Seznam termínů Darwin Core

Seznam termínů Darwin Core

Název
Seznam termínů Darwin Core
Datum vydání verze
2026-05-26
Datum vytvoření
2020-08-12
Část standardu TDWG
http://www.tdwg.org/standards/450
Tato verze
http://rs.tdwg.org/dwc/doc/list/2026-05-26
Aktuální verze
http://rs.tdwg.org/dwc/doc/list/
Previous version
http://rs.tdwg.org/dwc/doc/list/2025-07-10
Abstrakt
Darwin Core je slovníkový standard pro předávání informací o biologické rozmanitosti. V tomto dokumentu jsou uvedeny všechny termíny ve jmenných prostorech, které se v současné době používají ve slovníku.
Přispěvatelé
John Wieczorek (VertNet), Peter Desmet (Instituut voor Natuur- en Bosonderzoek (INBO)), Steve Baskauf (Vanderbilt University Libraries), Tim Robertson (Global Biodiversity Information Facility), Markus Döring (Global Biodiversity Information Facility), Quentin Groom (Botanic Garden Meise), Stijn Van Hoey (Instituut voor Natuur- en Bosonderzoek (INBO)), David Bloom (VertNet), Paula Zermoglio (VertNet), Robert Guralnick (University of Florida), John Deck (Genomic Biodiversity Working Group), Gail Kampmeier (Illinois Natural History Survey), Dave Vieglais (KU Natural History Museum), Renato De Giovanni (Centro de Referência em Informação Ambiental), Campbell Webb (TDWG RDF/OWL Task Group), Paul J. Morris (Harvard University Herbaria/Museum of Comparative Zoölogy), Mark Schildhauer (National Center for Ecological Analysis and Synthesis), Sophia Ratcliffe (National Biodiversity Network Trust), Teresa J. Mayfield-Meyer (The University of New Mexico, Arctos), Christian Bölling (Museum für Naturkunde Berlin - Leibniz-Institut für Evolutions- und Biodiversitätsforschung)
Tvůrce
Darwin Core Maintenance Group
Bibliografická citace
Darwin Core Maintenance Group. 2026. Darwin Core List of Terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/2026-05-26

1 Úvod (informativní)

Tento dokument obsahuje termíny, které jsou součástí nejnovější verze slovníku Darwin Core (http://rs.tdwg.org/version/dwc/2026-05-26).

Tento dokument obsahuje termíny ve čtyřech jmenných prostorech, které obsahují doporučené termíny: dwc:, dwciri:, dc: a dcterms:. Některé termíny v těchto jmenných prostorech jsou však zastaralé nebo překonané a neměly by se již používat. Vyřazení nebo nahrazení je uvedeno v metadatech termínu. Jmenné prostory, které obsahují pouze zastaralé termíny, nejsou v tomto dokumentu zahrnuty, ale metadata o těchto termínech lze získat dereferencováním jejich IRI.

Zjednodušený seznam, který obsahuje pouze aktuálně doporučené termíny, naleznete v Stručná referenční příručka Darwin Core.

1.1 Status obsahu tohoto dokumentu

Oddíly 1 a 3 nejsou normativní.

Oddíl 2 je normativní.

V oddíle 4 jsou hodnoty Term IRI a Definice normativní. Hodnoty Název termínu nejsou normativní, ačkoli lze očekávat, že prefix zkratky jmenného prostoru je prefix běžně používaný pro jmenný prostor termínu. Štítek a hodnoty všech ostatních vlastností (například Příklady a Poznámky) nejsou normativní.

1.2 Klíčová slova RFC 2119

Klíčová slova “MUST”, “MUST NOT”, “REQUIRED”, “SHALL”, “SHALL NOT”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY” a “OPTIONAL” v tomto dokumentu je třeba interpretovat tak, jak je popsáno v BCP 14 [RFC 2119] a [RFC 8174], pokud a pouze pokud jsou uvedena velkými písmeny, jak je uvedeno zde.

1.3 Zkratky jmenného prostoru

V tomto dokumentu se používají následující zkratky jmenných prostorů:

zkratka IRI
dwc: http://rs.tdwg.org/dwc/cs/terms/
dwciri: http://rs.tdwg.org/dwc/cs/iri/
dc: http://purl.org/dc/elements/1.1/
dcterms: http://purl.org/dc/terms/

2 Použití termínů

Vzhledem k požadavkům oddílu 1.4.3 Průvodce Darwin Core RDF se termíny ve jmenném prostoru dwciri: MUSÍ používat s hodnotami IRI. Od termínů ve jmenných prostorech dwc: a dc: se obecně očekává, že budou mít řetězcové literální hodnoty. Hodnoty termínů ve jmenném prostoru dcterms: závisí na podrobnostech termínu. Podrobnosti naleznete v oddílu 3 Darwin Core RDF Guide.

3 Indexy termínů

3.1 Index podle názvu termínu

(Viz také 3.2 Index podle štítku)

Třídy

dcterms:Agent | dwc:Assertion | dcterms:BibliographicResource | dwc:Dataset | dwc:Event | dwc:EventAttribute | dwc:EventMeasurement | dwc:FossilSpecimen | dwc:GeologicalContext | dwc:HumanObservation | dwc:Identification | dwc:LivingSpecimen | dcterms:Location | dwc:MachineObservation | dwc:MaterialCitation | dwc:MaterialEntity | dwc:MaterialSample | dwc:MeasurementOrFact | ac:Media | dwc:MolecularProtocol | dwc:NucleotideAnalysis | dwc:NucleotideSequence | dwc:Occurrence | dwc:OccurrenceMeasurement | dwc:Organism | dwc:OrganismInteraction | dwc:PreservedSpecimen | dwc:Protocol | dwc:Provenance | dwc:ResourceRelationship | dwc:Sample | dwc:SampleAttribute | dwc:SamplingEvent | dwc:SamplingLocation | dwc:Taxon | dwc:UsagePolicy

Record level

dwc:accordingTo | dwc:accuracy | dwc:agentRoleOrder | dwc:basisOfRecord | dwc:collectionCode | dwc:collectionID | dwc:dataGeneralizations | dwc:datasetID | dwc:datasetName | dwc:DwCType | dwc:dynamicProperties | dwc:feedbackURL | dwc:Generalizations | dwc:informationWithheld | dwc:institutionCode | dwc:institutionID | dwc:ownerInstitutionCode

Dublin Core legacy namespace

dc:language | dc:type

Dublin Core terms namespace

dcterms:accessRights | dcterms:bibliographicCitation | dcterms:language | dcterms:license | dcterms:modified | dcterms:references | dcterms:rights | dcterms:rightsHolder | dcterms:type

Agent

dwc:agentID | dwc:agentRemarks | dwc:agentType

Assertion

dwc:assertionBy | dwc:assertionEffectiveDate | dwc:assertionError | dwc:assertionID | dwc:assertionMadeDate | dwc:assertionProtocols | dwc:assertionReferences | dwc:assertionRemarks | dwc:assertionType | dwc:assertionUnit | dwc:assertionValue | dwc:verbatimAssertionType

Bibliographic Resource

dwc:referenceID | dwc:referenceRemarks | dwc:referenceType

Event

dwc:day | dwc:EarliestDateCollected | dwc:endDayOfYear | dwc:EndTimeOfDay | dwc:eventAttributes | dwc:eventCategory | dwc:eventDate | dwc:eventID | dwc:eventRemarks | dwc:eventTime | dwc:eventType | dwc:fieldNotes | dwc:fieldNumber | dwc:habitat | dwc:LatestDateCollected | dwc:month | dwc:parentEventID | dwc:sampledSubstrateCategory | dwc:sampledSubstrateLayer | dwc:sampleSizeUnit | dwc:sampleSizeValue | dwc:samplingEffort | dwc:samplingProtocol | dwc:startDayOfYear | dwc:StartTimeOfDay | dwc:verbatimEventDate | dwc:year

Geological Context

dwc:bed | dwc:earliestAgeOrLowestStage | dwc:earliestEonOrLowestEonothem | dwc:earliestEpochOrLowestSeries | dwc:earliestEraOrLowestErathem | dwc:earliestPeriodOrLowestSystem | dwc:formation | dwc:geologicalContextID | dwc:group | dwc:highestBiostratigraphicZone | dwc:latestAgeOrHighestStage | dwc:latestEonOrHighestEonothem | dwc:latestEpochOrHighestSeries | dwc:latestEraOrHighestErathem | dwc:latestPeriodOrHighestSystem | dwc:lithostratigraphicTerms | dwc:lowestBiostratigraphicZone | dwc:member

Identification

dwc:dateIdentified | dwc:identificationAttributes | dwc:identificationID | dwc:identificationQualifier | dwc:identificationReferences | dwc:identificationRemarks | dwc:identificationType | dwc:identificationVerificationStatus | dwc:identifiedBy | dwc:identifiedByID | dwc:isAcceptedIdentification | dwc:PreviousIdentifications | dwc:taxonFormula | dwc:typeStatus | dwc:verbatimIdentification

Location

dwc:continent | dwc:coordinatePrecision | dwc:coordinateUncertaintyInMeters | dwc:country | dwc:countryCode | dwc:county | dwc:decimalLatitude | dwc:decimalLongitude | dwc:footprintSpatialFit | dwc:footprintSRS | dwc:footprintWKT | dwc:geodeticDatum | dwc:georeferencedBy | dwc:georeferencedDate | dwc:georeferenceProtocol | dwc:georeferenceRemarks | dwc:georeferenceSources | dwc:higherGeography | dwc:higherGeographyID | dwc:island | dwc:islandGroup | dwc:locality | dwc:locationAccordingTo | dwc:locationAttributes | dwc:locationID | dwc:locationRemarks | dwc:maximumDepthInMeters | dwc:maximumDistanceAboveSurfaceInMeters | dwc:maximumElevationInMeters | dwc:minimumDepthInMeters | dwc:minimumDistanceAboveSurfaceInMeters | dwc:minimumElevationInMeters | dwc:municipality | dwc:pointRadiusSpatialFit | dwc:preferredSpatialRepresentation | dwc:SamplingLocationID | dwc:SamplingLocationRemarks | dwc:siteNumber | dwc:stateProvince | dwc:verbatimCoordinates | dwc:verbatimCoordinateSystem | dwc:verbatimDepth | dwc:verbatimElevation | dwc:verbatimLatitude | dwc:verbatimLocality | dwc:verbatimLongitude | dwc:verbatimSRS | dwc:verticalDatum | dwc:waterBody

Material Entity

dwc:associatedSequences | dwc:catalogNumber | dwc:digitalSpecimenID | dwc:discipline | dwc:disposition | dwc:materialEntityCategory | dwc:materialEntityID | dwc:materialEntityRemarks | dwc:materialEntityType | dwc:objectQuantity | dwc:objectQuantityType | dwc:otherCatalogNumbers | dwc:preparations | dwc:typeOfType | dwc:typifiedName | dwc:verbatimLabel

Material Sample

dwc:materialSampleID

Measurement or Fact

dwc:measurementAccuracy | dwc:measurementDeterminedBy | dwc:measurementDeterminedDate | dwc:measurementID | dwc:measurementMethod | dwc:measurementRemarks | dwc:measurementType | dwc:measurementUnit | dwc:measurementValue | dwc:parentMeasurementID | dwc:verbatimMeasurementType

Media

no_terms_organized_in_class

Molecular Protocol

dwc:assayType | dwc:molecularProtocolID

Nucleotide Analysis

dwc:processedTotalReadCount | dwc:readCount

Nucleotide Sequence

dwc:nucleotideSequenceRemarks | dwc:sequence

Occurrence

dwc:associatedMedia | dwc:associatedOccurrences | dwc:associatedReferences | dwc:associatedTaxa | dwc:behavior | dwc:caste | dwc:CatalogNumberNumeric | dwc:degreeOfEstablishment | dwc:establishmentMeans | dwc:georeferenceVerificationStatus | dwc:individualCount | dwc:individualID | dwc:lifeStage | dwc:occurrenceAttributes | dwc:occurrenceDetails | dwc:occurrenceID | dwc:occurrenceRemarks | dwc:occurrenceStatus | dwc:organismQuantity | dwc:organismQuantityType | dwc:pathway | dwc:recordedBy | dwc:recordedByID | dwc:recordNumber | dwc:reproductiveCondition | dwc:sex | dwc:vitality

Organism

dwc:associatedOrganisms | dwc:causeOfDeath | dwc:organismID | dwc:organismName | dwc:organismRemarks | dwc:organismScope | dwc:previousIdentifications

Organism Interaction

dwc:organismInteractionDescription | dwc:organismInteractionID | dwc:organismInteractionType

Protocol

dwc:protocolDescription | dwc:protocolID | dwc:protocolReferences | dwc:protocolRemarks | dwc:protocolType

Provenance

ac:fundingAttribution | dwc:fundingAttributionID | dwc:projectID | dwc:projectTitle

Resource Relationship

dwc:RelatedBasisOfRecord | dwc:relatedResourceID | dwc:relatedResourceType | dwc:relationshipAccordingTo | dwc:relationshipEstablishedDate | dwc:relationshipOfResource | dwc:relationshipOfResourceID | dwc:relationshipRemarks | dwc:resourceID | dwc:resourceRelationshipID

Taxon

dwc:acceptedNameUsage | dwc:acceptedNameUsageID | dwc:acceptedScientificName | dwc:acceptedScientificNameID | dwc:AcceptedTaxon | dwc:AcceptedTaxonID | dwc:acceptedTaxonID | dwc:acceptedTaxonName | dwc:acceptedTaxonNameID | dwc:basionym | dwc:basionymID | dwc:binomial | dwc:class | dwc:cultivarEpithet | dwc:family | dwc:genericName | dwc:genus | dwc:higherClassification | dwc:HigherTaxon | dwc:higherTaxonconceptID | dwc:HigherTaxonID | dwc:higherTaxonName | dwc:higherTaxonNameID | dwc:infragenericEpithet | dwc:infraspecificEpithet | dwc:kingdom | dwc:nameAccordingTo | dwc:nameAccordingToID | dwc:namePublicationID | dwc:namePublishedIn | dwc:namePublishedInID | dwc:namePublishedInYear | dwc:nomenclaturalCode | dwc:nomenclaturalStatus | dwc:order | dwc:originalNameUsage | dwc:originalNameUsageID | dwc:parentNameUsage | dwc:parentNameUsageID | dwc:phylum | dwc:scientificName | dwc:scientificNameAuthorship | dwc:scientificNameID | dwc:scientificNameRank | dwc:specificEpithet | dwc:subfamily | dwc:subgenus | dwc:subtribe | dwc:superfamily | dwc:taxonAccordingTo | dwc:taxonAttributes | dwc:taxonConceptID | dwc:TaxonID | dwc:taxonID | dwc:taxonNameID | dwc:taxonomicStatus | dwc:taxonRank | dwc:taxonRemarks | dwc:tribe | dwc:verbatimScientificNameRank | dwc:verbatimTaxonRank | dwc:vernacularName

Usage Policy

no_terms_organized_in_class

IRI-value terms

dwciri:assayType | dwciri:assertionBy | dwciri:assertionType | dwciri:assertionUnit | dwciri:assertionValue | dwciri:behavior | dwciri:caste | dwciri:dataGeneralizations | dwciri:degreeOfEstablishment | dwciri:discipline | dwciri:disposition | dwciri:earliestGeochronologicalEra | dwciri:establishmentMeans | dwciri:eventCategory | dwciri:eventType | dwciri:fieldNotes | dwciri:fieldNumber | dwciri:footprintSRS | dwciri:footprintWKT | dwciri:fromLithostratigraphicUnit | dwciri:fundingAttribution | dwciri:geodeticDatum | dwciri:georeferencedBy | dwciri:georeferenceProtocol | dwciri:georeferenceSources | dwciri:georeferenceVerificationStatus | dwciri:habitat | dwciri:identificationQualifier | dwciri:identificationType | dwciri:identificationVerificationStatus | dwciri:identifiedBy | dwciri:inCollection | dwciri:inDataset | dwciri:inDescribedPlace | dwciri:informationWithheld | dwciri:latestGeochronologicalEra | dwciri:lifeStage | dwciri:locationAccordingTo | dwciri:materialEntityCategory | dwciri:materialEntityType | dwciri:measurementDeterminedBy | dwciri:measurementMethod | dwciri:measurementType | dwciri:measurementUnit | dwciri:measurementValue | dwciri:objectQuantityType | dwciri:occurrenceStatus | dwciri:organismInteractionType | dwciri:organismQuantityType | dwciri:organismScope | dwciri:pathway | dwciri:preferredSpatialRepresentation | dwciri:preparations | dwciri:protocolType | dwciri:recordedBy | dwciri:recordNumber | dwciri:reproductiveCondition | dwciri:sampledSubstrateCategory | dwciri:sampledSubstrateLayer | dwciri:sampleSizeUnit | dwciri:samplingProtocol | dwciri:sex | dwciri:siteNumber | dwciri:taxonFormula | dwciri:toDigitalSpecimen | dwciri:toTaxon | dwciri:typeStatus | dwciri:verbatimCoordinateSystem | dwciri:verbatimSRS | dwciri:verticalDatum | dwciri:vitality

3.2 Index podle štítku

(Viz také 3.1 Index podle názvu termínu)

Třídy

Agent | Assertion | Bibliographic Resource | Dataset | Event | Event Attribute | Event Measurement | Fossil Specimen | Geological Context | Human Observation | Identification | Living Specimen | Location | Machine Observation | Material Citation | Material Entity | Material Sample | Measurement Or Fact | Media Entity | Molecular Protocol | Nucleotide Analysis | Nucleotide Sequence | Occurrence | Occurrence Measurement | Organism | Organism Interaction | Preserved Specimen | Protocol | Provenance | Resource Relationship | Sample | Sample Attribute | Sampling Event | Sampling Location | Taxon | Usage Policy

Record level

According To | Accuracy | Agent Role Order | Basis Of Record | Collection Code | Collection ID | Darwin Core Type | Data Generalizations | Dataset ID | Dataset Name | Dynamic Properties | Feedback URL | Generalizations | Information Withheld | Institution Code | Institution ID | Owner Institution Code

Dublin Core legacy namespace

Language | Type

Dublin Core terms namespace

Access Rights | Bibliographic Citation | Date Modified | Language | License | References | Rights | Rights Holder | Type

Agent

Agent ID | Agent Remarks | Agent Type

Assertion

Assertion By | Assertion Effective Date | Assertion Error | Assertion ID | Assertion Made Date | Assertion Protocols | Assertion References | Assertion Remarks | Assertion Type | Assertion Unit | Assertion Value | Verbatim Assertion Type

Bibliographic Resource

Reference ID | Reference Remarks | Reference Type

Event

Day | Earliest Date Collected | End Day Of Year | End Time of Day | Event Attributes | Event Category | Event Date | Event ID | Event Remarks | Event Time | Event Type | Field Notes | Field Number | Habitat | Latest Date Collected | Month | Parent Event ID | Sample Size Unit | Sample Size Value | Sampled Substrate Category | Sampled Substrate Layer | Sampling Effort | Sampling Protocol | Start Day Of Year | Start Time of Day | Verbatim EventDate | Year

Geological Context

Bed | Earliest Age Or Lowest Stage | Earliest Eon Or Lowest Eonothem | Earliest Epoch Or Lowest Series | Earliest Era Or Lowest Erathem | Earliest Period Or Lowest System | Formation | Geological Context ID | Group | Highest Biostratigraphic Zone | Latest Age Or Highest Stage | Latest Eon Or Highest Eonothem | Latest Epoch Or Highest Series | Latest Era Or Highest Erathem | Latest Period Or Highest System | Lithostratigraphic Terms | Lowest Biostratigraphic Zone | Member

Identification

Date Identified | Identification Attributes | Identification ID | Identification Qualifier | Identification References | Identification Remarks | Identification Type | Identification Verification Status | Identified By | Identified By ID | Is Accepted Identification | Previous Identifications | Taxon Formula | Type Status | Verbatim Identification

Location

Continent | Coordinate Precision | Coordinate Uncertainty In Meters | Country | Country Code | Decimal Latitude | Decimal Longitude | First Order Division | Footprint SRS | Footprint Spatial Fit | Footprint WKT | Geodetic Datum | Georeference Protocol | Georeference Remarks | Georeference Sources | Georeferenced By | Georeferenced Date | Higher Geography | Higher Geography ID | Island | Island Group | Locality | Location According To | Location Attributes | Location ID | Location Remarks | Maximum Depth In Meters | Maximum Distance Above Surface In Meters | Maximum Elevation In Meters | Minimum Depth In Meters | Minimum Distance Above Surface In Meters | Minimum Elevation In Meters | Point Radius Spatial Fit | Preferred Spatial Representation | Sampling Location ID | Sampling Location Remarks | Second Order Division | Site Number | Third Order Division | Verbatim Coordinate System | Verbatim Coordinates | Verbatim Depth | Verbatim Elevation | Verbatim Latitude | Verbatim Locality | Verbatim Longitude | Verbatim SRS | Vertical Datum | Water Body

Material Entity

Associated Sequences | Catalog Number | Digital Specimen ID | Discipline | Disposition | Material Entity Category | Material Entity ID | Material Entity Remarks | Material Entity Type | Object Quantity | Object Quantity Type | Other Catalog Numbers | Preparations | Type Of Type | Typified Name | Verbatim Label

Material Sample

Material Sample ID

Measurement or Fact

Measurement Accuracy | Measurement Determined By | Measurement Determined Date | Measurement ID | Measurement Method | Measurement Remarks | Measurement Type | Measurement Unit | Measurement Value | Parent Measurement ID | Verbatim Measurement Type

Media

no_terms_organized_in_class

Molecular Protocol

Assay Type | Molecular Protocol ID

Nucleotide Analysis

Processed Total Read Count | Read Count

Nucleotide Sequence

Nucleotide Sequence Remarks | Sequence

Occurrence

Associated Media | Associated Occurrences | Associated References | Associated Taxa | Behavior | Caste | Catalog Number Numeric | Degree of Establishment | Establishment Means | Georeference Verification Status | Individual Count | Individual ID | Life Stage | Occurrence Attributes | Occurrence Details | Occurrence ID | Occurrence Remarks | Occurrence Status | Organism Quantity | Organism Quantity Type | Pathway | Record Number | Recorded By | Recorded By ID | Reproductive Condition | Sex | Vitality

