc:tribe
term_iri	http://rs.tdwg.org/dwc/terms/tribe
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/tribe-2023-06-28
label	Tribe
definition	The full scientific name of the tribe in which the dwc:Taxon is classified.
examples	`Ortaliini` `Arethuseae`
abcd_equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dc:type
term_iri	http://purl.org/dc/elements/1.1/type
modified	2025-06-12
term_version_iri	http://dublincore.org/usage/terms/history/#type-006
label	Type
definition	The nature or genre of the resource.
notes	Must be populated with a value from the DCMI type vocabulary (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
examples	`StillImage` `MovingImage` `Sound` `PhysicalObject` `Event` `Text`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_20
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dcterms:type
term_iri	http://purl.org/dc/terms/type
modified	2008-01-14
label	Type
	term_deprecated
term_replaced_by	http://purl.org/dc/elements/1.1/type
definition	The nature or genre of the resource.
notes	To provide a string literal value for type, use dc:type rather than this term. In accordance with the Darwin Core RDF guide, rdf:type should be used instead of this term to indicate an IRI value for type.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2009-12-07_1
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_20
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55

term_name dwc:typeOfType
term_iri	http://rs.tdwg.org/dwc/terms/typeOfType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/typeOfType-2026-05-26
label	Type Of Type
definition	A category of nomenclatural type of a dwc:MaterialEntity.
notes	The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`holotype` `isotype`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/TypeStatus
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:typeStatus
term_iri	http://rs.tdwg.org/dwc/terms/typeStatus
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/typeStatus-2023-06-28
label	Type Status
definition	A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

term_name dwciri:typeStatus
term_iri	http://rs.tdwg.org/dwc/iri/typeStatus
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/typeStatus-2025-07-10
label	Type Status (IRI)
definition	A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwc:typifiedName
term_iri	http://rs.tdwg.org/dwc/terms/typifiedName
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/typifiedName-2026-05-26
label	Typified Name
definition	A scientific name for which a specimen or other name is the type.
notes	The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
examples	`Polysiphonia amphibolis Womersley`
abcd_equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/TypifiedName
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:UsagePolicy
term_iri	http://rs.tdwg.org/dwc/terms/UsagePolicy
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/UsagePolicy-2026-05-26
label	Usage Policy
definition	Information about rights, usage, and attribution statements applicable to an entity.
notes	This is a convenience class to group related properties.
abcd_equivalence	not in ABCD
type	class
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimAssertionType
term_iri	http://rs.tdwg.org/dwc/terms/verbatimAssertionType
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimAssertionType-2026-05-26
label	Verbatim Assertion Type
definition	A string representing the type of dwc:Assertion as it appeared in an original record.
notes	This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimCoordinates
term_iri	http://rs.tdwg.org/dwc/terms/verbatimCoordinates
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinates-2026-05-26
label	Verbatim Coordinates
definition	Verbatim original spatial coordinates of a dcterms:Location.
notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
examples	`41 05 54S 121 05 34W` `17T 630000 4833400`
abcd_equivalence	{DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinatesText or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesUTM/UTMText}
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwciri:verbatimCoordinateSystem
term_iri	http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/verbatimCoordinateSystem-2026-05-26
label	Verbatim Coordinate System (IRI)
definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimCoordinateSystem
term_iri	http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinateSystem-2026-05-26
label	Verbatim Coordinate System
definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`decimal degrees` `degrees decimal minutes` `degrees minutes seconds` `UTM`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesGrid/GridCellSystem
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimDepth
term_iri	http://rs.tdwg.org/dwc/terms/verbatimDepth
modified	2017-10-06
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimDepth-2017-10-06
label	Verbatim Depth
definition	The original description of the depth below the local surface.
examples	`100-200 m`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactText
type	property

term_name dwc:verbatimElevation
term_iri	http://rs.tdwg.org/dwc/terms/verbatimElevation
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimElevation-2026-05-26
label	Verbatim Elevation
definition	An original description of the elevation of a dcterms:Location.
examples	`100-200 m`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimEventDate
term_iri	http://rs.tdwg.org/dwc/terms/verbatimEventDate
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimEventDate-2023-06-28
label	Verbatim EventDate
definition	The verbatim original representation of the date and time information for a dwc:Event.
examples	`spring 1910` `Marzo 2002` `1999-03-XX` `17IV1934`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DateText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:verbatimIdentification
term_iri	http://rs.tdwg.org/dwc/terms/verbatimIdentification
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimIdentification-2023-06-28
label	Verbatim Identification
definition	A string representing the taxonomic identification as it appeared in the original record.
notes	This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it.
examples	`Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?` `Potentilla × pantotricha Soják` `Aconitum pilipes × A. variegatum` `Lepomis auritus x cyanellus`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