Organism

Associated Organisms | Cause Of Death | Organism ID | Organism Name | Organism Remarks | Organism Scope | Previous Identifications

Organism Interaction

Organism Interaction Description | Organism Interaction ID | Organism Interaction Type

Protocol

Protocol Description | Protocol ID | Protocol References | Protocol Remarks | Protocol Type

Provenance

Funding Attribution | Funding Attribution ID | Project ID | Project Title

Resource Relationship

Related Basis of Record | Related Resource ID | Related Resource Type | Relationship According To | Relationship Established Date | Relationship Of Resource | Relationship Of Resource ID | Relationship Remarks | Resource ID | Resource Relationship ID

Taxon

Accepted Name Usage | Accepted Name Usage ID | Accepted Scientific Name | Accepted Scientific Name ID | Accepted Taxon | Accepted Taxon ID | Accepted Taxon ID | Accepted Taxon Name | Accepted Taxon Name ID | Basionym | Basionym ID | Binomial | Class | Cultivar Epithet | Family | Generic Name | Genus | Higher Classification | Higher Taxon | Higher Taxon Concept ID | Higher Taxon ID | Higher Taxon Name | Higher Taxon Name ID | Infrageneric Epithet | Infraspecific Epithet | Kingdom | Name According To | Name According To ID | Name Publication ID | Name Published In | Name Published In ID | Name Published In Year | Nomenclatural Code | Nomenclatural Status | Order | Original Name Usage | Original Name Usage ID | Parent Name Usage | Parent Name Usage ID | Phylum | Scientific Name | Scientific Name Authorship | Scientific Name ID | Scientific Name Rank | Specific Epithet | Subfamily | Subgenus | Subtribe | Superfamily | Taxon According To | Taxon Attributes | Taxon Concept ID | Taxon ID | Taxon ID | Taxon Name ID | Taxon Rank | Taxon Remarks | Taxonomic Status | Tribe | Verbatim Scientific Name Rank | Verbatim Taxon Rank | Vernacular Name

Usage Policy

no_terms_organized_in_class

IRI-value terms

Assay Type (IRI) | Assertion By (IRI) | Assertion Type (IRI) | Assertion Unit (IRI) | Assertion Value (IRI) | Behavior (IRI) | Caste (IRI) | Data Generalizations (IRI) | Degree of Establishment (IRI) | Discipline (IRI) | Disposition (IRI) | Earliest Geochronological Era | Establishment Means (IRI) | Event Category (IRI) | Event Type (IRI) | Field Notes (IRI) | Field Number (IRI) | Footprint SRS (IRI) | Footprint WKT (IRI) | From Lithostratigraphic Unit | Funding Attribution (IRI) | Geodetic Datum (IRI) | Georeference Protocol (IRI) | Georeference Sources (IRI) | Georeference Verification Status (IRI) | Georeferenced By (IRI) | Habitat (IRI) | Identification Qualifier (IRI) | Identification Type (IRI) | Identification Verification Status (IRI) | Identified By (IRI) | In Collection | In Dataset | In Described Place | Information Withheld (IRI) | Latest Geochronological Era | Life Stage (IRI) | Location According To (IRI) | Material Entity Category (IRI) | Material Entity Type (IRI) | Measurement Determined By (IRI) | Measurement Method (IRI) | Measurement Type (IRI) | Measurement Unit (IRI) | Measurement Value (IRI) | Object Quantity Type (IRI) | Occurrence Status (IRI) | Organism Interaction Type (IRI) | Organism Quantity Type (IRI) | Organism Scope (IRI) | Pathway (IRI) | Preferred Spatial Representation (IRI) | Preparations (IRI) | Protocol Type (IRI) | Record Number (IRI) | Recorded By (IRI) | Reproductive Condition (IRI) | Sampled Substrate Category (IRI) | Sampled Substrate Layer (IRI) | Sampling Protocol (IRI) | Sampling Size Unit (IRI) | Sex (IRI) | Site Number (IRI) | Taxon Formula (IRI) | To Digital Specimen | To Taxon | Type Status (IRI) | Verbatim Coordinate System (IRI) | Verbatim SRS (IRI) | Vertical Datum (IRI) | Vitality (IRI)

4 Slovník

Název termínu dwc:acceptedNameUsage
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/acceptedNameUsage-2025-06-12
Štítek Užití přijatého názvu
Definice Úplný název aktuálně platného (zoologického) nebo přijatého (botanického) dwc:Taxon s uvedením autorství a data, pokud je známo.
Poznámky Úplný vědecký název s údaji o autorství a datu, pokud jsou známy, přijatého (botanického) nebo platného (zoologického) názvu v případech, kdy je uvedený dwc:scientificName považován odkazem uvedeným ve vlastnosti dwc:nameaccordingTo nebo poskytovatelem obsahu za synonymum nebo nesprávně použitý název. Při použití pro dwc:Organism nebo dwc:Occurrence by měl být tento termín použit v případech, kdy poskytovatel obsahu považuje poskytnutý dwc:scientificName za neslučitelný s taxonomickým pohledem poskytovatele obsahu. Například v rámci sbírek exemplářů a datových sad pozorování existuje mnoho rozporů mezi zaznamenaným názvem (např. nejnovější identifikací od odborníka, který zkoumal exemplář, nebo terénní identifikací pozorovaného dwc:Organism) a názvem, o kterém poskytovatel obsahu tvrdí, že je taxonomicky přijatelný.
Příklady Tamias minimus (platný název pro Eutamias minimus)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:acceptedNameUsageID
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/acceptedNameUsageID-2023-06-28
Štítek ID užití přijatého názvu
Definice Identifikátor pro použití názvu (doložený význam názvu podle zdroje) aktuálně platného (zoologického) nebo přijatého (botanického) taxonu.
Poznámky Tento termín by se měl používat pro synonyma nebo nesprávně použité názvy, aby odkazoval na dwc:taxonID záznamu dwc:Taxon, který představuje přijatý (botanický) nebo platný (zoologický) název. V případě Darwin Core Archives by měl být související záznam přítomen lokálně ve stejném archivu.
Příklady
  • tsn:41107 (ITIS)
  • urn:lsid:ipni.org:names:320035-2 (IPNI)
  • 2704179 (GBIF)
  • 6W3C4 (COL)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:acceptedScientificName
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedScientificName
Změněno 2009-09-21
Štítek Accepted Scientific Name
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Definice The currently valid (zoological) or accepted (botanical) name for the scientificName.
Poznámky Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:acceptedScientificNameID
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Změněno 2009-08-24
Štítek Accepted Scientific Name ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Definice A unique identifier for the acceptedScientificName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:AcceptedTaxon
Termín IRI http://rs.tdwg.org/dwc/terms/AcceptedTaxon
Změněno 2009-04-24
Štítek Accepted Taxon
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Definice The currently valid (zoological) or accepted (botanical) name for the ScientificName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:AcceptedTaxonID
Termín IRI http://rs.tdwg.org/dwc/terms/AcceptedTaxonID
Změněno 2009-04-24
Štítek Accepted Taxon ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Definice A global unique identifier for the parent to the AcceptedTaxon.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:acceptedTaxonID
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Změněno 2009-09-21
Štítek Accepted Taxon ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Definice An identifier for the name of the currently valid (zoological) or accepted (botanical) taxon. See acceptedTaxon.
Poznámky Example: "8fa58e08-08de-4ac1-b69c-1235340b7001"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:acceptedTaxonName
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Změněno 2009-07-06
Štítek Accepted Taxon Name
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedScientificName
Definice The currently valid (zoological) or accepted (botanical) name for the scientificName.
Poznámky Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:acceptedTaxonNameID
Termín IRI http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Změněno 2009-07-06
Štítek Accepted Taxon Name ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Definice A unique identifier for the acceptedTaxonName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:AccessConstraints
Termín IRI http://rs.tdwg.org/dwc/terms/AccessConstraints
Změněno 2009-09-21
Štítek Access Constraints
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://purl.org/dc/terms/accessRights
Definice A description of constraints on the use of the data as shared or access to further data that is not shared.
Poznámky Example: "not-for-profit use only".
ABCD ekvivalence DataSets/DataSet/Units/Unit/IPRStatements
Typ Vlastnost
Název termínu dcterms:accessRights
Termín IRI http://purl.org/dc/terms/accessRights
Změněno 2023-06-28
Verze termínu IRI http://dublincore.org/usage/terms/history/#accessRights-002
Štítek Přístupová práva
Definice Informace o tom, kdo má ke zdroji přístup, nebo údaj o jeho stavu zabezpečení.
Poznámky Přístupová práva mohou zahrnovat informace týkající se přístupu nebo omezení na základě zásad ochrany osobních údajů, bezpečnosti nebo jiných zásad.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:accordingTo
Termín IRI http://rs.tdwg.org/dwc/terms/accordingTo
Změněno 2020-08-06
Štítek According To
Tento termín je zastaralý a již by se neměl používat.
Definice Abstract term to attribute information to a source.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:accuracy
Termín IRI http://rs.tdwg.org/dwc/terms/accuracy
Změněno 2009-04-24
Štítek Accuracy
Tento termín je zastaralý a již by se neměl používat.
Definice Abstract term to capture error information about a measurement or fact.
ABCD ekvivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Název termínu dcterms:Agent
Termín IRI http://purl.org/dc/terms/Agent
Změněno 2026-05-26
Verze termínu IRI http://dublincore.org/usage/terms/history/#Agent-001
Štítek Agent
Definice A resource that acts or has the power to act.
Poznámky A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
Příklady
  • a person
  • a team of participants on an expedition
  • a funding agency
  • a particular bioacoustic monitoring installation
  • a software instance
  • a particular camera trap
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:agentID
Termín IRI http://rs.tdwg.org/dwc/terms/agentID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/agentID-2026-05-26
Štítek Agent ID
Definice An identifier for a dcterms:Agent.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:agentRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/agentRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/agentRemarks-2026-05-26
Štítek Agent Remarks
Definice Comments or notes about a dcterms:Agent.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:agentRoleOrder
Termín IRI http://rs.tdwg.org/dwc/terms/agentRoleOrder
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/agentRoleOrder-2026-05-26
Štítek Agent Role Order
Definice A numerical position of an AgentRole in a set of AgentRoles.
Poznámky One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
Příklady
  • 1
  • 2
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:agentType
Termín IRI http://rs.tdwg.org/dwc/terms/agentType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/agentType-2026-05-26
Štítek Agent Type
Definice A category that best matches the nature of a dcterms:Agent.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • person
  • group
  • organization
  • camera
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:assayType
Termín IRI http://rs.tdwg.org/dwc/iri/assayType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/assayType-2026-05-26
Štítek Assay Type (IRI)
Definice A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assayType
Termín IRI http://rs.tdwg.org/dwc/terms/assayType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assayType-2026-05-26
Štítek Assay Type
Definice A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • targeted
  • metabarcoding
  • other
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Assertion
Termín IRI http://rs.tdwg.org/dwc/terms/Assertion
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Assertion-2026-05-26
Štítek Assertion
Definice A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Poznámky Zdroje lze považovat za identifikovatelné záznamy nebo instance tříd a mohou zahrnovat instance dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification nebo dwc:Taxon, ale nemusí se na ně omezovat.
Příklady
  • the weight of a dwc:Organism in grams
  • the number of placental scars
  • surface water temperature in Celsius
ABCD ekvivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:assertionBy
Termín IRI http://rs.tdwg.org/dwc/iri/assertionBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/assertionBy-2026-05-26
Štítek Assertion By (IRI)
Definice An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionBy
Termín IRI http://rs.tdwg.org/dwc/terms/assertionBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionBy-2026-05-26
Štítek Assertion By
Definice A name for a dcterms:Agent responsible for making a dwc:Assertion.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • Rob Guralnick
  • Peter Desmet | Stijn Van Hoey
  • ChatGPT
  • Notes From Nature
  • ROV SuBastian
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionEffectiveDate
Termín IRI http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionEffectiveDate-2026-05-26
Štítek Assertion Effective Date
Definice A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionError
Termín IRI http://rs.tdwg.org/dwc/terms/assertionError
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionError-2026-05-26
Štítek Assertion Error
Definice A description of the potential error associated with a dwc:assertionValue.
Příklady
  • 0.01
  • normal distribution with variation of 2 m
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionID
Termín IRI http://rs.tdwg.org/dwc/terms/assertionID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionID-2026-05-26
Štítek Assertion ID
Definice An identifier for a dwc:Assertion.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionMadeDate
Termín IRI http://rs.tdwg.org/dwc/terms/assertionMadeDate
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionMadeDate-2026-05-26
Štítek Assertion Made Date
Definice A date on which a dwc:Assertion was created.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionProtocols
Termín IRI http://rs.tdwg.org/dwc/terms/assertionProtocols
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionProtocols-2026-05-26
Štítek Assertion Protocols
Definice Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
ABCD ekvivalence /DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionReferences
Termín IRI http://rs.tdwg.org/dwc/terms/assertionReferences
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionReferences-2026-05-26
Štítek Assertion References
Definice A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/assertionRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionRemarks-2026-05-26
Štítek Assertion Remarks
Definice Comments or notes about a dwc:Assertion.
Příklady
  • tip of tail missing
  • error determined by independently calibrated measurements
  • error provided is from the manufacturer’s standard instrument specification
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:assertionType
Termín IRI http://rs.tdwg.org/dwc/iri/assertionType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/assertionType-2026-05-26
Štítek Assertion Type (IRI)
Definice A category that best matches the nature of a dwc:Assertion.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionType
Termín IRI http://rs.tdwg.org/dwc/terms/assertionType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionType-2026-05-26
Štítek Assertion Type
Definice A category that best matches the nature of a dwc:Assertion.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • tailLength
  • waterTemperature
  • trapLineLength
  • surveyArea
  • trapType
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:assertionUnit
Termín IRI http://rs.tdwg.org/dwc/iri/assertionUnit
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/assertionUnit-2026-05-26
Štítek Assertion Unit (IRI)
Definice A unit associated with the value in dwc:assertionValue.
Poznámky Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionUnit
Termín IRI http://rs.tdwg.org/dwc/terms/assertionUnit
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionUnit-2026-05-26
Štítek Assertion Unit
Definice A unit associated with the value in dwc:assertionValue.
Poznámky Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., g/cm^3 for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., individuals). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • m
  • s
  • g
  • ml
  • %
  • individuals
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:assertionValue
Termín IRI http://rs.tdwg.org/dwc/terms/assertionValue
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/assertionValue-2026-05-26
Štítek Assertion Value
Definice An asserted value.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • 45
  • 20
  • 1
  • 14.5
  • UV-light
  • Hamon grab
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:assertionValue
Termín IRI http://rs.tdwg.org/dwc/iri/assertionValue
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/assertionValue-2026-05-26
Štítek Assertion Value (IRI)
Definice An asserted value.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:associatedMedia
Termín IRI http://rs.tdwg.org/dwc/terms/associatedMedia
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedMedia-2023-06-28
Štítek Přidružená média
Definice Seznam (spojený a oddělený) identifikátorů (publikace, globální jedinečný identifikátor, URI) médií spojených s dwc:Occurrence.
Příklady https://arctos.database.museum/media/10520962 | https://arctos.database.museum/media/10520964
ABCD ekvivalence DataSets/DataSet/Units/Unit/MultimediaObjects
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:associatedOccurrences
Termín IRI http://rs.tdwg.org/dwc/terms/associatedOccurrences
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedOccurrences-2023-06-28
Štítek Související výskyty
Definice Seznam (spojený a oddělený) identifikátorů jiných záznamů dwc:Occurrence a jejich asociací k tomuto dwc:Occurrence.
Poznámky Tento termín lze použít k poskytnutí seznamu asociací k jiným dwc:Occurrences. Všimněte si, že třída dwc:ResourceRelationship je alternativním prostředkem pro reprezentaci asociací, a to s většími podrobnostmi. Doporučeným osvědčeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:associatedOrganisms
Termín IRI http://rs.tdwg.org/dwc/terms/associatedOrganisms
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedOrganisms-2023-06-28
Štítek Související organismy
Definice Seznam (spojený a oddělený) identifikátorů jiných dwc:Organisms a asociací tohoto dwc:Organism ke každému z nich.
Poznámky Tento termín lze použít k poskytnutí seznamu asociací k jiným dwc:Organisms. Všimněte si, že třída dwc:ResourceRelationship je alternativním prostředkem pro reprezentaci asociací, a to s většími podrobnostmi. Doporučeným osvědčeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Název termínu dwc:associatedReferences
Termín IRI http://rs.tdwg.org/dwc/terms/associatedReferences
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedReferences-2023-06-28
Štítek Související reference
Definice Seznam (spojený a oddělený) identifikátorů (publikace, bibliografický odkaz, globální jedinečný identifikátor, URI) literatury spojené s dwc:Occurrence.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Všimněte si, že třída dwc:ResourceRelationship je alternativním prostředkem pro reprezentaci asociací, a to s většími detaily. Všimněte si také, že zamýšleným použitím termínu dcterms:references v jádře Darwin při použití na dwc:Occurrence je poukázat na definitivní zdrojovou reprezentaci této dwc:Occurrence, pokud je k dispozici. Všimněte si také, že zamýšleným použitím termínu dcterms:bibliographicCitation v Darwin Core, je-li použit na dwc:Occurrence, je poskytnout preferovaný způsob citování samotného dwc:Occurrence.
Příklady
  • http://www.sciencemag.org/cgi/content/abstract/322/5899/261
  • Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.
  • Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. | Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.
ABCD ekvivalence DataSets/DataSet/Units/Unit/UnitReferences
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:associatedSequences
Termín IRI http://rs.tdwg.org/dwc/terms/associatedSequences
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedSequences-2026-05-26
Štítek Související sekvence
Definice Seznam (zřetězený a rozdělený) termínů typu dcterms:BibliographicResources pro dwc:NucleotideSequences spojených s entitou dwc:MaterialEntity.
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/Sequences/Sequence/ID-in-Database + constant
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:associatedTaxa
Termín IRI http://rs.tdwg.org/dwc/terms/associatedTaxa
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/associatedTaxa-2023-06-28
Štítek Související taxony
Definice Seznam (spojený a oddělený) identifikátorů nebo názvů záznamů dwc:Taxon a přiřazení tohoto dwc:Occurrence ke každému z nich.
Poznámky Tento termín lze použít k poskytnutí seznamu přidružení k jiným záznamům dwc:Taxon, než je definováno v dwc:Occurrence. Všimněte si, že třída dwc:ResourceRelationship je alternativním prostředkem pro reprezentaci přidružení, a to s většími podrobnostmi. Tento termín není vhodný pro vytváření vztahů mezi dwc:Taxon záznamy, pouze mezi konkrétními dwc:Occurrences dwc:Organism s jinými dwc:Taxon záznamy. Doporučeným osvědčeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
  • "host":"Quercus alba"
  • "host":"gbif.org/species/2879737"
  • "parasitoid of":"Cyclocephala signaticollis" | "predator of":"Apis mellifera"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:basionym
Termín IRI http://rs.tdwg.org/dwc/terms/basionym
Změněno 2009-09-21
Štítek Basionym
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/originalNameUsage
Definice The basionym (botany) or basonym (bacteriology) of the scientificName.
Poznámky Example: "Pinus abies"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:basionymID
Termín IRI http://rs.tdwg.org/dwc/terms/basionymID
Změněno 2009-09-21
Štítek Basionym ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/originalNameUsageID
Definice A unique identifier for the basionym (botany) or basonym (bacteriology) of the scientificName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:basisOfRecord
Termín IRI http://rs.tdwg.org/dwc/terms/basisOfRecord
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/basisOfRecord-2023-09-13
Štítek Základ záznamu
Definice Specifická povaha datového záznamu.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například sadu místních názvů identifikátorů tříd v Darwin Core.
Příklady
  • MaterialEntity
  • PreservedSpecimen
  • FossilSpecimen
  • LivingSpecimen
  • MaterialSample
  • Event
  • HumanObservation
  • MachineObservation
  • Taxon
  • Occurrence
  • MaterialCitation
ABCD ekvivalence DataSets/DataSet/Units/Unit/RecordBasis
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2009-12-07_2
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:bed
Termín IRI http://rs.tdwg.org/dwc/terms/bed
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/bed-2023-09-13
Štítek Podloží
Definice Úplný název litostratigrafického podloží, z něhož byl dwc:MaterialEntity odebrán.
Příklady Harlem coal
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:behavior
Termín IRI http://rs.tdwg.org/dwc/terms/behavior
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/behavior-2026-05-26
Štítek Chování
Definice Chování, které vykazuje objekt typu dwc:Organism.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • roosting
  • foraging
  • running
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:behavior
Termín IRI http://rs.tdwg.org/dwc/iri/behavior
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/behavior-2026-05-26
Štítek Behavior (IRI)
Definice A behavior shown by a dwc:Organism.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dcterms:bibliographicCitation
Termín IRI http://purl.org/dc/terms/bibliographicCitation
Změněno 2023-06-28
Verze termínu IRI http://dublincore.org/usage/terms/history/#bibliographicCitation-002
Štítek Bibliografická citace
Definice Bibliografický odkaz na zdroj.
Poznámky Dublin Core: „Doporučeným postupem je uvést dostatečné bibliografické údaje, aby bylo možné zdroj co nejjednoznačněji identifikovat.“ Záměrem použití tohoto termínu v Darwin Core je poskytnout preferovaný způsob citování samotného zdroje - „jak citovat tento záznam“. Všimněte si, že zamýšleným použitím dcterms:references v Darwin Core je naopak poukázat na definitivní reprezentaci zdroje - „kde najít co nejbližší originální odkaz“, pokud je k dispozici.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dcterms:BibliographicResource
Termín IRI http://purl.org/dc/terms/BibliographicResource
Změněno 2026-05-26
Verze termínu IRI http://dublincore.org/usage/terms/history/#BibliographicResource-001
Štítek Bibliographic Resource
Definice A book, article, or other documentary resource.
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:binomial
Termín IRI http://rs.tdwg.org/dwc/terms/binomial
Změněno 2009-04-24
Štítek Binomial
Tento termín je zastaralý a již by se neměl používat.
Definice The combination of genus and first (species) epithet of the scientificName.
Poznámky Example: "Ctenomys sociabilis"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa/TaxonIdentified/ScientificName/FullScientificNameString
Typ Vlastnost
Název termínu dwciri:caste
Termín IRI http://rs.tdwg.org/dwc/iri/caste
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/caste-2026-05-26
Štítek Caste (IRI)
Definice A social caste of a dwc:Organism.
Poznámky Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:caste
Termín IRI http://rs.tdwg.org/dwc/terms/caste
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/caste-2026-05-26
Štítek Kasta
Definice A social caste of a dwc:Organism.
Poznámky Doporučeným osvědčeným postupem je použití řízeného slovníku, který nejlépe odpovídá dwc:Taxon. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • queen
  • male alate
  • intercaste
  • minor worker
  • soldier
  • ergatoid
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:catalogNumber
Termín IRI http://rs.tdwg.org/dwc/terms/catalogNumber
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/catalogNumber-2026-05-26
Štítek Katalogové číslo
Definice An identifier (preferably unique) for a resource within a collection.
Příklady
  • 145732
  • 145732a
  • 2008.1334
  • R-4313
ABCD ekvivalence DataSets/DataSet/Units/Unit/UnitID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:CatalogNumberNumeric
Termín IRI http://rs.tdwg.org/dwc/terms/CatalogNumberNumeric
Změněno 2009-04-24
Štítek Catalog Number Numeric
Tento termín je zastaralý a již by se neměl používat.
Definice The numeric value of the catalogNumber, used to facilitate numerical sorting and searching by ranges.
ABCD ekvivalence DataSets/DataSet/Units/Unit/UnitIDNumeric
Typ Vlastnost
Název termínu dwc:causeOfDeath
Termín IRI http://rs.tdwg.org/dwc/terms/causeOfDeath
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/causeOfDeath-2025-06-12
Štítek Příčna úmrtí
Definice Údaj o známé nebo předpokládané příčině úmrtí dwc:Organism.
Poznámky Příčinou mohou být přirozené příčiny (např. nemoci, predace), činnosti související s člověkem (např. zabíjení na silnicích, znečištění) nebo jiné faktory prostředí (např. extrémní povětrnostní jevy).
Příklady
  • trap
  • poison
  • starvation
  • drowning
  • shooting
  • old age
  • vehicle collision
  • disease
  • herbicide
  • burning
  • infanticide
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:class
Termín IRI http://rs.tdwg.org/dwc/terms/class
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/class-2023-06-28
Štítek Třída
Definice Úplný vědecký název třídy, do které je dwc:Taxon zařazen.
Příklady
  • Mammalia
  • Hepaticopsida
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = classis
Typ Vlastnost
Název termínu dwc:collectionCode
Termín IRI http://rs.tdwg.org/dwc/terms/collectionCode
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/collectionCode-2026-05-26
Štítek Kód sbírky
Definice A name, acronym, coden, or initialism identifying a collection.
Příklady
  • Mammals
  • Hildebrandt
  • EBIRD
  • VP
ABCD ekvivalence DataSets/DataSet/Units/Unit/SourceID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:collectionID
Termín IRI http://rs.tdwg.org/dwc/terms/collectionID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/collectionID-2026-05-26
Štítek ID sbírky
Definice An identifier for a collection.
Poznámky U fyzických exemplářů je doporučeným osvědčeným postupem použití celosvětově jedinečného a rozlišitelného identifikátoru z registru sbírek, jako je Globální registr vědeckých sbírek (https://scientific-collections.gbif.org/).
Příklady https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c
ABCD ekvivalence DataSets/DataSet/Units/Unit/SourceID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:continent
Termín IRI http://rs.tdwg.org/dwc/terms/continent
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/continent-2023-06-28
Štítek Kontinent
Definice Název kontinentu, ve kterém se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je použití řízeného slovníku, jako je například Getty Thesaurus of Geographic Names. Doporučeným osvědčeným postupem je ponechat toto pole prázdné, pokud dcterms:Location pokrývá více entit na této administrativní úrovni nebo pokud dcterms:Location může být v jedné nebo jiné z více možných entit na této úrovni. Násobnost a neurčitost geografické entity lze zachytit buď v termínu dwc:higherGeography, nebo v termínu dwc:locality, případně v obou.
Příklady
  • Africa
  • Antarctica
  • Asia
  • Europe
  • North America
  • Oceania
  • South America
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Continent
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:coordinatePrecision
Termín IRI http://rs.tdwg.org/dwc/terms/coordinatePrecision
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/coordinatePrecision-2023-06-28
Štítek Přesnost souřadnic
Definice Desetinná reprezentace přesnosti souřadnic uvedených v dwc:decimalLatitude a dwc:decimalLongitude.
Příklady
  • 0.00001 (běžný limit GPS pro desetinné stupně)
  • 0.000278 (nejbližší sekunda)
  • 0.01667 (nejbližší minuta)
  • 1.0 (nejbližší stupeň)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/ISOAccuracy or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/AccuracyStatement
Typ Vlastnost
Název termínu dwc:coordinateUncertaintyInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/coordinateUncertaintyInMeters-2026-05-26
Štítek Neurčitost souřadnic v metrech
Definice Vodorovná vzdálenost (v metrech) od zadaných hodnot dwc:decimalLatitude a dwc:decimalLongitude, která vymezuje nejmenší kruh obsahující celou lokalitu dcterms:Location. Hodnota nula není pro tento termín platná.
Poznámky Pokud je nejistota neznámá, nelze ji odhadnout nebo se na daný případ nevztahuje (protože nejsou k dispozici souřadnice), ponechte pole prázdné. Nula není pro tento údaj platnou hodnotou.
Příklady
  • 30 (přiměřená dolní mez odečtu GPS za dobrých podmínek k datu 2000-05-01 nebo později, pokud v té době nebyla zaznamenána skutečná přesnost)
  • 100 (přiměřená dolní mez odečtu GPS za dobrých podmínek před datem 2000-05-01, pokud v té době nebyla zaznamenána skutečná přesnost)
  • 71 (nejistota pro souřadnici UTM s přesností 100 metrů a známým prostorovým referenčním systémem)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinateErrorDistanceInMeters
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:country
Termín IRI http://rs.tdwg.org/dwc/terms/country
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/country-2023-06-28
Štítek Země
Definice Název země nebo hlavní správní jednotky, ve které se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je použití řízeného slovníku, jako je například Getty Thesaurus of Geographic Names. Doporučeným osvědčeným postupem je ponechat toto pole prázdné, pokud dcterms:Location pokrývá více entit na této administrativní úrovni nebo pokud dcterms:Location může být v jedné nebo jiné z více možných entit na této úrovni. Násobnost a neurčitost geografické entity lze zachytit buď v termínu dwc:higherGeography, nebo v termínu dwc:locality, případně v obou.
Příklady
  • Denmark
  • Colombia
  • España
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Country/Name
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:countryCode
Termín IRI http://rs.tdwg.org/dwc/terms/countryCode
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/countryCode-2026-05-26
Štítek Kód země
Definice Standardní kód země, ve které se dcterms:Location vyskytuje.
Poznámky Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Příklady
  • AR
  • SV
  • XZ
  • ZZ
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Country/ISO3166Code
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:county
Termín IRI http://rs.tdwg.org/dwc/terms/county
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/county-2023-06-28
Štítek Členění druhého řádu
Definice Úplný nezkrácený název nejbližšího menšího správního regionu, než je státProvincie (hrabství, okres, katastr atd.), ve kterém se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je použití řízeného slovníku, jako je například Getty Thesaurus of Geographic Names. Doporučeným osvědčeným postupem je ponechat toto pole prázdné, pokud dcterms:Location pokrývá více entit na této administrativní úrovni nebo pokud dcterms:Location může být v jedné nebo jiné z více možných entit na této úrovni. Násobnost a neurčitost geografické entity lze zachytit buď v termínu dwc:higherGeography, nebo v termínu dwc:locality, případně v obou.
Příklady
  • Missoula
  • Los Lagos
  • Mataró
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= County
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:cultivarEpithet
Termín IRI http://rs.tdwg.org/dwc/terms/cultivarEpithet
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/cultivarEpithet-2026-05-26
Štítek Přídomek kultivaru
Definice Část názvu kultivaru, skupiny kultivarů nebo grexu, která následuje po dwc:scientificName.
Poznámky According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
Příklady
  • King Edward (pro vědecký název Solanum tuberosum 'King Edward' a taxonRank kultivar)
  • Mishmiense (pro vědecký název Rhododendron boothii Mishmiense Group a taxonRank kultivar group)