term_name dwc:verbatimLabel
term_iri	http://rs.tdwg.org/dwc/terms/verbatimLabel
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimLabel-2026-05-26
label	Verbatim Label
definition	A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
notes	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
abcd_equivalence	Marks/Mark/MarkText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimLatitude
term_iri	http://rs.tdwg.org/dwc/terms/verbatimLatitude
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimLatitude-2026-05-26
label	Verbatim Latitude
definition	A verbatim original latitude of a dcterms:Location.
notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
examples	`41 05 54.03S`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLatitude
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimLocality
term_iri	http://rs.tdwg.org/dwc/terms/verbatimLocality
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimLocality-2026-05-26
label	Verbatim Locality
definition	An original textual description of a dcterms:Location.
examples	`25 km NNE Bariloche por R. Nac. 237`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/LocalityText
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimLongitude
term_iri	http://rs.tdwg.org/dwc/terms/verbatimLongitude
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimLongitude-2026-05-26
label	Verbatim Longitude
definition	A verbatim original longitude of a dcterms:Location.
notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
examples	`121d 10' 34" W`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLongitude
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verbatimMeasurementType
term_iri	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimMeasurementType-2025-06-12
label	Verbatim Measurement Type
definition	A string representing the type of measurement or fact as it appeared in the original record.
notes	This term is meant to allow the capture of an unaltered original name for a measurement or fact type. This term is meant to be used in addition to dwc:measurementType, not instead of it.
examples	`water_temp` `Fish biomass` `sampling net mesh size`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:verbatimScientificNameRank
term_iri	http://rs.tdwg.org/dwc/terms/verbatimScientificNameRank
modified	2009-09-21
label	Verbatim Scientific Name Rank
	term_deprecated
term_replaced_by	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
definition	The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
notes	Examples: "Agamospecies", "sub-lesus", "prole", "apomict", "nothogrex".
abcd_equivalence	not in ABCD
type	property

term_name dwciri:verbatimSRS
term_iri	http://rs.tdwg.org/dwc/iri/verbatimSRS
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/iri/version/verbatimSRS-2025-06-12
label	Verbatim SRS (IRI)
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:verbatimSRS
term_iri	http://rs.tdwg.org/dwc/terms/verbatimSRS
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimSRS-2025-06-12
label	Verbatim SRS
definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwc:verbatimTaxonRank
term_iri	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verbatimTaxonRank-2023-06-28
label	Verbatim Taxon Rank
definition	The taxonomic rank of the most specific name in the dwc:scientificName as it appears in the original record.
examples	`Agamospecies` `sub-lesus` `prole` `apomict` `nothogrex` `sp.` `subsp.` `var.`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

term_name dwc:vernacularName
term_iri	http://rs.tdwg.org/dwc/terms/vernacularName
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/vernacularName-2026-05-26
label	Vernacular Name
definition	A common or vernacular name.
examples	`cóndor andino` `death cap` `rainbow trout` `Gänsegeier` `smoky quartz`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:verticalDatum
term_iri	http://rs.tdwg.org/dwc/terms/verticalDatum
modified	2025-06-12
term_version_iri	http://rs.tdwg.org/dwc/terms/version/verticalDatum-2025-06-12
label	Vertical Datum
definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`EGM84` `EGM96` `EGM2008` `PGM2000A` `PGM2004` `PGM2006` `PGM2007` `EPSG:7030` `not recorded`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

term_name dwciri:verticalDatum
term_iri	http://rs.tdwg.org/dwc/iri/verticalDatum
modified	2025-07-10
term_version_iri	http://rs.tdwg.org/dwc/iri/version/verticalDatum-2025-07-10
label	Vertical Datum (IRI)
definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

term_name dwciri:vitality
term_iri	http://rs.tdwg.org/dwc/iri/vitality
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/iri/version/vitality-2026-05-26
label	Vitality (IRI)
definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:vitality
term_iri	http://rs.tdwg.org/dwc/terms/vitality
modified	2026-05-26
term_version_iri	http://rs.tdwg.org/dwc/terms/version/vitality-2026-05-26
label	Vitality
definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
examples	`alive` `dead` `mixedLot` `uncertain` `notAssessed`
abcd_equivalence	not in ABCD
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

term_name dwc:waterBody
term_iri	http://rs.tdwg.org/dwc/terms/waterBody
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/waterBody-2023-06-28
label	Water Body
definition	The name of the water body in which the dcterms:Location occurs.
notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
examples	`Indian Ocean` `Baltic Sea` `Hudson River` `Lago Nahuel Huapi`
abcd_equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Water body
type	property
executive_committee_decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

term_name dwc:year
term_iri	http://rs.tdwg.org/dwc/terms/year
modified	2023-06-28
term_version_iri	http://rs.tdwg.org/dwc/terms/version/year-2023-06-28
label	Year
definition	The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar.
examples	`1160` `2008`
abcd_equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
type	property

On this page

Darwin Core List of Terms

1 Introduction (Informative)

1.1 Status of the content of this document

1.2 RFC 2119 key words

1.3 Namespace abbreviations

2 Use of Terms

3 Term indices

3.1 index_by_term_name

3.2 index_by_label

4 vocabulary