  • Atlantis (pro vědecký název Paphiopedilum Atlantis grex a taxonRank grex)
ABCD ekvivalence http://rs.tdwg.org/abcd/terms/cultivarName or http://rs.tdwg.org/abcd/terms/cultivarGroupName or http://rs.tdwg.org/abcd/terms/breed (ABCD 3.0)
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:dataGeneralizations
Termín IRI http://rs.tdwg.org/dwc/terms/dataGeneralizations
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/dataGeneralizations-2023-06-28
Štítek Zobecnění dat
Definice Opatření přijatá za účelem snížení specifičnosti nebo úplnosti sdílených údajů oproti jejich původní podobě. Navrhuje, že na vyžádání mohou být k dispozici alternativní údaje vyšší kvality.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady Coordinates generalized from original GPS coordinates to the nearest half degree grid cell.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:dataGeneralizations
Termín IRI http://rs.tdwg.org/dwc/iri/dataGeneralizations
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/dataGeneralizations-2025-07-10
Štítek Data Generalizations (IRI)
Definice Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:Dataset
Termín IRI http://rs.tdwg.org/dwc/terms/Dataset
Změněno 2009-09-11
Štítek Dataset
Tento termín je zastaralý a již by se neměl používat.
Definice The category of information pertaining to a logical set of records.
ABCD ekvivalence DataSets/DataSet
Typ Třída
Název termínu dwc:datasetID
Termín IRI http://rs.tdwg.org/dwc/terms/datasetID
Změněno 2017-10-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/datasetID-2017-10-06
Štítek ID datové sady
Definice Identifikátor datové sady. Může to být globální jedinečný identifikátor nebo identifikátor specifický pro sbírku nebo instituci.
Příklady b15d4952-7d20-46f1-8a3e-556a512b04c5
ABCD ekvivalence DataSets/DataSet/DataSetGUID
Typ Vlastnost
Název termínu dwc:datasetName
Termín IRI http://rs.tdwg.org/dwc/terms/datasetName
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/datasetName-2026-05-26
Štítek Název datové sady
Definice A name of a source dataset.
Příklady
  • Grinnell Resurvey Mammals
  • Lacey Ctenomys Recaptures
ABCD ekvivalence DataSets/DataSet/Units/Unit/SourceID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:dateIdentified
Termín IRI http://rs.tdwg.org/dwc/terms/dateIdentified
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/dateIdentified-2025-06-12
Štítek Datum identifikace
Definice Datum, kdy bylo určeno, že předmět představuje dwc:Taxon.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Date/DateText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:day
Termín IRI http://rs.tdwg.org/dwc/terms/day
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/day-2023-06-28
Štítek Den
Definice Celé číslo dne v měsíci, kdy k dwc:Event došlo.
Příklady
  • 9
  • 28
ABCD ekvivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Typ Vlastnost
Název termínu dwc:decimalLatitude
Termín IRI http://rs.tdwg.org/dwc/terms/decimalLatitude
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/decimalLatitude-2026-05-26
Štítek Desetinná zeměpisná šířka
Definice A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Poznámky Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
Příklady -41.0983423
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LatitudeDecimal
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:decimalLongitude
Termín IRI http://rs.tdwg.org/dwc/terms/decimalLongitude
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/decimalLongitude-2026-05-26
Štítek Desetinná zeměpisná délka
Definice A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Poznámky Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
Příklady -121.1761111
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LongitudeDecimal
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:degreeOfEstablishment
Termín IRI http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/degreeOfEstablishment-2023-06-28
Štítek Stupeň zavedení
Definice Míra, do jaké dwc:Organismus přežívá, rozmnožuje se a rozšiřuje svůj areál v daném místě a čase.
Poznámky Doporučeným osvědčeným postupem je používat řetězce řízených hodnot z řízeného slovníku určeného pro použití s tímto termínem, který je uveden na adrese http://rs.tdwg.org/dwc/doc/doe/. Podrobnosti naleznete na adrese https://doi.org/10.3897/biss.3.38084. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • native
  • captive
  • cultivated
  • released
  • failing
  • casual
  • reproducing
  • established
  • colonising
  • invasive
  • widespreadInvasive
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_27
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:degreeOfEstablishment
Termín IRI http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/degreeOfEstablishment-2025-07-10
Štítek Degree of Establishment (IRI)
Definice The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Poznámky Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_27
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:digitalSpecimenID
Termín IRI http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/digitalSpecimenID-2026-05-26
Štítek Digital Specimen ID
Definice An identifier for a Digital Specimen resource.
Poznámky Digitální vzorek je definován na adrese https://doi.org/10.3897/rio.7.e67379. Identifikátor dwc:digitalSpecimenID je určen k jednoznačné a trvalé identifikaci digitálního exempláře. Doporučeným osvědčeným postupem je používat DOI se strojově čitelnými metadaty v záznamu DOI, který používá metadatový profil dohodnutý komunitou (známý také jako profil FDO) pro Digitální exemplář. Příklad viz: https://doi.org/10.3535/N75-CR4-0SM?noredirect. Identifikátor je určen pro artefakt digitální informace (digitální exemplář) na rozdíl od identifikátoru pro konkrétní instanci dwc:MaterialEntity.
Příklady
ABCD ekvivalence Note: /DataSets/DataSet/Units/Unit/UnitGUID could be used. A new term /DataSets/DataSet/Units/Unit/SpecimenUnit/digitalSpecimenID would make it distinguishable from URIs that identify the physical object or catalogue record.
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:discipline
Termín IRI http://rs.tdwg.org/dwc/iri/discipline
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/discipline-2025-06-12
Štítek Discipline (IRI)
Definice The primary branch or branches of knowledge represented by the record.
Poznámky This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:discipline
Termín IRI http://rs.tdwg.org/dwc/terms/discipline
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/discipline-2026-05-26
Štítek Disciplína
Definice The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
Poznámky This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( | ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • Botany
  • Botany | Virology | Taxonomy
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:disposition
Termín IRI http://rs.tdwg.org/dwc/iri/disposition
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/disposition-2026-05-26
Štítek Disposition (IRI)
Definice A current state of a dwc:MaterialEntity with respect to where it can be found.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:disposition
Termín IRI http://rs.tdwg.org/dwc/terms/disposition
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/disposition-2026-05-26
Štítek Dispozice
Definice A current state of a dwc:MaterialEntity with respect to where it can be found.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • in collection
  • missing
  • on loan
  • used up
  • destroyed
  • deaccessioned
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/Disposition
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:DwCType
Termín IRI http://rs.tdwg.org/dwc/terms/DwCType
Změněno 2014-10-23
Štítek Darwin Core Type
Tento termín je zastaralý a již by se neměl používat.
Definice The set of classes specified by the Darwin Core Type Vocabulary, used to categorize the nature or genre of the resource.
ABCD ekvivalence not in ABCD
Typ http://purl.org/dc/dcam/VocabularyEncodingScheme
Název termínu dwc:dynamicProperties
Termín IRI http://rs.tdwg.org/dwc/terms/dynamicProperties
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/dynamicProperties-2023-06-28
Štítek Dynamické vlastnosti
Definice Seznam dalších měření, skutečností, charakteristik nebo tvrzení o záznamu. Slouží jako mechanismus pro strukturovaný obsah.
Poznámky Doporučeným osvědčeným postupem je použití schématu kódování klíč:hodnota pro formát výměny dat, jako je JSON.
Příklady
  • {"heightInMeters":1.5}
  • {"targusLengthInMeters":0.014, "weightInGrams":120}
  • {"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}
  • {"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}
  • {"aspectHeading":277, "slopeInDegrees":6}
  • {"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:earliestAgeOrLowestStage
Termín IRI http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/earliestAgeOrLowestStage-2023-09-13
Štítek Nejstarší věk nebo nejnižší stadium
Definice Úplný název nejstaršího možného geochronologického stáří nebo nejnižšího chronostratigrafického stupně, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity odebrán.
Příklady
  • Atlantic
  • Boreal
  • Skullrockian
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:EarliestDateCollected
Termín IRI http://rs.tdwg.org/dwc/terms/EarliestDateCollected
Změněno 2009-04-24
Štítek Earliest Date Collected
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventDate
Definice The earliest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Poznámky Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Typ Vlastnost
Název termínu dwc:earliestEonOrLowestEonothem
Termín IRI http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/earliestEonOrLowestEonothem-2026-05-26
Štítek Nejstarší eon nebo nejnižší eonotém
Definice The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Příklady
  • Phanerozoic
  • Proterozoic
  • Precambrian
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:earliestEpochOrLowestSeries
Termín IRI http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/earliestEpochOrLowestSeries-2023-09-13
Štítek Nejstarší epocha nebo nejnižší řada
Definice Úplný název nejstarší možné geochronologické epochy nebo nejnižší chronostratigrafické řady, kterou lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Holocene
  • Pleistocene
  • Ibexian Series
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:earliestEraOrLowestErathem
Termín IRI http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/earliestEraOrLowestErathem-2023-09-13
Štítek Nejstarší éra nebo nejnižší eratém
Definice Úplný název nejstarší možné geochronologické éry nebo nejnižšího chronostratigrafického eratému, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Cenozoic
  • Mesozoic
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:earliestGeochronologicalEra
Termín IRI http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/earliestGeochronologicalEra-2023-09-13
Štítek Earliest Geochronological Era
Definice Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
Poznámky Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:earliestPeriodOrLowestSystem
Termín IRI http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/earliestPeriodOrLowestSystem-2023-09-13
Štítek Nejstarší období nebo nejnižší systém
Definice Úplný název nejstaršího možného geochronologického období nebo nejnižšího chronostratigrafického systému, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Neogene
  • Tertiary
  • Quaternary
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:endDayOfYear
Termín IRI http://rs.tdwg.org/dwc/terms/endDayOfYear
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/endDayOfYear-2026-05-26
Štítek Poslední den roku
Definice The latest integer day of the year on which a dwc:Event occurred.
Poznámky The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Příklady
  • 1 (1. ledna)
  • 32 (1. února)
  • 366 (31. prosince)
  • 365 (30. prosince v přestupném roce, 31. prosince v nepřestupném roce)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberEnd
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:EndTimeOfDay
Termín IRI http://rs.tdwg.org/dwc/terms/EndTimeOfDay
Změněno 2009-04-24
Štítek End Time of Day
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventTime
Definice The time of day when the event ended, expressed as decimal hours from midnight, local time.
Poznámky Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/TimeOfDayEnd
Typ Vlastnost
Název termínu dwciri:establishmentMeans
Termín IRI http://rs.tdwg.org/dwc/iri/establishmentMeans
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/establishmentMeans-2025-07-10
Štítek Establishment Means (IRI)
Definice Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Poznámky Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_25
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:establishmentMeans
Termín IRI http://rs.tdwg.org/dwc/terms/establishmentMeans
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/establishmentMeans-2026-05-26
Štítek Způsob zavlečení
Definice Vyjádření k tomu, zda byl dwc:Organism zavlečen na dané místo a do daného času přímou nebo nepřímou činností moderního člověka.
Poznámky Doporučeným osvědčeným postupem je používat řetězce řízených hodnot z řízeného slovníku určeného pro použití s tímto termínem, který je uveden na adrese http://rs.tdwg.org/dwc/doc/em/. Podrobnosti naleznete na adrese https://doi.org/10.3897/biss.3.38084. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • native
  • nativeEndemic
  • nativeReintroduced
  • introduced
  • introducedAssistedColonisation
  • vagrant
  • uncertain
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/EstablishmentMeans
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_25
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Event
Termín IRI http://rs.tdwg.org/dwc/terms/Event
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Event-2026-05-26
Štítek Událost
Definice An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
Příklady
  • a material collecting event
  • a bird observation
  • a camera trap image capture
  • an organism occurrence
  • a biotic survey
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:EventAttribute
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttribute
Změněno 2009-04-24
Štítek Event Attribute
Tento termín je zastaralý a již by se neměl používat.
Definice Container class for information about attributes related to a given sampling event.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Třída
Název termínu dwc:EventAttributeAccuracy
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeAccuracy
Změněno 2009-04-24
Štítek Event Attribute Accuracy
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Definice The description of the error associated with the EventAttributeValue.
Poznámky Example: "0.01", "normal distribution with variation of 2 m"
ABCD ekvivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Název termínu dwc:EventAttributeDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedBy
Změněno 2009-04-24
Štítek Event Attribute Determined By
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Definice The agent responsible for having determined the value of the measurement or characteristic of the sampling event.
Poznámky Example: "Robert Hijmans"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Název termínu dwc:EventAttributeDeterminedDate
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedDate
Změněno 2009-04-24
Štítek Event Attribute Determined Date
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Definice The date on which the the measurement or characteristic of the sampling event was made.
Poznámky Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Název termínu dwc:EventAttributeID
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeID
Změněno 2009-04-24
Štítek Event Attribute ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementID
Definice An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:EventAttributeRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeRemarks
Změněno 2009-04-24
Štítek Event Attribute Remarks
Tento termín je zastaralý a již by se neměl používat.
Definice Comments or notes accompanying the measurement or characteristic of the sampling event.
Poznámky Example: "temperature taken at 15:00"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:eventAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/eventAttributes
Změněno 2009-10-09
Štítek Event Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements or characteristics of the Event.
Poznámky Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Vlastnost
Název termínu dwc:EventAttributeType
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeType
Změněno 2009-04-24
Štítek Event Attribute Type
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementType
Je nahrazen http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Definice The nature of the measurement or characteristic of the sampling event. Recommended best practice is to use a controlled vocabulary.
Poznámky Example: "Temperature"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Název termínu dwc:EventAttributeUnit
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeUnit
Změněno 2009-04-24
Štítek Event Attribute Unit
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Definice The units for the value of the measurement or characteristic of the sampling event. Recommended best practice is to use International System of Units (SI) units.
Poznámky Example: "C"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Název termínu dwc:EventAttributeValue
Termín IRI http://rs.tdwg.org/dwc/terms/EventAttributeValue
Změněno 2009-04-24
Štítek Event Attribute
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Definice The value of the measurement or characteristic of the sampling event.
Poznámky Example: "22"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Název termínu dwciri:eventCategory
Termín IRI http://rs.tdwg.org/dwc/iri/eventCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/eventCategory-2026-05-26
Štítek Event Category (IRI)
Definice A broad category that best matches the nature of a dwc:Event.
Poznámky Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:eventCategory
Termín IRI http://rs.tdwg.org/dwc/terms/eventCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventCategory-2026-05-26
Štítek Event Category
Definice A broad category that best matches the nature of a dwc:Event.
Poznámky Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: Event, MaterialGathering, Occurrence, OrganismInteraction, or Survey. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • Event
  • MaterialGathering
  • Occurrence
  • OrganismInteraction
  • Survey
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:eventDate
Termín IRI http://rs.tdwg.org/dwc/terms/eventDate
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventDate-2026-05-26
Štítek Datum události
Definice A date-time or time interval during which a dwc:Event occurred.
Poznámky Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:eventID
Termín IRI http://rs.tdwg.org/dwc/terms/eventID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventID-2023-06-28
Štítek ID události
Definice Identifikátor souboru informací spojených s dwc:Event (něco, co nastane v určitém místě a čase). Může to být globální jedinečný identifikátor nebo identifikátor specifický pro datovou sadu.
Příklady INBO:VIS:Ev:00009375
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Code
Typ Vlastnost
Název termínu dwc:EventMeasurement
Termín IRI http://rs.tdwg.org/dwc/terms/EventMeasurement
Změněno 2009-10-09
Štítek Event Measurement
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Definice The category of information pertaining to measurements associated with an event.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Třída
Název termínu dwc:eventMeasurementAccuracy
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Změněno 2009-10-09
Štítek Event Measurement Accuracy
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definice The description of the error associated with the EventAttributeValue.
Poznámky Example: "0.01", "normal distribution with variation of 2 m"
ABCD ekvivalence DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Název termínu dwc:eventMeasurementDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Změněno 2009-10-09
Štítek Event Measurement Determined By
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Definice The agent responsible for having determined the value of the measurement or characteristic of the event.
Poznámky Example: "Robert Hijmans"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Název termínu dwc:eventMeasurementDeterminedDate
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Změněno 2009-10-09
Štítek Event Measurement Determined Date
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definice The date on which the the measurement or characteristic of the event was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Poznámky Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Název termínu dwc:eventMeasurementID
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementID
Změněno 2009-10-09
Štítek Event Measurement ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementID
Definice An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:eventMeasurementRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementRemarks
Změněno 2009-10-09
Štítek Event Measurement Remarks
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementRemarks
Definice Comments or notes accompanying the measurement or characteristic of the event.
Poznámky Example: "temperature taken at 15:00"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:eventMeasurementType
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementType
Změněno 2009-10-09
Štítek Event Measurement Type
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementType
Definice The nature of the measurement or characteristic of the event. Recommended best practice is to use a controlled vocabulary.
Poznámky Example: "temperature"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Název termínu dwc:eventMeasurementUnit
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Změněno 2009-10-09
Štítek Event Measurement Unit
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementUnit
Definice The units for the value of the measurement or characteristic of the event. Recommended best practice is to use International System of Units (SI) units.
Poznámky Example: "C"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Název termínu dwc:eventMeasurementValue
Termín IRI http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Změněno 2009-10-09
Štítek Event Measurement Value
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementValue
Definice The value of the measurement or characteristic of the event.
Poznámky Example: "22"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Název termínu dwc:eventRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/eventRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventRemarks-2023-06-28
Štítek Poznámky k události
Definice Komentáře nebo poznámky k dwc:Event.
Příklady After the recent rains the river is nearly at flood stage.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Notes
Typ Vlastnost
Název termínu dwc:eventTime
Termín IRI http://rs.tdwg.org/dwc/terms/eventTime
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventTime-2025-06-12
Štítek Čas události
Definice Čas nebo interval, během kterého došlo k události dwc:Event.
Poznámky Doporučeným osvědčeným postupem je používat denní dobu, která odpovídá normě ISO 8601-1:2019.
Příklady
  • 14:07-06:00 (v 14:07 nebo později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 08:40:21Z (v 8:40:21 nebo později a před 8:41:22 UTC)
  • 13:00:00Z/15:30:00Z (v 13:00 nebo později a před 15:30 UTC)
ABCD ekvivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:eventType
Termín IRI http://rs.tdwg.org/dwc/iri/eventType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/eventType-2026-05-26
Štítek Event Type (IRI)
Definice A narrow category that best matches the nature of a dwc:Event.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:eventType
Termín IRI http://rs.tdwg.org/dwc/terms/eventType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/eventType-2026-05-26
Štítek Typ události
Definice A narrow category that best matches the nature of a dwc:Event.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • bioBlitz
  • cameraTrapDeployment
  • expedition
  • project
  • siteVisit
  • trawl
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:family
Termín IRI http://rs.tdwg.org/dwc/terms/family
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/family-2023-06-28
Štítek Čeleď
Definice Úplný vědecký název čeledi, do které je dwc:Taxon zařazen.
Příklady
  • Felidae
  • Monocleaceae
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = familia
Typ Vlastnost
Název termínu dwc:feedbackURL
Termín IRI http://rs.tdwg.org/dwc/terms/feedbackURL
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/feedbackURL-2025-06-12
Štítek URL pro zpětnou vazbu
Definice Unifikovaný lokátor zdroje (URL), který odkazuje na webovou stránku, na níž lze odeslat formulář pro získání zpětné vazby k záznamu.
Poznámky Doporučeným osvědčeným postupem je volitelně zahrnout řetězce dotazů, které slouží k předvyplnění prvků formuláře webové stránky a sdělují kontext.
Příklady https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:fieldNotes
Termín IRI http://rs.tdwg.org/dwc/iri/fieldNotes
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/fieldNotes-2023-06-28
Štítek Field Notes (IRI)
Definice One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Poznámky The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:fieldNotes
Termín IRI http://rs.tdwg.org/dwc/terms/fieldNotes
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/fieldNotes-2023-06-28
Štítek Poznámky z terénu
Definice Jeden z těchto údajů: a) indikátor existence, b) odkaz na (publikace, URI) nebo c) text poznámek pořízených v terénu o dwc:Event.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady Notes available in the Grinnell-Miller Library.
ABCD ekvivalence DataSets/DataSet/Units/Unit/FieldNotes
Typ Vlastnost
Název termínu dwc:fieldNumber
Termín IRI http://rs.tdwg.org/dwc/terms/fieldNumber
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/fieldNumber-2026-05-26
Štítek Číslo terénní poznámky
Definice An identifier given to a dwc:Event in the field.
Poznámky Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady RV Sol 87-03-08
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Code
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:fieldNumber
Termín IRI http://rs.tdwg.org/dwc/iri/fieldNumber
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/fieldNumber-2026-05-26
Štítek Field Number (IRI)
Definice An identifier given to a dwc:Event in the field.
Poznámky Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:footprintSpatialFit
Termín IRI http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/footprintSpatialFit-2026-05-26
Štítek Stopa prostorového rozložení
Definice A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Poznámky Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Příklady
  • 0
  • 1
  • 1.5708
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/FootprintSpatialFit
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:footprintSRS
Termín IRI http://rs.tdwg.org/dwc/terms/footprintSRS
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/footprintSRS-2025-06-12
Štítek Stopa SRS
Definice Elipsoid, geodetický referenční bod nebo prostorový referenční systém (SRS), na kterém je založena geometrie uvedená v dwc:footprintWKT.
Poznámky Doporučeným postupem je použít kód EPSG systému SRS, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód geodetického bodu, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód elipsoidu, pokud je znám. Pokud není znám žádný z těchto údajů, použijte hodnotu „nezaznamenáno“. Je také povoleno uvést SRS ve formátu Well-Known-Text, zejména pokud žádný kód EPSG neposkytuje potřebné hodnoty pro atributy SRS. Tento termín nepoužívejte k popisu SRS dwc:decimalLatitude a dwc:decimalLongitude, ani k popisu jakýchkoli přesných souřadnic – místo toho použijte dwc:geodeticDatum a dwc:verbatimSRS. Tento termín má ekvivalent v jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli hodnotu znakového řetězce.
Příklady
  • EPSG:4326
  • GEOGCS[„GCS_WGS_1984“, DATUM[„D_WGS_1984“, SPHEROID[„WGS_1984“,6378137,298.257223563]], PRIMEM[‚Greenwich‘,0], UNIT[„Degree“,0.0174532925199433]] (WKT pro standardní prostorový referenční systém WGS84 EPSG:4326)
  • není zaznamenáno
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:footprintSRS
Termín IRI http://rs.tdwg.org/dwc/iri/footprintSRS
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/footprintSRS-2025-06-12
Štítek Footprint SRS (IRI)
Definice The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Poznámky Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:footprintWKT
Termín IRI http://rs.tdwg.org/dwc/terms/footprintWKT
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/footprintWKT-2026-05-26
Štítek Stopa WKT
Definice A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Poznámky A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Příklady POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20)) (ohraničující pole o jednom stupni s protilehlými rohy na zeměpisné délce=10, šířce=20 a zeměpisné délce=11, šířce=21)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/FootprintWKT (ABCD v2.06b)
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:footprintWKT
Termín IRI http://rs.tdwg.org/dwc/iri/footprintWKT
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/footprintWKT-2025-07-10
Štítek Footprint WKT (IRI)
Definice A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:formation
Termín IRI http://rs.tdwg.org/dwc/terms/formation
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/formation-2023-09-13
Štítek Formace
Definice Úplný název litostratigrafické formace, ze které byl dwc:MaterialEntity získán.
Příklady
  • Notch Peak Formation
  • House Limestone
  • Fillmore Formation
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:FossilSpecimen
Termín IRI http://rs.tdwg.org/dwc/terms/FossilSpecimen
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/FossilSpecimen-2023-09-18
Štítek Fosilní exemplář
Definice Zachovalý exemplář, který je zkamenělinou.
Příklady
  • a body fossil
  • a coprolite
  • a gastrolith
  • an ichnofossil
  • a piece of a petrified tree
ABCD ekvivalence RecordBasisEnum/FossileSpecimen
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwciri:fromLithostratigraphicUnit
Termín IRI http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/fromLithostratigraphicUnit-2015-03-27
Štítek From Lithostratigraphic Unit
Definice Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
Poznámky Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:fundingAttribution
Termín IRI http://rs.tdwg.org/dwc/iri/fundingAttribution
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/fundingAttribution-2025-07-10
Štítek Funding Attribution (IRI)
Definice An organization or agency that provided funding for a project.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu ac:fundingAttribution
Termín IRI http://rs.tdwg.org/ac/terms/fundingAttribution
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/ac/terms/version/fundingAttribution-2020-01-27
Štítek Přidělení finančních prostředků
Definice Textový popis organizací nebo jednotlivců, kteří financovali vytvoření zdroje.
Poznámky Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
  • Artsdatabanken
  • National Science Foundation
  • Norges forskningsråd
  • Ocean Census | Nippon Foundation
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:fundingAttributionID
Termín IRI http://rs.tdwg.org/dwc/terms/fundingAttributionID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/fundingAttributionID-2026-05-26
Štítek ID přidělení finančních prostředků
Definice An identifier for a dcterms:Agent that financially supported a project.
Poznámky Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Generalizations
Termín IRI http://rs.tdwg.org/dwc/terms/Generalizations
Změněno 2009-04-24
Štítek Generalizations
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/dataGeneralizations
Definice Actions taken to make the data as shared less specific or complete than in its original form. Suggests that alternative data of highly quality may be available on request.
Poznámky Examples: "Coordinates generalized from original GPS coordinates to the nearest half degree grid cell", "locality information given only to nearest county".
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:genericName
Termín IRI http://rs.tdwg.org/dwc/terms/genericName
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/genericName-2023-06-28
Štítek Obecný název
Definice Rodová část dwc:scientificName bez autorství.
Poznámky U synonym se může lišit přijímaný rod a rodová část názvu. Termín dwc:genericName by měl být použit společně s dwc:specificEpithet pro vytvoření binomického názvu a s dwc:infraspecificEpithet pro vytvoření trinomického názvu. Termín dwc:genericName by se měl používat pouze pro kombinace. Jednočleny obecného stupně nemají dwc:genericName.
Příklady Felis (pro vědecký název Felis concolor, s doprovodnými hodnotami Puma concolor v acceptedNameUsage a Puma v rodu)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:genus
Termín IRI http://rs.tdwg.org/dwc/terms/genus
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/genus-2023-06-28
Štítek Rod
Definice Úplný vědecký název rodu, do kterého je dwc:Taxon zařazen.
Příklady
  • Puma
  • Monoclea
ABCD ekvivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Viral/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/GenusOrMonomial}
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:geodeticDatum
Termín IRI http://rs.tdwg.org/dwc/terms/geodeticDatum
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/geodeticDatum-2025-06-12
Štítek Geodetické datum
Definice Elipsoid, geodetický referenční bod nebo prostorový referenční systém (SRS), na kterém jsou založeny zeměpisné souřadnice uvedené v dwc:decimalLatitude a dwc:decimalLongitude.
Poznámky Doporučeným osvědčeným postupem je použít kód EPSG SRS, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód geodetického podkladu, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód elipsoidu, je-li znám. Není-li žádný z těchto údajů znám, použijte hodnotu nezaznamenáno. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje doslovnou hodnotu řetězce.
Příklady
  • EPSG:4326
  • WGS84
  • NAD27
  • Campo Inchauspe
  • European 1950
  • Clarke 1866
  • not recorded
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/SpatialDatum
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:geodeticDatum
Termín IRI http://rs.tdwg.org/dwc/iri/geodeticDatum
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/geodeticDatum-2025-06-12
Štítek Geodetic Datum (IRI)
Definice The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Poznámky Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value not recorded.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:GeologicalContext
Termín IRI http://rs.tdwg.org/dwc/terms/GeologicalContext
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/GeologicalContext-2026-05-26
Štítek Geologická souvislost
Definice A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity.
Příklady
  • a particular lithostratigraphic layer
  • a specific chronostratigraphic unit
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Stratigraphy
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:geologicalContextID
Termín IRI http://rs.tdwg.org/dwc/terms/geologicalContextID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/geologicalContextID-2023-06-28
Štítek ID geologické souvislosti
Definice Identifikátor souboru informací spojených s dwc:GeologicalContext (umístění v rámci geologického kontextu, např. stratigrafie). Může to být globální jedinečný identifikátor nebo identifikátor specifický pro danou datovou sadu.
Příklady https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:georeferencedBy
Termín IRI http://rs.tdwg.org/dwc/terms/georeferencedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferencedBy-2026-05-26
Štítek Georeferencováno od
Definice A name for a dcterms:Agent responsible for providing a georeference.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • Brad Millen (ROM)
  • Kristina Yamamoto | Janet Fang
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:georeferencedBy
Termín IRI http://rs.tdwg.org/dwc/iri/georeferencedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/georeferencedBy-2026-05-26
Štítek Georeferenced By (IRI)
Definice An IRI identifying a dcterms:Agent responsible for providing a georeference.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:georeferencedDate
Termín IRI http://rs.tdwg.org/dwc/terms/georeferencedDate
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferencedDate-2025-06-12
Štítek Georeferencované datum
Definice Datum, kdy byla dcterms:Location georeferencována.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2011-10-16_9
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:georeferenceProtocol
Termín IRI http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/georeferenceProtocol-2026-05-26
Štítek Georeference Protocol (IRI)
Definice A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:georeferenceProtocol
Termín IRI http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferenceProtocol-2026-05-26
Štítek Protokol georeference
Definice A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinateMethod
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:georeferenceRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferenceRemarks-2025-06-12
Štítek Poznámky ke georeferenci
Definice Komentáře nebo poznámky k určení prostorového popisu, vysvětlující předpoklady, které doplňují nebo jsou v rozporu s předpoklady formalizovanými v metodě uvedené v dwc:georeferenceProtocol.
Příklady Assumed distance by road (Hwy. 101)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceRemarks
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:georeferenceSources
Termín IRI http://rs.tdwg.org/dwc/terms/georeferenceSources
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferenceSources-2026-05-26
Štítek Zdroje georeferencí
Definice A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceSources
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:georeferenceSources
Termín IRI http://rs.tdwg.org/dwc/iri/georeferenceSources
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/georeferenceSources-2026-05-26
Štítek Georeference Sources (IRI)
Definice An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
Poznámky Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:georeferenceVerificationStatus
Termín IRI http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/georeferenceVerificationStatus-2025-07-10
Štítek Georeference Verification Status (IRI)
Definice A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:georeferenceVerificationStatus
Termín IRI http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/georeferenceVerificationStatus-2023-06-28
Štítek Stav ověření georeference
Definice Kategorický popis míry, do jaké byl georeferenční údaj ověřen jako nejlepší možný prostorový popis dcterms:Location of the dwc:Occurrence.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • unable to georeference
  • requires georeference
  • requires verification
  • verified by data custodian
  • verified by contributor
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceVerificationStatus
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Název termínu dwc:group
Termín IRI http://rs.tdwg.org/dwc/terms/group
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/group-2023-09-13
Štítek Skupina
Definice Úplný název litostratigrafické skupiny, ze které byl dwc:MaterialEntity získán.
Příklady
  • Bathurst
  • Lower Wealden
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:habitat
Termín IRI http://rs.tdwg.org/dwc/terms/habitat
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/habitat-2023-06-28
Štítek Stanoviště
Definice Kategorie nebo popis stanoviště, ve kterém k dwc:Event došlo.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • oak savanna
  • pre-cordilleran steppe
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Biotope/Text
Typ Vlastnost
Název termínu dwciri:habitat
Termín IRI http://rs.tdwg.org/dwc/iri/habitat
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/habitat-2025-07-10
Štítek Habitat (IRI)
Definice A category or description of the habitat in which the dwc:Event occurred.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:higherClassification
Termín IRI http://rs.tdwg.org/dwc/terms/higherClassification
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/higherClassification-2023-06-28
Štítek Vyšší zařazení
Definice Seznam (spojený a oddělený) názvů taxonů končící na stupni bezprostředně vyšším než odkazovaný dwc:Taxon.
Poznámky Doporučeným postupem je oddělit hodnoty v seznamu mezerou svislou čarou mezerou ( | ), přičemž termíny jsou seřazeny od nejvyššího taxonomického stupně po nejnižší.
Příklady
  • Plantae | Tracheophyta | Magnoliopsida | Ranunculales | Ranunculaceae | Ranunculus
  • Animalia
  • Animalia | Chordata | Vertebrata | Mammalia | Theria | Eutheria | Rodentia | Hystricognatha | Hystricognathi | Ctenomyidae | Ctenomyini | Ctenomys
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:higherGeography
Termín IRI http://rs.tdwg.org/dwc/terms/higherGeography
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/higherGeography-2023-06-28
Štítek Vyšší geografie
Definice Seznam (spojený a oddělený) zeměpisných názvů, které jsou méně specifické než informace obsažené v termínu dwc:locality.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ) a termíny řadit od nejméně specifických po nejvíce specifické.
Příklady
  • Severní Atlantik
  • Jižní Amerika | Argentina | Patagonie | Parque Nacional Nahuel Huapi | Neuquén | Los Lagos s doprovodnými hodnotami Jižní Amerika (kontinent) Argentina (země), Neuquén (rozdělení prvního řádu) a Los Lagos (rozdělení druhého řádu)
ABCD ekvivalence {DataSets/DataSet/Units/Unit/Gathering/LocalityText or DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName}
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:higherGeographyID
Termín IRI http://rs.tdwg.org/dwc/terms/higherGeographyID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/higherGeographyID-2023-06-28
Štítek ID vyšší geografie
Definice Identifikátor zeměpisné oblasti, ve které se dcterms:Location vyskytl.
Poznámky Doporučeným osvědčeným postupem je použití trvalého identifikátoru z řízeného slovníku, jako je například Getty Thesaurus of Geographic Names.
Příklady http://vocab.getty.edu/tgn/1002002 (Antarktida a ostrovy v jižním Atlantiku, Národní území Ohňová země, Argentina).
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:HigherTaxon
Termín IRI http://rs.tdwg.org/dwc/terms/HigherTaxon
Změněno 2009-08-24
Štítek Higher Taxon
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of the names for the taxonomic ranks less specific than the ScientificName.
Poznámky Example: "Animalia, Chordata, Vertebrata, Mammalia, Theria, Eutheria, Rodentia, Hystricognatha, Hystricognathi, Ctenomyidae, Ctenomyini, Ctenomys".
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Typ Vlastnost
Název termínu dwc:higherTaxonconceptID
Termín IRI http://rs.tdwg.org/dwc/terms/higherTaxonconceptID
Změněno 2009-08-24
Štítek Higher Taxon Concept ID
Tento termín je zastaralý a již by se neměl používat.
Definice A unique identifier for the taxon concept less specific than that given in the taxonConceptID.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:HigherTaxonID
Termín IRI http://rs.tdwg.org/dwc/terms/HigherTaxonID
Změněno 2009-08-24
Štítek Higher Taxon ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Definice A global unique identifier for the parent to the taxon.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:higherTaxonName
Termín IRI http://rs.tdwg.org/dwc/terms/higherTaxonName
Změněno 2009-08-24
Štítek Higher Taxon Name
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/higherClassification
Definice A list (concatenated and separated) of the names for the taxonomic ranks less specific than that given in the scientificName.
Poznámky Example: "Animalia; Chordata; Vertebrata; Mammalia; Theria; Eutheria; Rodentia; Hystricognatha; Hystricognathi; Ctenomyidae; Ctenomyini; Ctenomys"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Typ Vlastnost
Název termínu dwc:higherTaxonNameID
Termín IRI http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Změněno 2009-08-24
Štítek Higher Taxon Name ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/parentNameUsageID
Definice A unique identifier for the name of the next higher rank than the scientificName in a taxonomic classification. See higherTaxonName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:highestBiostratigraphicZone
Termín IRI http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/highestBiostratigraphicZone-2023-09-13
Štítek Nejvyšší biostratigrafická zóna
Definice Úplný název nejvyšší možné geologické biostratigrafické zóny stratigrafického horizontu, ze kterého byl dwc:MaterialEntity odebrán.
Příklady Blancan
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:HumanObservation
Termín IRI http://rs.tdwg.org/dwc/terms/HumanObservation
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/HumanObservation-2023-09-18
Štítek Pozorování člověkem
Definice Výstup procesu lidského pozorování.
Příklady
  • evidence of a dwc:Occurrence taken from field notes or literature
  • a record of a dwc:Occurrence without physical evidence or evidence captured with a machine
ABCD ekvivalence RecordBasisEnum/HumanObservation
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwc:Identification
Termín IRI http://rs.tdwg.org/dwc/terms/Identification
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Identification-2026-05-26
Štítek Identifikace
Definice A classification of a resource according to a classification scheme.
Poznámky For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
Příklady
  • a subspecies determination of an organism
  • a nomenclatural act designating a specimen as a holotype
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:identificationAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/identificationAttributes
Změněno 2009-10-09
Štítek Identification Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Identification.
Poznámky Example: "natureOfID=expert identification; identificationEvidence=cytochrome B sequence"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:identificationID
Termín IRI http://rs.tdwg.org/dwc/terms/identificationID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationID-2026-05-26
Štítek ID Identifikace
Definice An identifier for a dwc:Identification.
Poznámky Recommended best practice is to use a globally unique identifier.
Příklady 9992
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:identificationQualifier
Termín IRI http://rs.tdwg.org/dwc/iri/identificationQualifier
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/identificationQualifier-2025-07-10
Štítek Identification Qualifier (IRI)
Definice A controlled value to express the determiner's doubts about the dwc:Identification.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:identificationQualifier
Termín IRI http://rs.tdwg.org/dwc/terms/identificationQualifier
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationQualifier-2023-06-28
Štítek Identifikační kvalifikátor
Definice Krátká věta nebo standardní výraz ("cf.", "aff.") vyjadřující pochybnosti určovatele o dwc:Identification.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • aff. agrifolia var. oxyadenia (pro Quercus aff. agrifolia var. oxyadenia s doprovodnými hodnotami Quercus v rodu, agrifolia ve specifickémEpithet, oxyadenia v infraspecifickémEpithet a var. v taxonRank)
  • cf. var. oxyadenia (pro Quercus agrifolia cf. var. oxyadenia s doprovodnými hodnotami Quercus v rodu, agrifolia ve specificEpithet, oxyadenia v infraspecificEpithet a var. v taxonRank)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/IdentificationQualifier
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Název termínu dwc:identificationReferences
Termín IRI http://rs.tdwg.org/dwc/terms/identificationReferences
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationReferences-2026-05-26
Štítek Odkazy na identifikaci
Definice A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
Poznámky When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
  • Aves del Noroeste Patagonico. Christie et al. 2004.
  • Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. | Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/References
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:identificationRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/identificationRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationRemarks-2023-06-28
Štítek Poznámky k identifikaci
Definice Komentáře nebo poznámky k dwc:Identification.
Příklady Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Notes
Typ Vlastnost
Název termínu dwc:identificationType
Termín IRI http://rs.tdwg.org/dwc/terms/identificationType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationType-2026-05-26
Štítek Identification Type
Definice A category that best matches the nature of a dwc:Identification.
Poznámky The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • geography
  • taxonomicRevision
  • functionalAttributes
  • nucleotideAnalysis
  • karyotype
  • media
  • relationship
  • features
  • fineFeatures
  • unknown
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:identificationType
Termín IRI http://rs.tdwg.org/dwc/iri/identificationType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/identificationType-2026-05-26
Štítek Identification Type (IRI)
Definice A category that best matches the nature of a dwc:Identification.
Poznámky The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:identificationVerificationStatus
Termín IRI http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identificationVerificationStatus-2026-05-26
Štítek Stav ověření identifikace
Definice A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, jako je slovník používaný v HISPID a ABCD. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady 0 (unverified in HISPID/ABCD)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2011-10-16_10
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:identificationVerificationStatus
Termín IRI http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/identificationVerificationStatus-2026-05-26
Štítek Identification Verification Status (IRI)
Definice A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Poznámky Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:identifiedBy
Termín IRI http://rs.tdwg.org/dwc/terms/identifiedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identifiedBy-2026-05-26
Štítek Identifikováno kým
Definice A name for a dcterms:Agent responsible for making a dwc:Identification.
Poznámky When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • James L. Patton
  • Theodore Pappenfuss | Robert Macey
  • MegaDetector V5
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Identifiers/IdentifiersText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:identifiedBy
Termín IRI http://rs.tdwg.org/dwc/iri/identifiedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/identifiedBy-2026-05-26
Štítek Identified By (IRI)
Definice An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
Poznámky When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:identifiedByID
Termín IRI http://rs.tdwg.org/dwc/terms/identifiedByID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/identifiedByID-2026-05-26
Štítek Identifikováno podle ID
Definice An identifier for a dcterms:Agent responsible for making a dwc:Identification.
Poznámky When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:inCollection
Termín IRI http://rs.tdwg.org/dwc/iri/inCollection
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/inCollection-2015-03-27
Štítek In Collection
Definice Use to link any subject resource that is part of a collection to the collection containing the resource.
Poznámky Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:inDataset
Termín IRI http://rs.tdwg.org/dwc/iri/inDataset
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/inDataset-2015-03-27
Štítek In Dataset
Definice Use to link a subject dataset record to the dataset which contains it.
Poznámky A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:inDescribedPlace
Termín IRI http://rs.tdwg.org/dwc/iri/inDescribedPlace
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/inDescribedPlace-2015-03-27
Štítek In Described Place
Definice Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
Poznámky Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
Příklady http://vocab.getty.edu/tgn/1019987
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:individualCount
Termín IRI http://rs.tdwg.org/dwc/terms/individualCount
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/individualCount-2023-06-28
Štítek Individuální počet
Definice Počet osob přítomných v době dwc:Occurrence.
Příklady
  • 0
  • 1
  • 25
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue
Typ Vlastnost
Název termínu dwc:individualID
Termín IRI http://rs.tdwg.org/dwc/terms/individualID
Změněno 2014-10-23
Štítek Individual ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/organismID
Definice An identifier for an individual or named group of individual organisms represented in the Occurrence. Meant to accommodate resampling of the same individual or group for monitoring purposes. May be a global unique identifier or an identifier specific to a data set.
Poznámky Examples: "U.amer. 44", "Smedley", "Orca J 23"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/NamedIndividual or DataSets/DataSet/Units/Unit/ObservationUnit/ObservationUnitIdentifiers/ObservationUnitIdentifier or DataSets/DataSet/Units/Unit/SpecimenUnit/Accessions/AccessionNumber
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwciri:informationWithheld
Termín IRI http://rs.tdwg.org/dwc/iri/informationWithheld
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/informationWithheld-2026-05-26
Štítek Information Withheld (IRI)
Definice Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:informationWithheld
Termín IRI http://rs.tdwg.org/dwc/terms/informationWithheld
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/informationWithheld-2026-05-26
Štítek Zatajené informace
Definice Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • location information not given for endangered species
  • collector identities withheld | ask about tissue samples
ABCD ekvivalence DataSets/DataSet/Units/Unit/InformationWithheld
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:infragenericEpithet
Termín IRI http://rs.tdwg.org/dwc/terms/infragenericEpithet
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/infragenericEpithet-2023-06-28
Štítek Infragenerický epiteton
Definice Infragenerická část binomického názvu, která je vyšší než druh, ale nižší než rod.
Poznámky Termín dwc:infragenericEpithet by měl být používán ve spojení s dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank a dwc:scientificNameAuthorship, aby reprezentoval jednotlivé prvky kompletního dwc:scientificName. Lze je použít k označení zařazení druhu do podrodu, které se v zoologii často uvádí v závorce. Může být také použit pro sdílení infragenerických jmen, jako jsou botanické sekce (např. Vicia sect. Cracca).
Příklady
  • Abacetillus (pro vědecký název Abacetus (Abacetillus) ambiguus)
  • Cracca (pro vědecký název Vicia sect. Cracca)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Bacterial/Subgenus (for bacterial names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/Subgenus (for zoological names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet (for botanical names)
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:infraspecificEpithet
Termín IRI http://rs.tdwg.org/dwc/terms/infraspecificEpithet
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/infraspecificEpithet-2026-05-26
Štítek Infraspecifický epithet
Definice The name of the lowest or terminal infraspecific of the dwc:scientificName.
Poznámky In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string Indigofera charlieriana subsp. sessilis var. scaberrima is scaberrima and the dwc:scientificName is Indigofera charlieriana var. scaberrima. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
Příklady
  • concolor (for scientificName Puma concolor concolor)
  • oxyadenia (for scientificName Quercus agrifolia var. oxyadenia)
  • laxa (for scientificName Cheilanthes hirta f. laxa)
  • scaberrima (for scientificName Indigofera charlieriana var. scaberrima)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SubspeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/SecondEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SubspeciesEpithet
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:institutionCode
Termín IRI http://rs.tdwg.org/dwc/terms/institutionCode
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/institutionCode-2026-05-26
Štítek Kód instituce
Definice A name (or acronym) in use by an institution having custody of a resource.
Poznámky The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
Příklady
  • MVZ
  • FMNH
  • CLO
  • UCMP
  • National Museum of Kenya
  • Kew Gardens
ABCD ekvivalence DataSets/DataSet/Units/Unit/SourceInstitutionID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:institutionID
Termín IRI http://rs.tdwg.org/dwc/terms/institutionID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/institutionID-2026-05-26
Štítek ID Instituce
Definice An identifier for an organization.
Poznámky For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/SourceInstitutionID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:isAcceptedIdentification
Termín IRI http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/isAcceptedIdentification-2026-05-26
Štítek Is Accepted Identification
Definice An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
Poznámky Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Příklady
  • true
  • false
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:island
Termín IRI http://rs.tdwg.org/dwc/terms/island
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/island-2023-06-28
Štítek Ostrov
Definice Název ostrova, na kterém nebo v jehož blízkosti se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například Getty Thesaurus of Geographic Names.
Příklady
  • Nosy Be
  • Bikini Atoll
  • Vancouver
  • Viti Levu
  • Zanzibar
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:islandGroup
Termín IRI http://rs.tdwg.org/dwc/terms/islandGroup
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/islandGroup-2023-06-28
Štítek Skupina ostrovů
Definice Název skupiny ostrovů, ve které se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například Getty Thesaurus of Geographic Names.
Příklady
  • Alexander Archipelago
  • Archipiélago Diego Ramírez
  • Seychelles
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island group
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:kingdom
Termín IRI http://rs.tdwg.org/dwc/terms/kingdom
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/kingdom-2023-06-28
Štítek Říše
Definice Úplný vědecký název říše, do které je dwc:Taxon zařazen.
Příklady
  • Animalia
  • Archaea
  • Bacteria
  • Chromista
  • Fungi
  • Plantae
  • Protozoa
  • Viruses
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = regnum
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dcterms:language
Termín IRI http://purl.org/dc/terms/language
Změněno 2008-01-14
Verze termínu IRI http://dublincore.org/usage/terms/history/#languageT-001
Štítek Jazyk
Definice Jazyk zdroje.
Poznámky Doporučeným osvědčeným postupem je použití IRI ze schématu ISO 639-2 Kongresové knihovny http://id.loc.gov/vocabulary/iso639-2
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Název termínu dc:language
Termín IRI http://purl.org/dc/elements/1.1/language
Změněno 2023-06-28
Verze termínu IRI http://dublincore.org/usage/terms/history/#language-007
Štítek Jazyk
Definice Jazyk zdroje.
Poznámky Doporučeným osvědčeným postupem je použití řízeného slovníku, například RFC 5646. Tento termín má ekvivalent ve jmenném prostoru dcterms:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • en (pro angličtinu)
  • es (pro španělštinu)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Název termínu dwc:latestAgeOrHighestStage
Termín IRI http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/latestAgeOrHighestStage-2023-09-13
Štítek Poslední věk nebo nejvyšší stadium
Definice Úplný název nejpozdějšího možného geochronologického stáří nebo nejvyššího chronostratigrafického stupně, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity odebrán.
Příklady
  • Atlantic
  • Boreal
  • Skullrockian
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:LatestDateCollected
Termín IRI http://rs.tdwg.org/dwc/terms/LatestDateCollected
Změněno 2009-04-24
Štítek Latest Date Collected
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventDate
Definice The latest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Poznámky Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Typ Vlastnost
Název termínu dwc:latestEonOrHighestEonothem
Termín IRI http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/latestEonOrHighestEonothem-2026-05-26
Štítek Nejnovější Eon nebo nejvyšší Eonothem
Definice The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Příklady
  • Phanerozoic
  • Proterozoic
  • Precambrian
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:latestEpochOrHighestSeries
Termín IRI http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/latestEpochOrHighestSeries-2023-09-13
Štítek Nejnovější epocha nebo nejvyšší série
Definice Úplný název nejnovější možné geochronologické epochy nebo nejvyšší chronostratigrafické řady, kterou lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Holocene
  • Pleistocene
  • Ibexian Series
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:latestEraOrHighestErathem
Termín IRI http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/latestEraOrHighestErathem-2023-09-13
Štítek Nejnovější éra nebo nejvyšší Erathem
Definice Úplný název nejpozdější možné geochronologické éry nebo nejvyššího chronostratigrafického eratému, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Cenozoic
  • Mesozoic
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:latestGeochronologicalEra
Termín IRI http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/latestGeochronologicalEra-2023-09-13
Štítek Latest Geochronological Era
Definice Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
Poznámky Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:latestPeriodOrHighestSystem
Termín IRI http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/latestPeriodOrHighestSystem-2023-09-13
Štítek Poslední období nebo nejvyšší systém
Definice Úplný název posledního možného geochronologického období nebo nejvyššího chronostratigrafického systému, který lze přiřadit stratigrafickému horizontu, z něhož byl dwc:MaterialEntity odebrán.
Příklady
  • Neogene
  • Tertiary
  • Quaternary
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dcterms:license
Termín IRI http://purl.org/dc/terms/license
Změněno 2023-06-28
Verze termínu IRI http://dublincore.org/usage/terms/history/#license-002
Štítek Licence
Definice Právní dokument, který dává úřední povolení k určité činnosti se zdrojem.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-11-06_17
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:lifeStage
Termín IRI http://rs.tdwg.org/dwc/terms/lifeStage
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/lifeStage-2026-05-26
Štítek Životní fáze
Definice An age class or life stage of a dwc:Organism.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • zygote
  • larva
  • juvenile
  • adult
  • seedling
  • flowering
  • fruiting
ABCD ekvivalence DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalSexualStage or DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalLiveStages/MycologicalLiveStage or DataSets/DataSet/Units/Unit/ZoologicalUnit/PhasesOrStages/PhaseOrStage
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:lifeStage
Termín IRI http://rs.tdwg.org/dwc/iri/lifeStage
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/lifeStage-2026-05-26
Štítek Life Stage (IRI)
Definice An age class or life stage of a dwc:Organism.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:lithostratigraphicTerms
Termín IRI http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/lithostratigraphicTerms-2025-06-12
Štítek Litostratigrafické termíny
Definice Kombinace všech litostratigrafických názvů pro horninu, ze které byla dwc:MaterialEntity získána.
Příklady Pleistocene-Weichselien
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Stratigraphy/LithostratigraphicTerms
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:LivingSpecimen
Termín IRI http://rs.tdwg.org/dwc/terms/LivingSpecimen
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/LivingSpecimen-2023-09-18
Štítek Živý exemplář
Definice Exemplář, který je naživu.
Příklady
  • a living plant in a botanical garden
  • a living animal in a zoo
ABCD ekvivalence RecordBasisEnum/LivingSpecimen
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwc:locality
Termín IRI http://rs.tdwg.org/dwc/terms/locality
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/locality-2023-06-28
Štítek Lokalita
Definice Konkrétní popis místa.
Poznámky Méně specifické geografické informace lze poskytnout v jiných geografických termínech (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). Tento termín může obsahovat informace upravené oproti originálu za účelem opravy zjištěných chyb nebo standardizace popisu.
Příklady
  • Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)
  • Queets Rainforest, Olympic National Park
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dcterms:Location
Termín IRI http://purl.org/dc/terms/Location
Změněno 2023-09-18
Verze termínu IRI http://dublincore.org/usage/terms/history/#Location-001
Štítek Lokalita
Definice Prostorová oblast nebo místo s názvem.
Příklady
  • the municipality of San Carlos de Bariloche, Río Negro, Argentina
  • the place defined by a georeference
ABCD ekvivalence not in ABCD
Typ Třída
Název termínu dwciri:locationAccordingTo
Termín IRI http://rs.tdwg.org/dwc/iri/locationAccordingTo
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/locationAccordingTo-2025-07-10
Štítek Location According To (IRI)
Definice Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:locationAccordingTo
Termín IRI http://rs.tdwg.org/dwc/terms/locationAccordingTo
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/locationAccordingTo-2023-06-28
Štítek Poloha podle
Definice Informace o zdroji této infomace dcterms:Lokalita. Může se jednat o publikaci (vydavatelem), instituci nebo týmem osob.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • Getty Thesaurus of Geographic Names
  • GADM
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:locationAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/locationAttributes
Změněno 2014-10-23
Štítek Location Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the location.
Poznámky Example: "aspectheading=277; slopeindegrees=6"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:locationID
Termín IRI http://rs.tdwg.org/dwc/terms/locationID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/locationID-2026-05-26
Štítek ID lokality
Definice An identifier for a dcterms:Location.
Poznámky Recommended best practice is to use a globally unique identifier.
Příklady https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:locationRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/locationRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/locationRemarks-2023-06-28
Štítek Poznámky k poloze
Definice Komentáře nebo poznámky k dcterms:Lokalita.
Příklady under water since 2005
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Typ Vlastnost
Název termínu dwc:lowestBiostratigraphicZone
Termín IRI http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/lowestBiostratigraphicZone-2023-09-13
Štítek Nejnižší biostratigrafická zóna
Definice Úplný název nejnižší možné geologické biostratigrafické zóny stratigrafického horizontu, ze kterého byl dwc:MaterialEntity odebrán.
Příklady Maastrichtian
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:MachineObservation
Termín IRI http://rs.tdwg.org/dwc/terms/MachineObservation
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MachineObservation-2023-09-18
Štítek Strojové pozorování
Definice Výstup procesu strojového pozorování.
Příklady
  • a photograph
  • a video
  • an audio recording
  • a remote sensing image
  • a dwc:Occurrence record based on telemetry
ABCD ekvivalence RecordBasisEnum/MachineObservation
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwc:MaterialCitation
Termín IRI http://rs.tdwg.org/dwc/terms/MaterialCitation
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MaterialCitation-2023-09-18
Štítek Citace materiálu
Definice Odkaz na jeden exemplář, jeho část nebo více exemplářů ve vědeckých publikacích nebo jejich citace.
Poznámky Tato třída představuje novou hodnotu pro řízený slovník v doporučeních pro basisOfRecord. Při importu datových sad založených na literatuře z Darwin Core Archives do GBIF by se měl basisOfRecord změnit z "Occurrence", "PreservedSpecimen" nebo "Literature" na "MaterialCitation".
Příklady
  • a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication
  • a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Název termínu dwc:MaterialEntity
Termín IRI http://rs.tdwg.org/dwc/terms/MaterialEntity
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MaterialEntity-2026-05-26
Štítek Materiální entita
Definice Entita, kterou lze identifikovat, existuje po určitou dobu a skládá se zcela nebo zčásti z fyzické hmoty, dokud existuje.
Poznámky The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Příklady
  • the entire contents of a trawl
  • a subset of the contents of a trawl
  • the body of a fish
  • the stomach contents of a fish
  • a rock containing fossils
  • a fossil within a rock
  • an herbarium sheet with its attached plant specimen
  • a flower on a plant specimen
  • a pollen grain
  • a specific water sample
  • an isolated molecule of DNA
ABCD ekvivalence not in ABCD (Specimen Unit, when used to denote a class of things, appears to be a broadly construed subclass.)
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:materialEntityCategory
Termín IRI http://rs.tdwg.org/dwc/iri/materialEntityCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/materialEntityCategory-2026-05-26
Štítek Material Entity Category (IRI)
Definice A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Poznámky Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:materialEntityCategory
Termín IRI http://rs.tdwg.org/dwc/terms/materialEntityCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/materialEntityCategory-2026-05-26
Štítek Material Entity Category
Definice A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Poznámky Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady liveOrganism, deadOrganism, partOfOrganism, nonMolecularBiologicalExtract, molecularBiologicalExtract, mineral, rock, fossil, chemical, humanArtifactWithBiologicalConstituent, humanArtifactWithoutBiologicalConstituent, and mixed
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:materialEntityID
Termín IRI http://rs.tdwg.org/dwc/terms/materialEntityID
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/materialEntityID-2023-09-13
Štítek ID materiální entity
Definice Identifikátor konkrétní instance dwc:MaterialEntity.
Poznámky Hodnoty dwc:materialEntityID jsou určeny k jednoznačné a trvalé identifikaci konkrétní dwc:MaterialEntity v rámci určitého kontextu. Příklady kontextu zahrnují konkrétní sbírku vzorků, organizaci nebo celosvětové měřítko. Doporučeným osvědčeným postupem je používat trvalý, celosvětově jedinečný identifikátor. Identifikátor je vázán na fyzický objekt (dwc:MaterialEntity) na rozdíl od konkrétního digitálního záznamu (reprezentace) tohoto fyzického objektu.
Příklady 06809dc5-f143-459a-be1a-6f03e63fc083
ABCD ekvivalence Unit/UnitGUID or Unit/UnitID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:materialEntityRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/materialEntityRemarks-2026-05-26
Štítek Poznámky k materiálním entitám
Definice Comments or notes about a dwc:MaterialEntity.
Příklady
  • found in association with charred remains
  • some original fragments missing
ABCD ekvivalence DataSets/DataSet/Units/Unit/Notes
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:materialEntityType
Termín IRI http://rs.tdwg.org/dwc/iri/materialEntityType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/materialEntityType-2026-05-26
Štítek Material Entity Type (IRI)
Definice A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Poznámky A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:materialEntityType
Termín IRI http://rs.tdwg.org/dwc/terms/materialEntityType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/materialEntityType-2026-05-26
Štítek Typ entity subjektu
Definice A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Poznámky Obecnější klasifikace dwc:MaterialEntity než dwc:preparations. Doporučeným osvědčeným postupem je použití řízeného slovníku. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakýkoli textový řetězec.
ABCD ekvivalence skos:closeMatch to /DataSets/DataSet/Units/Unit/KindOfUnit. ABCD structural considerations prevent an exactMatch.
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:MaterialSample
Termín IRI http://rs.tdwg.org/dwc/terms/MaterialSample
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MaterialSample-2023-09-13
Štítek Vzorek materiálu
Definice Významný subjekt, který představuje zájmový subjekt jako celek nebo jeho část.
Příklady
  • a whole organism preserved in a collection
  • a part of an organism isolated for some purpose
  • a soil sample
  • a marine microbial sample
ABCD ekvivalence DataSets/DataSet/Units/Unit
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2013-10-09_11
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:materialSampleID
Termín IRI http://rs.tdwg.org/dwc/terms/materialSampleID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/materialSampleID-2023-06-28
Štítek ID vzorku materiálu
Definice Identifikátor dwc:MaterialSample (na rozdíl od konkrétního digitálního záznamu dwc:MaterialSample). Pokud neexistuje trvalý globální jedinečný identifikátor, vytvořte jej z kombinace identifikátorů v záznamu, která bude co nejpřesněji zajišťovat globální jedinečnost dwc:materialSampleID.
Poznámky Doporučeným osvědčeným postupem je použití trvalého, globálně jedinečného identifikátoru.
Příklady 06809dc5-f143-459a-be1a-6f03e63fc083
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2013-10-09_13
Název termínu dwc:maximumDepthInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/maximumDepthInMeters-2026-05-26
Štítek Maximální hloubka v metrech
Definice The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Poznámky See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Příklady
  • 0
  • 200
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:maximumDistanceAboveSurfaceInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/maximumDistanceAboveSurfaceInMeters-2023-06-28
Štítek Maximální vzdálenost nad povrchem v metrech
Definice Větší vzdálenost v rozsahu vzdálenosti od referenční plochy ve svislém směru v metrech. Kladné hodnoty použijte pro místa nad povrchem, záporné hodnoty pro místa pod povrchem. Pokud jsou uvedeny míry hloubky, je referenčním povrchem místo dané hloubkou, jinak je referenčním povrchem místo dané nadmořskou výškou.
Příklady
  • -1.5 (pod hladinou)
  • 4.2 (nad hladinou)
  • Pro 1,5metrové jádro sedimentu ze dna jezera (v hloubce 20m) v nadmořské výšce 300m: verbatimElevation: 300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: MinimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Název termínu dwc:maximumElevationInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/maximumElevationInMeters-2026-05-26
Štítek Maximální nadmořská výška v metrech
Definice The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Poznámky See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Příklady
  • -205
  • 1236
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:measurementAccuracy
Termín IRI http://rs.tdwg.org/dwc/terms/measurementAccuracy
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementAccuracy-2023-06-28
Štítek Přesnost měření
Definice Popis potenciální chyby spojené s dwc:measurementValue.
Příklady
  • 0.01
  • normal distribution with variation of 2 m
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:measurementDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementDeterminedBy-2023-06-28
Štítek Měření Určeno podle
Definice Seznam (spojený a oddělený) jmen osob, skupin nebo organizací, které určily hodnotu dwc:MeasurementOrFact.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • Rob Guralnick
  • Peter Desmet | Stijn Van Hoey
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwciri:measurementDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/measurementDeterminedBy-2025-07-10
Štítek Measurement Determined By (IRI)
Definice A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:measurementDeterminedDate
Termín IRI http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementDeterminedDate-2025-06-12
Štítek Stanovené datum měření
Definice Datum, kdy bylo dwc:MeasurementOrFact provedeno.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:measurementID
Termín IRI http://rs.tdwg.org/dwc/terms/measurementID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementID-2023-06-28
Štítek ID měření
Definice Identifikátor dwc:MeasurementOrFact (informace týkající se měření, faktů, charakteristik nebo tvrzení). Může to být globální jedinečný identifikátor nebo identifikátor specifický pro datovou sadu.
Příklady 9c752d22-b09a-11e8-96f8-529269fb1459
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:measurementMethod
Termín IRI http://rs.tdwg.org/dwc/terms/measurementMethod
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementMethod-2023-06-28
Štítek Metoda měření
Definice Popis nebo odkaz na (publikaci, URI) metodu nebo protokol použitý k určení měření, skutečnosti, vlastnosti nebo tvrzení.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • minimální konvexní polygon kolem vchodů do nory (pro oblast domovského okrsku)
  • barometrický výškoměr (pro nadmořskou výšku)
ABCD ekvivalence /DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:measurementMethod
Termín IRI http://rs.tdwg.org/dwc/iri/measurementMethod
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/measurementMethod-2025-07-10
Štítek Measurement Method (IRI)
Definice The method or protocol used to determine the measurement, fact, characteristic, or assertion.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:MeasurementOrFact
Termín IRI http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MeasurementOrFact-2023-09-13
Štítek Měření nebo fakt
Definice Měření nebo skutečnost o rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Poznámky Zdroje lze považovat za identifikovatelné záznamy nebo instance tříd a mohou zahrnovat instance dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification nebo dwc:Taxon, ale nemusí se na ně omezovat.
Příklady
  • the weight of a dwc:Organism in grams
  • the number of placental scars
  • surface water temperature in Celsius
ABCD ekvivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:measurementRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/measurementRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementRemarks-2023-06-28
Štítek Poznámky k měření
Definice Komentáře nebo poznámky k dwc:MeasurementOrFact.
Příklady tip of tail missing
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:measurementType
Termín IRI http://rs.tdwg.org/dwc/iri/measurementType
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/measurementType-2025-07-10
Štítek Measurement Type (IRI)
Definice The nature of the measurement, fact, characteristic, or assertion.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:measurementType
Termín IRI http://rs.tdwg.org/dwc/terms/measurementType
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementType-2023-06-28
Štítek Typ měření
Definice Povaha měření, skutečnosti, vlastnosti nebo tvrzení.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • tail length
  • temperature
  • trap line length
  • survey area
  • trap type
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:measurementUnit
Termín IRI http://rs.tdwg.org/dwc/terms/measurementUnit
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementUnit-2023-06-28
Štítek Jednotka měření
Definice Jednotky spojené s dwc:measurementValue.
Poznámky Doporučeným postupem je používat Mezinárodní soustavu jednotek (SI). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • m
  • g
  • l
  • °C
  • mm
  • km²
  • %
  • hh:mm:ss
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:measurementUnit
Termín IRI http://rs.tdwg.org/dwc/iri/measurementUnit
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/measurementUnit-2023-06-28
Štítek Measurement Unit (IRI)
Definice The units associated with the dwc:measurementValue.
Poznámky Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:measurementValue
Termín IRI http://rs.tdwg.org/dwc/terms/measurementValue
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/measurementValue-2023-06-28
Štítek Hodnota měření
Definice Hodnota měření, skutečnosti, vlastnosti nebo tvrzení.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady
  • 45
  • 20
  • 1
  • 14.5
  • UV-light
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:measurementValue
Termín IRI http://rs.tdwg.org/dwc/iri/measurementValue
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/measurementValue-2025-07-10
Štítek Measurement Value (IRI)
Definice The value of the measurement, fact, characteristic, or assertion.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu ac:Media
Termín IRI http://rs.tdwg.org/ac/terms/Media
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/ac/terms/version/Media-2026-02-24
Štítek Media Entity
Definice A digital or physical media resource.
Poznámky An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
Příklady
  • dcmi:Sound
  • dcmi:StillImage
  • dcmi:MovingImage
  • dcmi:InteractiveResource
  • ac:Digital3DResource
ABCD ekvivalence This term is equivalent to the ABCD term http://rs.tdwg.org/abcd/terms/MultimediaObject .
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:member
Termín IRI http://rs.tdwg.org/dwc/terms/member
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/member-2023-09-13
Štítek Člen
Definice Úplný název litostratigrafického členění, z něhož byl dwc:MaterialEntity získán.
Příklady
  • Lava Dam Member
  • Hellnmaria Member
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:minimumDepthInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/minimumDepthInMeters-2026-05-26
Štítek Minimální hloubka v metrech
Definice The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Poznámky See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Příklady
  • 0
  • 100
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:minimumDistanceAboveSurfaceInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/minimumDistanceAboveSurfaceInMeters-2023-06-28
Štítek Minimální vzdálenost nad povrchem v metrech
Definice Menší vzdálenost v rozsahu vzdálenosti od referenční plochy ve svislém směru v metrech. Kladné hodnoty použijte pro místa nad povrchem, záporné hodnoty pro místa pod povrchem. Pokud jsou uvedeny míry hloubky, je referenčním povrchem místo dané hloubkou, jinak je referenčním povrchem místo dané nadmořskou výškou.
Příklady
  • -1.5 (pod hladinou)
  • 4.2 (nad hladinou)
  • Pro 1,5metrové jádro sedimentu ze dna jezera (v hloubce 20m) v nadmořské výšce 300m: verbatimElevation: 300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: MinimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue
Typ Vlastnost
Název termínu dwc:minimumElevationInMeters
Termín IRI http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/minimumElevationInMeters-2026-05-26
Štítek Minimální nadmořská výška v metrech
Definice The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Poznámky See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Příklady
  • -100
  • 802
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dcterms:modified
Termín IRI http://purl.org/dc/terms/modified
Změněno 2025-06-12
Verze termínu IRI http://dublincore.org/usage/terms/history/#modified-003
Štítek Datum změny
Definice Datum, kdy byl zdroj změněn.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Název termínu dwc:MolecularProtocol
Termín IRI http://rs.tdwg.org/dwc/terms/MolecularProtocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/MolecularProtocol-2026-05-26
Štítek Molecular Protocol
Definice A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
Příklady
  • a standard DNA barcoding workflow using Sanger sequencing
  • a shotgun metagenomics pipeline for microbial community profiling
  • a high-throughput amplicon sequencing protocol targeting 16S rRNA
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:molecularProtocolID
Termín IRI http://rs.tdwg.org/dwc/terms/molecularProtocolID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/molecularProtocolID-2026-05-26
Štítek Molecular Protocol ID
Definice An identifier for a dwc:MolecularProtocol.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:month
Termín IRI http://rs.tdwg.org/dwc/terms/month
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/month-2023-06-28
Štítek měsíc
Definice Celé číslo měsíce, ve kterém dwc:Event nastala.
Příklady
  • 1 (leden)
  • 10 (říjen)
ABCD ekvivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Typ Vlastnost
Název termínu dwc:municipality
Termín IRI http://rs.tdwg.org/dwc/terms/municipality
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/municipality-2023-06-28
Štítek Členění třetího řádu
Definice Úplný nezkrácený název nejbližšího menšího správního obvodu než kraj (město, obec atd.), ve kterém se dcterms:Location vyskytuje. Nepoužívejte tento termín pro blízké pojmenované místo, které neobsahuje vlastní dcterms:Location.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například Getty Thesaurus of Geographic Names. Doporučeným osvědčeným postupem je ponechat toto pole prázdné, pokud dcterms:Location pokrývá více entit na této administrativní úrovni nebo pokud dcterms:Location může být v jedné nebo jiné z více možných entit na této úrovni. Násobnost a neurčitost geografické entity lze zachytit buď v termínu dwc:higherGeography, nebo v termínu dwc:locality, případně v obou.
Příklady
  • Holzminden
  • Araçatuba
  • Ga-Segonyana
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:nameAccordingTo
Termín IRI http://rs.tdwg.org/dwc/terms/nameAccordingTo
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/nameAccordingTo-2026-05-26
Štítek Název podle
Definice Odkaz na zdroj, v němž je definován nebo naznačen konkrétní pojem okruhu vymezení taxonu - tradičně označovaný latinským "sensu" nebo "sec". (od secundum, což znamená "podle"). U taxonů, které jsou výsledkem identifikace, by měl být uveden odkaz na klíče, monografie, odborníky a další zdroje.
Poznámky This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by sensu or sec., it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
Příklady Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O'Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209-236. (jako úplná citace Franz & Cardona-Duque (2013) v Perelleschus splendida sec. Franz & Cardona-Duque (2013))
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:nameAccordingToID
Termín IRI http://rs.tdwg.org/dwc/terms/nameAccordingToID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/nameAccordingToID-2023-06-28
Štítek Název podle ID
Definice Identifikátor zdroje, ve kterém je definován nebo naznačen specifický okruh pojmu taxonu. Viz dwc:nameAccordingTo.
Příklady https://doi.org/10.1016/S0269-915X(97)80026-2
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:namePublicationID
Termín IRI http://rs.tdwg.org/dwc/terms/namePublicationID
Změněno 2009-09-21
Štítek Name Publication ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/namePublishedInID
Definice A resolvable globally unique identifier for the original publication of the scientificName.
Poznámky Example: "http://hdl.handle.net/10199/7"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:namePublishedIn
Termín IRI http://rs.tdwg.org/dwc/terms/namePublishedIn
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/namePublishedIn-2023-06-28
Štítek Název publikován v
Definice Odkaz na publikaci, ve které byl dwc:scientificName původně vytvořen podle pravidel přiřazeného dwc:nomenclaturalCode.
Poznámky Citace prvního zveřejnění názvu v dané kombinaci, nikoliv basionym / původní název. Rekombinace často nejsou v zoologii publikovány, v takovém případě by dwc:namePublishedIn mělo být prázdné.
Příklady
  • Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388
  • Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:namePublishedInID
Termín IRI http://rs.tdwg.org/dwc/terms/namePublishedInID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/namePublishedInID-2023-06-28
Štítek Název publikován v ID
Definice Identifikátor publikace, ve které byl dwc:scientificName původně vytvořen podle pravidel přiřazeného dwc:nomenclaturalCode.
Poznámky Citace prvního zveřejnění názvu v dané kombinaci, nikoliv basionym / původní název. Rekombinace často nejsou v zoologii publikovány, v takovém případě by dwc:namePublishedInID mělo být prázdné.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dwc:namePublishedInYear
Termín IRI http://rs.tdwg.org/dwc/terms/namePublishedInYear
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/namePublishedInYear-2023-06-28
Štítek Název publikován v roce
Definice Čtyřmístný rok, ve kterém byl dwc:scientificName publikován.
Příklady
  • 1915
  • 2008
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2011-10-16_8
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:nomenclaturalCode
Termín IRI http://rs.tdwg.org/dwc/terms/nomenclaturalCode
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/nomenclaturalCode-2023-06-28
Štítek Kód názvosloví
Definice Kód názvosloví (nebo kódy v případě ambiregnálního názvu), podle kterého je dwc:scientificName vytvořen.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • ICN
  • ICZN
  • BC
  • ICNCP
  • BioCode
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/Code
Typ Vlastnost
Název termínu dwc:nomenclaturalStatus
Termín IRI http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/nomenclaturalStatus-2023-06-28
Štítek Stav názvosloví
Definice Stav související s původním zveřejněním názvu a jeho soulad s příslušnými pravidly názvosloví. Je založen v podstatě na algoritmu podle obchodních pravidel kódu. Nevyžaduje žádné taxonomické stanovisko.
Příklady
  • nom. ambig.
  • nom. illeg.
  • nom. subnud.
ABCD ekvivalence (DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation) pro parte
Typ Vlastnost
Název termínu dwc:NucleotideAnalysis
Termín IRI http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/NucleotideAnalysis-2026-05-26
Štítek Nucleotide Analysis
Definice A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:NucleotideSequence
Termín IRI http://rs.tdwg.org/dwc/terms/NucleotideSequence
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/NucleotideSequence-2026-05-26
Štítek Nucleotide Sequence
Definice A digital representation of a nucleotide sequence.
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:nucleotideSequenceRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/nucleotideSequenceRemarks-2026-05-26
Štítek Nucleotide Sequence Remarks
Definice Comments or notes about a dwc:NucleotideSequence.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:objectQuantity
Termín IRI http://rs.tdwg.org/dwc/terms/objectQuantity
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/objectQuantity-2026-05-26
Štítek Object Quantity
Definice A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Poznámky An dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
Příklady
  • 27 (objectQuantity) with individuals (objectQuantityType)
  • many (objectQuantity) with individuals (objectQuantityType)
  • 3 (objectQuantity) with legs (objectQuantityType)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:objectQuantityType
Termín IRI http://rs.tdwg.org/dwc/iri/objectQuantityType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/objectQuantityType-2026-05-26
Štítek Object Quantity Type (IRI)
Definice The type of quantification system used for the quantity of dwc:MaterialEntities.
Poznámky An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:objectQuantityType
Termín IRI http://rs.tdwg.org/dwc/terms/objectQuantityType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/objectQuantityType-2026-05-26
Štítek Object Quantity Type
Definice The type of quantification system used for the quantity of dwc:MaterialEntities.
Poznámky An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • 27 (objectQuantity) with individuals (objectQuantityType)
  • many (objectQuantity) with individuals (objectQuantityType)
  • 3 (objectQuantity) with legs (objectQuantityType)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Occurrence
Termín IRI http://rs.tdwg.org/dwc/terms/Occurrence
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Occurrence-2026-05-26
Štítek Výskyt
Definice A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
Poznámky In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Příklady
  • a wolf pack on the shore of Kluane Lake in 1988
  • a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23
  • a fungus in Central Park in the summer of 1929
  • a male lance-tailed manakin in a courtship display on Isla Boca Brava
ABCD ekvivalence DataSets/DataSet/Units/Unit
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:occurrenceAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceAttributes
Změněno 2009-10-09
Štítek Occurrence Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Occurrence.
Poznámky Examples: "Tragus length: 14mm; Weight: 120g", "Height: 1-1.5 meters tall; flowers yellow; uncommon".
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts
Typ Vlastnost
Název termínu dwc:occurrenceDetails
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceDetails
Změněno 2009-10-09
Štítek Occurrence Details
Tento termín je zastaralý a již by se neměl používat.
Definice A reference (publication, URI) to the most detailed information available about the Occurrence.
Poznámky Example: "http://mvzarctos.berkeley.edu/guid/MVZ:Mamm:165861"
ABCD ekvivalence DataSets/DataSet/Units/Unit/RecordURI
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2011-10-16_7
Název termínu dwc:occurrenceID
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/occurrenceID-2026-05-26
Štítek ID Výskytu
Definice An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
Poznámky In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/UnitGUID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:OccurrenceMeasurement
Termín IRI http://rs.tdwg.org/dwc/terms/OccurrenceMeasurement
Změněno 2009-10-09
Štítek Occurrence Measurement
Tento termín je zastaralý a již by se neměl používat.
Definice The category of information pertaining to measurements accociated with an occurrence.
ABCD ekvivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Typ Třída
Název termínu dwc:occurrenceMeasurementAccuracy
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Změněno 2009-10-09
Štítek Occurrence Measurement Accuracy
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definice The description of the error associated with the occurrenceAttributeValue.
Poznámky Example: "0.01", "normal distribution with variation of 2 m"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Změněno 2009-10-09
Štítek Occurrence Measurement Determined By
Tento termín je zastaralý a již by se neměl používat.
Definice The agent responsible for having determined the value of the measurement or characteristic of the occurrence.
Poznámky Example: "Javier de la Torre"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementDeterminedDate
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Změněno 2009-10-09
Štítek Occurrence Measurement Determined Date
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definice The date on which the the measurement or characteristic of the occurrence was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Poznámky Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementID
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementID
Změněno 2009-10-09
Štítek Occurrence Measurement ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementID
Definice An identifier for the occurrence attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementRemarks
Změněno 2009-10-09
Štítek Occurrence Measurement Remarks
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementRemarks
Definice Comments or notes accompanying the measurement or characteristic of the occurrence.
Poznámky Example: "tip of tail missing"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementType
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementType
Změněno 2009-10-09
Štítek Occurrence Measurement Type
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementType
Definice The nature of the measurement or characteristic of the occurrence. Recommended best practice is to use a controlled vocabulary.
Poznámky Example: "tail length"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementUnit
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Změněno 2009-10-09
Štítek Occurrence Measurement Unit
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementUnit
Definice The units for the value of the measurement or characteristic of the occurrence. Recommended best practice is to use International System of Units (SI) units.
Poznámky Example: "mm"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Název termínu dwc:occurrenceMeasurementValue
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Změněno 2009-10-09
Štítek Occurrence Measurement Value
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/measurementValue
Definice The value of the measurement or characteristic of the occurrence.
Poznámky Example: "45"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Název termínu dwc:occurrenceRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/occurrenceRemarks-2023-06-28
Štítek Záznamy o výskytu
Definice Komentáře nebo poznámky k dwc:Occurrence.
Příklady found dead on road
ABCD ekvivalence DataSets/DataSet/Units/Unit/Notes
Typ Vlastnost
Název termínu dwciri:occurrenceStatus
Termín IRI http://rs.tdwg.org/dwc/iri/occurrenceStatus
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/occurrenceStatus-2026-05-26
Štítek Occurrence Status (IRI)
Definice A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:occurrenceStatus
Termín IRI http://rs.tdwg.org/dwc/terms/occurrenceStatus
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/occurrenceStatus-2026-05-26
Štítek Status výskytu
Definice A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Poznámky For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • detected
  • notDetected
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:order
Termín IRI http://rs.tdwg.org/dwc/terms/order
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/order-2023-06-28
Štítek Řazení
Definice Úplný vědecký název řádu, do kterého je dwc:Taxon zařazen.
Příklady
  • Carnivora
  • Monocleales
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = ordo
Typ Vlastnost
Název termínu dwc:Organism
Termín IRI http://rs.tdwg.org/dwc/terms/Organism
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Organism-2026-05-26
Štítek Organismus
Definice Určitý organismus nebo definovaná skupina organismů považovaná za taxonomicky homogenní.
Poznámky Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Příklady
  • a specific bird
  • a specific wolf pack
  • a specific instance of a bacterial culture
  • a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismID
Termín IRI http://rs.tdwg.org/dwc/terms/organismID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismID-2023-06-28
Štítek ID organismu
Definice Identifikátor instance dwc:Organism (na rozdíl od konkrétního digitálního záznamu dwc:Organism). Může to být globálně jedinečný identifikátor nebo identifikátor specifický pro datovou sadu.
Příklady http://arctos.database.museum/guid/WNMU:Mamm:1249
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Název termínu dwc:OrganismInteraction
Termín IRI http://rs.tdwg.org/dwc/terms/OrganismInteraction
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/OrganismInteraction-2026-05-26
Štítek Organism Interaction
Definice An interaction between two dwc:Organisms during a dwc:Event.
Poznámky Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
Příklady
  • a bee visiting a flower
  • a Mallophora ruficauda hunting an Apis mellifera in flight
  • a viral infection in a plant
  • a female spider mating with a male spider
  • a lion cub nursing from its mother
  • a mosquito sucking blood from a chimpanzee's arm
  • a slug eating a fungus growing on decomposing stump (2 interactions)
ABCD ekvivalence /abcd:DataSets/abcd:DataSet/abcd:Units/abcd:Unit/abcd:Associations/abcd:UnitAssociation
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismInteractionDescription
Termín IRI http://rs.tdwg.org/dwc/terms/organismInteractionDescription
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionDescription-2026-05-26
Štítek Organism Interaction Description
Definice A verbatim description of a dwc:OrganismInteraction.
Příklady Mallophora ruficauda captured an Apis mellifera worker in flight.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismInteractionID
Termín IRI http://rs.tdwg.org/dwc/terms/organismInteractionID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionID-2026-05-26
Štítek Organism Interaction ID
Definice An identifier for a dwc:OrganismInteraction.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismInteractionType
Termín IRI http://rs.tdwg.org/dwc/terms/organismInteractionType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismInteractionType-2026-05-26
Štítek Organism Interaction Type
Definice A category that best matches the nature of a dwc:OrganismInteraction.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • visitedFlowerOf
  • parasitized
  • matedWith
  • wasAttachedTo
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:organismInteractionType
Termín IRI http://rs.tdwg.org/dwc/iri/organismInteractionType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/organismInteractionType-2026-05-26
Štítek Organism Interaction Type (IRI)
Definice A category that best matches the nature of a dwc:OrganismInteraction.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismName
Termín IRI http://rs.tdwg.org/dwc/terms/organismName
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismName-2023-06-28
Štítek Název organismu
Definice Textový název nebo označení přiřazené instanci dwc:Organism.
Příklady
  • Huberta
  • Boab Prison Tree
  • J pod
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Název termínu dwc:organismQuantity
Termín IRI http://rs.tdwg.org/dwc/terms/organismQuantity
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismQuantity-2023-06-28
Štítek Množství organismů
Definice Číslo nebo výčtová hodnota pro množství dwc:Organisms.
Poznámky K dwc:organismQuantity musí být přiřazen odpovídající dwc:organismQuantityType.
Příklady
  • 27 (organismQuantity) with individuals (organismQuantityType)
  • 12.5 (organismQuantity) with % biomass (organismQuantityType)
  • r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)
  • many (organismQuantity) with individuals (organismQuantityType)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2015-03-19_18
Název termínu dwciri:organismQuantityType
Termín IRI http://rs.tdwg.org/dwc/iri/organismQuantityType
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/organismQuantityType-2015-03-27
Štítek Organism Quantity Type (IRI)
Definice The type of quantification system used for the quantity of organisms.
Poznámky A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:organismQuantityType
Termín IRI http://rs.tdwg.org/dwc/terms/organismQuantityType
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismQuantityType-2023-06-28
Štítek Typ množství organismu
Definice Typ kvantifikačního systému používaného pro množství dwc:Organisms.
Poznámky Typ dwc:organismQuantityType musí mít odpovídající dwc:organismQuantity. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • 27 (organismQuantity) with individuals (organismQuantityType)
  • 12.5 (organismQuantity) with % biomass (organismQuantityType)
  • r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)
  • many (organismQuantity) with individuals (organismQuantityType)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2015-03-19_18
Název termínu dwc:organismRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/organismRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismRemarks-2023-06-28
Štítek Poznámky k organismu
Definice Komentáře nebo poznámky k instanci dwc:Organism.
Příklady One of a litter of six
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Název termínu dwciri:organismScope
Termín IRI http://rs.tdwg.org/dwc/iri/organismScope
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/organismScope-2026-05-26
Štítek Organism Scope (IRI)
Definice A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Poznámky Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:organismScope
Termín IRI http://rs.tdwg.org/dwc/terms/organismScope
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/organismScope-2023-06-28
Štítek Rozsah organismu
Definice Popis druhu instance dwc:Organism. Může být použit k určení, zda instance dwc:Organism představuje diskrétní organismus nebo zda představuje určitý typ agregace.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín není určen k určení typu dwc:Taxon. Chcete-li popsat druh dwc:Organism pomocí objektu URI v RDF, použijte místo toho rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type).
Příklady
  • multicellular organism
  • virus
  • clone
  • pack
  • colony
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Název termínu dwc:originalNameUsage
Termín IRI http://rs.tdwg.org/dwc/terms/originalNameUsage
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/originalNameUsage-2023-06-28
Štítek Užití původního názvu
Definice Název taxonu s údaji o autorství a datu, pokud jsou známy, tak, jak se původně objevil při prvním stanovení podle pravidel přiřazeného dwc:nomenclaturalCode. Basionym (botanika) nebo basonymum (bakteriologie) dwc:scientificName nebo starší/starší homonymum u nahrazených názvů.
Poznámky Úplný vědecký název s údaji o autorství a datu, pokud jsou známy, použití názvu, ve kterém byl terminální prvek dwc:scientificName původně vytvořen podle pravidel přidruženého dwc:nomenclaturalCode. Například pro názvy, které se řídí ICNafp, by tento termín označoval basionym záznamu představujícího následnou kombinaci. Na rozdíl od basionymů se však tento termín může vztahovat na vědecké názvy všech stupňů.
Příklady
  • Pinus abies
  • Gasterosteus saltatrix Linnaeus 1768
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:originalNameUsageID
Termín IRI http://rs.tdwg.org/dwc/terms/originalNameUsageID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/originalNameUsageID-2023-06-28
Štítek ID Užití původního názvu
Definice Identifikátor použití názvu (dokumentovaný význam názvu podle zdroje), ve kterém byl terminální prvek dwc:scientificName původně vytvořen podle pravidel přiřazeného dwc:nomenclaturalCode.
Poznámky Tento termín by se měl používat pro označení dwc:taxonID záznamu dwc:Taxon, který představuje použití koncového prvku dwc:scientificName, jak bylo původně stanoveno podle pravidel souvisejícího dwc:nomenclaturalCode. Například pro názvy, které se řídí ICNafp, by tento termín stanovil vztah mezi záznamem představujícím následnou kombinaci a záznamem pro odpovídající basionym. Na rozdíl od basionymů se však tento termín může vztahovat na vědecké názvy všech stupňů. V případě Darwin Core Archives by měl být související záznam přítomen lokálně ve stejném archivu.
Příklady
  • tsn:41107 (ITIS)
  • urn:lsid:ipni.org:names:320035-2 (IPNI)
  • 2704179 (GBIF)
  • 6W3C4 (COL)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:otherCatalogNumbers
Termín IRI http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/otherCatalogNumbers-2026-05-26
Štítek Další katalogová čísla
Definice A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
  • FMNH:Mammal:1234
  • NPS YELLO6778 | MBG 33424
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/History/PreviousUnitsText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:ownerInstitutionCode
Termín IRI http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/ownerInstitutionCode-2026-05-26
Štítek Kód instituce vlastníka
Definice A name (or acronym) in use by an institution having ownership of a resource.
Příklady
  • NPS
  • APN
  • InBio
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:parentEventID
Termín IRI http://rs.tdwg.org/dwc/terms/parentEventID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/parentEventID-2026-05-26
Štítek ID nadřazené události
Definice An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
Poznámky Recommended best practice is to use a globally unique identifier.
Příklady A1 (parentEventID pro identifikaci hlavní Whittakerovy plochy ve vnořených vzorcích, z nichž každý má své vlastní eventID - A1:1, A1:2).
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2015-03-19_18
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:parentMeasurementID
Termín IRI http://rs.tdwg.org/dwc/terms/parentMeasurementID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/parentMeasurementID-2023-06-28
Štítek ID nadřazeného měření
Definice Identifikátor širšího dwc:MeasurementOrFact, který sdružuje tento a případně další dwc:MeasurementOrFacts.
Poznámky Může to být globálně jedinečný identifikátor nebo identifikátor specifický pro datovou sadu.
Příklady
  • 9c752d22-b09a-11e8-96f8-529269fb1459
  • E1_E1_O1_M1
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dwc:parentNameUsage
Termín IRI http://rs.tdwg.org/dwc/terms/parentNameUsage
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/parentNameUsage-2023-06-28
Štítek Užití nadřazeného názvu
Definice Úplný název, s údaji o autorství a datu, pokud jsou známy, přímého, nejbližšího nadřazeného dwc:Taxon (v klasifikaci) nejkonkrétnějšího prvku dwc:scientificName.
Příklady
  • Rubiaceae
  • Gruiformes
  • Testudinae
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Typ Vlastnost
Název termínu dwc:parentNameUsageID
Termín IRI http://rs.tdwg.org/dwc/terms/parentNameUsageID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/parentNameUsageID-2023-06-28
Štítek ID Užití nadřazeného názvu
Definice Identifikátor pro použití názvu (dokumentovaný význam názvu podle zdroje) přímého, nejbližšího nadřazeného taxonu vyššího řádu (v klasifikaci) nejkonkrétnějšího prvku dwc:scientificName.
Poznámky Tento termín by měl být používán pro přijaté názvy, aby odkazoval na dwc:taxonID záznamu dwc:Taxon, který představuje další vyšší taxon ve stejné taxonomické klasifikaci. V případě Darwin Core Archives by se měl související záznam vyskytovat lokálně ve stejném archivu.
Příklady
  • tsn:41074 (ITIS)
  • urn:lsid:ipni.org:names:30001404-2 (IPNI)
  • 2704173 (GBIF)
  • 6T8N (COL)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:pathway
Termín IRI http://rs.tdwg.org/dwc/iri/pathway
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/pathway-2025-07-10
Štítek Pathway (IRI)
Definice The process by which a dwc:Organism came to be in a given place at a given time.
Poznámky Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_23
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:pathway
Termín IRI http://rs.tdwg.org/dwc/terms/pathway
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/pathway-2023-06-28
Štítek Cesta
Definice Proces, kterým se dwc:Organism dostal na dané místo v daném čase.
Poznámky Doporučeným osvědčeným postupem je používat řetězce řízených hodnot z řízeného slovníku určeného pro použití s tímto termínem, který je uveden na adrese http://rs.tdwg.org/dwc/doc/pw/. Podrobnosti naleznete na adrese https://doi.org/10.3897/biss.3.38084. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • releasedForUse
  • otherEscape
  • transportContaminant
  • transportStowaway
  • corridor
  • unaided
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2020-10-13_23
Název termínu dwc:phylum
Termín IRI http://rs.tdwg.org/dwc/terms/phylum
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/phylum-2023-06-28
Štítek Kmen
Definice Úplný vědecký název kmene nebo oddělení, do kterého je dwc:Taxon zařazen.
Příklady
  • Chordata (kmen)
  • Bryophyta (oddělení)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = phylum
Typ Vlastnost
Název termínu dwc:pointRadiusSpatialFit
Termín IRI http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/pointRadiusSpatialFit-2026-05-26
Štítek Prostorové přizpůsobení bodu poloměru
Definice A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Poznámky Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Příklady
  • 0
  • 1
  • 1.5708
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/PointRadiusSpatialFit
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:preferredSpatialRepresentation
Termín IRI http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/preferredSpatialRepresentation-2026-05-26
Štítek Preferred Spatial Representation
Definice An indication of which spatial representation best represents the dcterms:Location.
Příklady
  • point-radius
  • footprint
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:preferredSpatialRepresentation
Termín IRI http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/preferredSpatialRepresentation-2026-05-26
Štítek Preferred Spatial Representation (IRI)
Definice An indication of which spatial representation best represents the dcterms:Location.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:preparations
Termín IRI http://rs.tdwg.org/dwc/terms/preparations
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/preparations-2026-05-26
Štítek Uchovávání
Definice Seznam (spojený a oddělený) přípravků a metod uchovávání pro dwc:MaterialEntity.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • fossil
  • cast
  • photograph
  • DNA extract
  • skin | skull | skeleton
  • whole animal (EtOH) | tissue (EDTA)
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/Preparations/PreparationsText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:preparations
Termín IRI http://rs.tdwg.org/dwc/iri/preparations
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/preparations-2025-07-10
Štítek Preparations (IRI)
Definice A preparation or preservation method for a specimen.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:PreservedSpecimen
Termín IRI http://rs.tdwg.org/dwc/terms/PreservedSpecimen
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/PreservedSpecimen-2023-09-18
Štítek Uchovaný exemplář
Definice Zakonzervovaný exemplář.
Příklady
  • a plant on an herbarium sheet
  • a cataloged lot of fish in a jar
ABCD ekvivalence RecordBasisEnum/PreservedSpecimen
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwc:PreviousIdentifications
Termín IRI http://rs.tdwg.org/dwc/terms/PreviousIdentifications
Změněno 2009-04-24
Štítek Previous Identifications
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/previousIdentifications
Definice A list (concatenated and separated) of previous ScientificNames to which the sample was identified.
Poznámky Example: "Anthus correndera".
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Typ Vlastnost
Název termínu dwc:previousIdentifications
Termín IRI http://rs.tdwg.org/dwc/terms/previousIdentifications
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/previousIdentifications-2023-06-28
Štítek Předchozí identifikace
Definice Seznam (spojený a oddělený) předchozích přiřazení názvů k dwc:Organism.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
  • Chalepidae
  • Pinus abies
  • Anthus sp., field ID by G. Iglesias | Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_14
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwc:processedTotalReadCount
Termín IRI http://rs.tdwg.org/dwc/terms/processedTotalReadCount
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/processedTotalReadCount-2026-05-26
Štítek Processed Total Read Count
Definice The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Příklady 50638, 345987, 764032
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:projectID
Termín IRI http://rs.tdwg.org/dwc/terms/projectID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/projectID-2026-05-26
Štítek ID Projektu
Definice Seznam (spojený a oddělený) identifikátorů projektů, které přispěly k dwc:Event.
Poznámky A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:projectTitle
Termín IRI http://rs.tdwg.org/dwc/terms/projectTitle
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/projectTitle-2026-05-26
Štítek Název projektu
Definice Seznam (spojený a oddělený) názvů nebo jmen projektů, které přispěly k dwc:Event.
Poznámky Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( | ).
Příklady
  • Arctic Deep
  • Scalidophora i Noreg
  • The Nansen Legacy
  • Underwater Oases of the Mar del Plata Canyon: Talud Continental IV
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Project/ProjectTitle
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Protocol
Termín IRI http://rs.tdwg.org/dwc/terms/Protocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Protocol-2026-05-26
Štítek Protocol
Definice A method used during an action.
Příklady
  • a pitfall trap method for sampling ground-dwelling arthropods
  • a point-radius georeferencing method
  • a linear regression model to estimate body mass from skeletal measurements
  • a Bayesian phylogenetic inference method
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:protocolDescription
Termín IRI http://rs.tdwg.org/dwc/terms/protocolDescription
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/protocolDescription-2026-05-26
Štítek Protocol Description
Definice A detailed description of a dwc:Protocol.
Příklady Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:protocolID
Termín IRI http://rs.tdwg.org/dwc/terms/protocolID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/protocolID-2026-05-26
Štítek Protocol ID
Definice An identifier for a dwc:Protocol.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:protocolReferences
Termín IRI http://rs.tdwg.org/dwc/terms/protocolReferences
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/protocolReferences-2026-05-26
Štítek Odkazy protokolu
Definice A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Poznámky Recommended best practice is to separate multiple values in a list with space vertical bar space ( | ).
Příklady Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:protocolRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/protocolRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/protocolRemarks-2026-05-26
Štítek Protocol Remarks
Definice Comments or notes about a dwc:Protocol.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:protocolType
Termín IRI http://rs.tdwg.org/dwc/terms/protocolType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/protocolType-2026-05-26
Štítek Protocol Type
Definice A category that best matches the nature of a dwc:Protocol.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • measurement
  • georeference
  • chronometricAge
  • chronometricAgeConversion
  • samplingEffort
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:protocolType
Termín IRI http://rs.tdwg.org/dwc/iri/protocolType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/protocolType-2026-05-26
Štítek Protocol Type (IRI)
Definice A category that best matches the nature of a dwc:Protocol.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:Provenance
Termín IRI http://rs.tdwg.org/dwc/terms/Provenance
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Provenance-2026-05-26
Štítek Provenance
Definice Information about an entity’s origins.
Poznámky This is a convenience class to group related properties.
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:readCount
Termín IRI http://rs.tdwg.org/dwc/terms/readCount
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/readCount-2026-05-26
Štítek Read Count
Definice The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Příklady
  • 325
  • 73591
  • 8302
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:recordedBy
Termín IRI http://rs.tdwg.org/dwc/terms/recordedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/recordedBy-2026-05-26
Štítek Zaznamenáno od
Definice A name for a dcterms:Agent responsible for recording a dwc:Occurrence.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • José E. Crespo
  • Oliver P. Pearson | Anita K. Pearson
  • Megatherium Club
  • The Natural History Society of Northumbria
  • ROV SuBastian
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/GatheringAgents/GatheringAgentsText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:recordedBy
Termín IRI http://rs.tdwg.org/dwc/iri/recordedBy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/recordedBy-2026-05-26
Štítek Recorded By (IRI)
Definice An IRI identifying a dcterms:Agent responsible for recording a dwc:Occurrence.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:recordedByID
Termín IRI http://rs.tdwg.org/dwc/terms/recordedByID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/recordedByID-2026-05-26
Štítek Zaznamenáno od ID
Definice An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ).
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:recordNumber
Termín IRI http://rs.tdwg.org/dwc/iri/recordNumber
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/recordNumber-2023-06-28
Štítek Record Number (IRI)
Definice An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
Poznámky The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:recordNumber
Termín IRI http://rs.tdwg.org/dwc/terms/recordNumber
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/recordNumber-2023-06-28
Štítek Číslo záznamu
Definice Identifikátor přidělený dwc:Occurrence v době, kdy byl zaznamenán. Často slouží jako spojovací článek mezi terénními poznámkami a záznamem dwc:Occurrence, např. číslo sběratele exempláře.
Poznámky Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje zadat jakoukoli řetězcovou literální hodnotu.
Příklady OPP 7101
ABCD ekvivalence DataSets/DataSet/Units/Unit/CollectorsFieldNumber
Typ Vlastnost
Název termínu dwc:referenceID
Termín IRI http://rs.tdwg.org/dwc/terms/referenceID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/referenceID-2026-05-26
Štítek Reference ID
Definice An identifier for a dcterms:BibliographicResource.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:referenceRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/referenceRemarks
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/referenceRemarks-2026-05-26
Štítek Reference Remarks
Definice Comments or notes about a dcterms:BibliographicResource.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dcterms:references
Termín IRI http://purl.org/dc/terms/references
Změněno 2026-05-26
Verze termínu IRI http://dublincore.org/usage/terms/history/#references-003
Štítek Odkazy
Definice Související zdroj, na který popisovaný zdroj odkazuje, který je citován nebo na který jinak odkazuje.
Poznámky From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2011-10-16_7
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:referenceType
Termín IRI http://rs.tdwg.org/dwc/terms/referenceType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/referenceType-2026-05-26
Štítek Typ odkazu
Definice A category that best matches the nature of a dcterms:BibliographicResource.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • book, bookSection, journalArticle, thesis
  • proceedingsPaper
  • report
  • poster
  • fieldNotebook
  • log
  • oralCommunication
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:RelatedBasisOfRecord
Termín IRI http://rs.tdwg.org/dwc/terms/RelatedBasisOfRecord
Změněno 2009-01-26
Štítek Related Basis of Record
Tento termín je zastaralý a již by se neměl používat.
Definice The nature of the related resource. Recommended best practice is to use the same controlled vocabulary as for basisOfRecord.
Poznámky Example: "PreservedSpecimen"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:relatedResourceID
Termín IRI http://rs.tdwg.org/dwc/terms/relatedResourceID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relatedResourceID-2026-05-26
Štítek ID souvisejícího zdroje
Definice An identifier for the related resource (the object) of a dwc:ResourceRelationship.
Poznámky Recommended best practice is to use a globally unique identifier.
Příklady dc609808-b09b-11e8-96f8-529269fb1459
ABCD ekvivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:relatedResourceType
Termín IRI http://rs.tdwg.org/dwc/terms/relatedResourceType
Změněno 2009-10-09
Štítek Related Resource Type
Tento termín je zastaralý a již by se neměl používat.
Definice The type of the related resource. Recommended best practice is to use a controlled vocabulary.
Poznámky Examples: "StillImage", "MovingImage", "Sound", PhysicalObject", "PreservedSpecimen", FossilSpecimen", LivingSpecimen", "HumanObservation", "MachineObservation", "Location", "Taxonomy", "NomeclaturalChecklist", "Publication"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:relationshipAccordingTo
Termín IRI http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Změněno 2018-09-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relationshipAccordingTo-2018-09-06
Štítek Vztah podle
Definice Zdroj (osoba, organizace, publikace, odkaz), který určuje vztah mezi oběma zdroji.
Příklady Julie Woodruff
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:relationshipEstablishedDate
Termín IRI http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relationshipEstablishedDate-2025-06-12
Štítek Datum vzniku vztahu
Definice Datum a čas, kdy byl vztah mezi oběma zdroji navázán.
Poznámky Doporučeným osvědčeným postupem je používat datum, které je v souladu s normou ISO 8601-1:2019.
Příklady
  • 1963-03-08T14:07-06:00 (8. března 1963 v 14:07 a později a před 14:08 v časovém pásmu o šest hodin dříve než UTC)
  • 2009-02-20T08:40Z (20. února 2009 v 8:40 a později a před 8:41 UTC)
  • 2018-08-29T15:19 (29. srpna 2018 v 15:19 a později a před 15:20 místního času)
  • 1809-02-12 (v rámci dne 12. února 1809)
  • 1906-06 (v měsíci červnu 1906)
  • 1971 (v roce 1971)
  • 2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (někdy v intervalu od 1. března 2007 v 13:00 UTC do 11. května 2008 v 15:30 UTC)
  • 1900/1909 (někdy v intervalu mezi začátkem roku 1900 a před rokem 1909)
  • 2007-11-13/15 (někdy v intervalu mezi začátkem 13. listopadu 2007 a před 15. listopadem 2007)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:relationshipOfResource
Termín IRI http://rs.tdwg.org/dwc/terms/relationshipOfResource
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relationshipOfResource-2023-06-28
Štítek Vztah ke zdroji
Definice Vztah subjektu (identifikovaného pomocí dwc:resourceID) k objektu (identifikovanému pomocí dwc:relatedResourceID).
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • same as
  • duplicate of
  • mother of
  • offspring of
  • sibling of
  • parasite of
  • host of
  • valid synonym of
  • located within
  • pollinator of members of taxon
  • pollinated specific plant
  • pollinated by members of taxon
  • on slab with
ABCD ekvivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociationType
Typ Vlastnost
Název termínu dwc:relationshipOfResourceID
Termín IRI http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relationshipOfResourceID-2023-06-28
Štítek ID Vztahu ke zdroji
Definice Identifikátor typu vztahu (predikátu), který spojuje subjekt identifikovaný pomocí dwc:resourceID s jeho objektem identifikovaným pomocí dwc:relatedResourceID.
Poznámky Doporučeným osvědčeným postupem je použití identifikátorů termínů v řízeném slovníku, jako je například Ontologie vztahů OBO.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Název termínu dwc:relationshipRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/relationshipRemarks
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/relationshipRemarks-2023-06-28
Štítek Poznámky o vztazích
Definice Komentáře nebo poznámky ke vztahu mezi oběma zdroji.
Příklady
  • mother and offspring collected from the same nest
  • pollinator captured in the act
ABCD ekvivalence DataSets/DataSet/Units/Unit/Associations/UnitAssociation/Comments
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwciri:reproductiveCondition
Termín IRI http://rs.tdwg.org/dwc/iri/reproductiveCondition
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/reproductiveCondition-2026-05-26
Štítek Reproductive Condition (IRI)
Definice A reproductive condition of a dwc:Organism.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:reproductiveCondition
Termín IRI http://rs.tdwg.org/dwc/terms/reproductiveCondition
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/reproductiveCondition-2026-05-26
Štítek Reprodukční stav
Definice A reproductive condition of a dwc:Organism.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • non-reproductive
  • pregnant
  • in bloom
  • fruit-bearing
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:resourceID
Termín IRI http://rs.tdwg.org/dwc/terms/resourceID
Změněno 2018-09-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/resourceID-2018-09-06
Štítek ID zdroje
Definice Identifikátor prostředku, který je předmětem vztahu.
Příklady f809b9e0-b09b-11e8-96f8-529269fb1459
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:ResourceRelationship
Termín IRI http://rs.tdwg.org/dwc/terms/ResourceRelationship
Změněno 2023-09-13
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/ResourceRelationship-2023-09-13
Štítek Vztah mezi zdroji
Definice Vztah jednoho rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) k jinému.
Poznámky Zdroje lze považovat za identifikovatelné záznamy nebo instance tříd a mohou zahrnovat instance dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification nebo dwc:Taxon, ale nemusí se na ně omezovat.
Příklady
  • an instance of a dwc:Organism is the mother of another instance of a dwc:Organism
  • a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence
  • a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity
ABCD ekvivalence DataSets/DataSet/Units/Unit/Associations
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Název termínu dwc:resourceRelationshipID
Termín IRI http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/resourceRelationshipID-2026-05-26
Štítek ID vztahu mezi zdroji
Definice An identifier for a dwc:ResourceRelationship.
Poznámky Recommended best practice is to use a globally unique identifier.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dcterms:rights
Termín IRI http://purl.org/dc/terms/rights
Změněno 2008-01-14
Štítek Rights
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://purl.org/dc/terms/license
Definice Information about rights held in and over the resource.
Poznámky Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-11-06_17
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dcterms:rightsHolder
Termín IRI http://purl.org/dc/terms/rightsHolder
Změněno 2008-01-14
Verze termínu IRI http://dublincore.org/usage/terms/history/#rightsHolder-002
Štítek Držitel práv
Definice Osoba nebo organizace, která vlastní nebo spravuje práva k danému zdroji.
Příklady The Regents of the University of California
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:Sample
Termín IRI http://rs.tdwg.org/dwc/terms/Sample
Změněno 2009-04-29
Štítek Sample
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/Occurrence
Definice Container class for information about the results of a sampling event (specimen, observation, etc.)
ABCD ekvivalence DataSets/DataSet/Units/Unit
Typ Třída
Název termínu dwc:SampleAttribute
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttribute
Změněno 2009-04-29
Štítek Sample Attribute
Tento termín je zastaralý a již by se neměl používat.
Definice Container class for information about attributes related to a given sample.
ABCD ekvivalence Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Typ Třída
Název termínu dwc:SampleAttributeAccuracy
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeAccuracy
Změněno 2009-04-29
Štítek Sample Attribute Accuracy
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Definice The description of the error associated with the SampleAttributeValue.
Poznámky Example: "0.01", "normal distribution with variation of 2 m"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Typ Vlastnost
Název termínu dwc:SampleAttributeDeterminedBy
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedBy
Změněno 2009-04-29
Štítek Sample Attribute Determined By
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Definice The agent responsible for having determined the value of the measurement or characteristic of the sample.
Poznámky Example: "Javier de la Torre"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Typ Vlastnost
Název termínu dwc:SampleAttributeDeterminedDate
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedDate
Změněno 2009-04-29
Štítek Sample Attribute Determined Date
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Definice The date on which the the measurement or characteristic of the sample was made.
Poznámky Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Typ Vlastnost
Název termínu dwc:SampleAttributeRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeRemarks
Změněno 2009-04-29
Štítek Sample Attribute Remarks
Tento termín je zastaralý a již by se neměl používat.
Definice Comments or notes accompanying the measurement or characteristic of the sample.
Poznámky Example: "tip of tail missing"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:SampleAttributeUnit
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeUnit
Změněno 2009-04-29
Štítek Sample Attribute Unit
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Definice The units for the value of the measurement or characteristic of the sample. Recommended best practice is to use International System of Units (SI) units.
Poznámky Example: "mm"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Typ Vlastnost
Název termínu dwc:SampleAttributeValue
Termín IRI http://rs.tdwg.org/dwc/terms/SampleAttributeValue
Změněno 2009-04-29
Štítek Sample Attribute Value
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Definice The value of the measurement or characteristic of the sample.
Poznámky Example: "45"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Typ Vlastnost
Název termínu dwciri:sampledSubstrateCategory
Termín IRI http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/sampledSubstrateCategory-2026-05-26
Štítek Sampled Substrate Category (IRI)
Definice A category or type of substrate sampled during a dwc:Event.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:sampledSubstrateCategory
Termín IRI http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sampledSubstrateCategory-2026-05-26
Štítek Sampled Substrate Category
Definice A category or type of substrate sampled during a dwc:Event.
Poznámky Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • vegetation
  • soil
  • ocean
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:sampledSubstrateLayer
Termín IRI http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sampledSubstrateLayer-2026-05-26
Štítek Sampled Substrate Layer
Definice A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
Poznámky Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • forest floor
  • herbaceous | shrub
  • understory
  • canopy
  • organic (O)
  • surface (A)
  • eluviated (E)
  • subsoil (B)
  • parent material (C)
  • bedrock (R)
  • epipelagic | mesopelagic
  • bathypelagic
  • abysopelagic
  • hadalpelagic
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:sampledSubstrateLayer
Termín IRI http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/sampledSubstrateLayer-2026-05-26
Štítek Sampled Substrate Layer (IRI)
Definice An IRI identifying a substrate layer sampled during a dwc:Event.
Poznámky Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:SampleRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/SampleRemarks
Změněno 2009-04-29
Štítek Sample Remarks
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Definice Comments or notes about the sample or record.
Poznámky Example: "found dead on road"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Notes
Typ Vlastnost
Název termínu dwc:sampleSizeUnit
Termín IRI http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sampleSizeUnit-2023-06-28
Štítek Jednotka velikosti vzorku
Definice Měrná jednotka velikosti (doba trvání, délka, plocha nebo objem) vzorku při odběru dwc:Event.
Poznámky K dwc:sampleSizeUnit musí být přiřazena odpovídající dwc:sampleSizeValue, např. 5 pro dwc:sampleSizeValue s m pro dwc:sampleSizeUnit. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • minute
  • hour
  • day
  • metre
  • square metre
  • cubic metre
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2015-03-19_18
Název termínu dwciri:sampleSizeUnit
Termín IRI http://rs.tdwg.org/dwc/iri/sampleSizeUnit
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/sampleSizeUnit-2025-07-10
Štítek Sampling Size Unit (IRI)
Definice The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Poznámky A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:sampleSizeValue
Termín IRI http://rs.tdwg.org/dwc/terms/sampleSizeValue
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sampleSizeValue-2023-06-28
Štítek Hodnota velikosti vzorku
Definice Číselná hodnota pro měření velikosti (doba trvání, délka, plocha nebo objem) vzorku při odběru dwc:Event.
Poznámky Hodnota dwc:sampleSizeValue musí mít odpovídající hodnotu dwc:sampleSizeUnit.
Příklady 5 (sampleSizeValue) s metre (sampleSizeUnit)
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2015-03-19_18
Název termínu dwc:SamplingAttributeID
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingAttributeID
Změněno 2009-04-29
Štítek Sample Attribute ID
Tento termín je zastaralý a již by se neměl používat.
Definice An identifier for the sampling attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:SamplingAttributeType
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Změněno 2009-04-29
Štítek Sample Attribute Type
Tento termín je zastaralý a již by se neměl používat.
Definice The nature of the measurement or characteristic of the sample. Recommended best practice is to use a controlled vocabulary.
Poznámky Example: "tail length"
ABCD ekvivalence DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Typ Vlastnost
Název termínu dwc:samplingEffort
Termín IRI http://rs.tdwg.org/dwc/terms/samplingEffort
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/samplingEffort-2023-06-28
Štítek Intenzita sběru vzorků
Definice Množství úsilí vynaloženého během dwc:Event.
Příklady
  • 40 trap-nights
  • 10 observer-hours
  • 10 km by foot
  • 30 km by car
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:SamplingEvent
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingEvent
Změněno 2009-04-29
Štítek Sampling Event
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/Event
Definice Container class for information about the conditions and methods of acquisition of samples.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering
Typ Třída
Název termínu dwc:SamplingEventAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingEventAttributes
Změněno 2009-04-29
Štítek Sampling Event Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements or characteristics of the sampling event.
Poznámky Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Typ Vlastnost
Název termínu dwc:SamplingEventID
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingEventID
Změněno 2009-04-29
Štítek Sampling Event ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventID
Definice An identifier for the sampling event. May be a global unique identifier or an identifier specific to the data set.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Code
Typ Vlastnost
Název termínu dwc:SamplingEventRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingEventRemarks
Změněno 2009-04-29
Štítek Sampling Event Remarks
Tento termín je zastaralý a již by se neměl používat.
Definice Comments or notes about the sampling event.
Poznámky Example: "found dead on road"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:SamplingLocation
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingLocation
Změněno 2009-04-29
Štítek Sampling Location
Tento termín je zastaralý a již by se neměl používat.
Definice Container class for information about the location where a sampling event occurred.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/LocalityText
Typ Třída
Název termínu dwc:SamplingLocationID
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingLocationID
Změněno 2009-04-29
Štítek Sampling Location ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/locationID
Definice An identifier for the sampling location. May be a global unique identifier or an identifier specific to the data set.
Poznámky Example: "MVZ:LocID:12345"
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:SamplingLocationRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/SamplingLocationRemarks
Změněno 2009-04-29
Štítek Sampling Location Remarks
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/locationRemarks
Definice Comments or notes about the sampling location.
Poznámky Example: "under water since 2005"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Typ Vlastnost
Název termínu dwc:samplingProtocol
Termín IRI http://rs.tdwg.org/dwc/terms/samplingProtocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/samplingProtocol-2026-05-26
Štítek Protokol o sběru vzorků
Definice Názvy, odkazy nebo popisy metod nebo protokolů použitých během dwc:Event.
Poznámky Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Method
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:samplingProtocol
Termín IRI http://rs.tdwg.org/dwc/iri/samplingProtocol
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/samplingProtocol-2026-05-26
Štítek Sampling Protocol (IRI)
Definice The methods or protocols used during a dwc:Event, denoted by an IRI.
Poznámky Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:scientificName
Termín IRI http://rs.tdwg.org/dwc/terms/scientificName
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/scientificName-2026-05-26
Štítek Vědecký název
Definice The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
Poznámky This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign × (Unicode U+00D7, HTML ×) to identify a hybrid, not x or X, if possible.
Příklady
  • Coleoptera (order)
  • Vespertilionidae (family)
  • Manis (genus)
  • Ctenomys sociabilis (genus + specificEpithet)
  • Ambystoma tigrinum diaboli (genus + specificEpithet + infraspecificEpithet)
  • Roptrocerus typographi (Györfi, 1952) (genus + specificEpithet + scientificNameAuthorship)
  • Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)
  • ×Agropogon littoralis (Sm.) C. E. Hubb.
  • Mentha ×smithiana R. A. Graham
  • Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/FullScientificNameString
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:scientificNameAuthorship
Termín IRI http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/scientificNameAuthorship-2023-06-28
Štítek Autorství vědeckého názvu
Definice Informace o autorství pro dwc:scientificName formátované podle konvencí příslušného dwc:nomenclaturalCode.
Příklady
  • (Torr.) J.T. Howell
  • (Martinovský) Tzvelev
  • (Györfi, 1952)
ABCD ekvivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/ParentheticalAuthorTeamAndYear + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/AuthorTeamAndYear} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeamParenthesis + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeam} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamOriginalAndYear + [= or] DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamParenthesisAndYear}
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:scientificNameID
Termín IRI http://rs.tdwg.org/dwc/terms/scientificNameID
Změněno 2017-10-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/scientificNameID-2017-10-06
Štítek ID vědeckého názvu
Definice Identifikátor pro nomenklaturní (nikoli taxonomické) údaje vědeckého názvu.
Příklady urn:lsid:ipni.org:names:37829-1:1.3
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Název termínu dwc:scientificNameRank
Termín IRI http://rs.tdwg.org/dwc/terms/scientificNameRank
Změněno 2009-09-21
Štítek Scientific Name Rank
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/taxonRank
Definice The taxonomic rank of the most specific name in the scientificName. Recommended best practice is to use a controlled vocabulary.
Poznámky Examples: "subsp.", "var.", "forma", "species", "genus"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Typ Vlastnost
Název termínu dwc:sequence
Termín IRI http://rs.tdwg.org/dwc/terms/sequence
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sequence-2026-05-26
Štítek Sequence
Definice A string representing nucleotide base pairs.
Poznámky Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
Příklady TCTATCCTCAATTATAGGTCATAATTCACCATCAG
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:sex
Termín IRI http://rs.tdwg.org/dwc/terms/sex
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/sex-2026-05-26
Štítek Pohlaví
Definice A sex of a dwc:Organism.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • female
  • male
  • hermaphrodite
ABCD ekvivalence DataSets/DataSet/Units/Unit/Sex
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:sex
Termín IRI http://rs.tdwg.org/dwc/iri/sex
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/sex-2026-05-26
Štítek Sex (IRI)
Definice A sex of a dwc:Organism.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:siteNumber
Termín IRI http://rs.tdwg.org/dwc/iri/siteNumber
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/siteNumber-2026-05-26
Štítek Site Number (IRI)
Definice An identifier for a named site.
Poznámky Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:siteNumber
Termín IRI http://rs.tdwg.org/dwc/terms/siteNumber
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/siteNumber-2026-05-26
Štítek Site Number
Definice An identifier for a named site.
Poznámky Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • USGS CENO LOC 21387
  • UCM 2025001
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:specificEpithet
Termín IRI http://rs.tdwg.org/dwc/terms/specificEpithet
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/specificEpithet-2023-06-28
Štítek Specifický epithet
Definice Název prvního nebo druhového epiteta dwc:scientificName.
Příklady
  • concolor
  • gottschei
ABCD ekvivalence {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SpeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SpeciesEpithet}
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:startDayOfYear
Termín IRI http://rs.tdwg.org/dwc/terms/startDayOfYear
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/startDayOfYear-2026-05-26
Štítek Počáteční den roku
Definice The earliest integer day of the year on which a dwc:Event occurred.
Poznámky The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Příklady
  • 1 (1. ledna)
  • 32 (1. února)
  • 366 (31. prosince)
  • 365 (30. prosince v přestupném roce, 31. prosince v nepřestupném roce)
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberBegin
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:StartTimeOfDay
Termín IRI http://rs.tdwg.org/dwc/terms/StartTimeOfDay
Změněno 2009-04-24
Štítek Start Time of Day
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/eventTime
Definice The time of day when the event began, expressed as decimal hours from midnight, local time.
Poznámky Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD ekvivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Typ Vlastnost
Název termínu dwc:stateProvince
Termín IRI http://rs.tdwg.org/dwc/terms/stateProvince
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/stateProvince-2023-06-28
Štítek Členění prvního řádu
Definice Název nejbližší menší správní oblasti než země (stát, provincie, kanton, departement, region atd.), ve které se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například Getty Thesaurus of Geographic Names. Doporučeným osvědčeným postupem je ponechat toto pole prázdné, pokud dcterms:Location pokrývá více entit na této administrativní úrovni nebo pokud dcterms:Location může být v jedné nebo jiné z více možných entit na této úrovni. Násobnost a neurčitost geografické entity lze zachytit buď v termínu dwc:higherGeography, nebo v termínu dwc:locality, případně v obou.
Příklady
  • Montana
  • Minas Gerais
  • Córdoba
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= State or = Province (etc.)
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:subfamily
Termín IRI http://rs.tdwg.org/dwc/terms/subfamily
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/subfamily-2023-06-28
Štítek Podčeleď
Definice Úplný vědecký název podčeledi, do které je dwc:Taxon zařazen.
Příklady
  • Periptyctinae
  • Orchidoideae
  • Sphindociinae
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName if DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonRank == "subfamilia"
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Název termínu dwc:subgenus
Termín IRI http://rs.tdwg.org/dwc/terms/subgenus
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/subgenus-2025-06-12
Štítek Podrod
Definice Úplný vědecký název podrodu, do kterého je dwc:Taxon zařazen.
Poznámky Hodnota tohoto termínu by měla být úplným názvem podrodu, jak to vyžaduje příslušný nomenklaturní kód.
Příklady
  • Abacetus (Parastygis)
  • Dicranum subgen. Orthodicranum
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:subtribe
Termín IRI http://rs.tdwg.org/dwc/terms/subtribe
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/subtribe-2023-06-28
Štítek Podkmen
Definice Úplný vědecký název podkmene, do kterého je dwc:Taxon zařazen.
Příklady
  • Plotinini
  • Typhaeini
ABCD ekvivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dwc:superfamily
Termín IRI http://rs.tdwg.org/dwc/terms/superfamily
Změněno 2023-07-07
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/superfamily-2023-07-07
Štítek Nadčeleď
Definice Úplný vědecký název nadčeledi, do které je dwc:Taxon zařazen.
Poznámky Taxonomická kategorie podřízená řádu a nadřazená čeledi. Podle článku 29.2 ICZN se pro název nadčeledi používá přípona -oidea.
Příklady
  • Achatinoidea
  • Cerithioidea
  • Helicoidea
  • Hypsibioidea
  • Valvatoidea
  • Zonitoidea
ABCD ekvivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: superfamilia)
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dwc:Taxon
Termín IRI http://rs.tdwg.org/dwc/terms/Taxon
Změněno 2023-09-18
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/Taxon-2023-09-18
Štítek Taxon
Definice Skupina organismů (sensu http://purl.obolibrary.org/obo/OBI_0100026), kterou taxonomové považují za homogenní jednotku.
Příklady the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820
ABCD ekvivalence no simple equivalent in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-26_15
Název termínu dwc:taxonAccordingTo
Termín IRI http://rs.tdwg.org/dwc/terms/taxonAccordingTo
Změněno 2009-09-21
Štítek Taxon According To
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/nameAccordingTo
Definice Information about the authorship of this taxon concept which uses the scientificName in their sense (secundum, sensu). Could be a publication (identification key), institution or team of individuals.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:taxonAttributes
Termín IRI http://rs.tdwg.org/dwc/terms/taxonAttributes
Změněno 2009-10-09
Štítek Taxon Attributes
Tento termín je zastaralý a již by se neměl používat.
Definice A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the taxon.
Poznámky Example: "iucnstatus=vulnerable; distribution=Neuquen, Argentina"
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/InformalNameString
Typ Vlastnost
Název termínu dwc:taxonConceptID
Termín IRI http://rs.tdwg.org/dwc/terms/taxonConceptID
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonConceptID-2023-06-28
Štítek ID návrhu taxonu
Definice Identifikátor taxonomického konceptu, ke kterému se záznam vztahuje - nikoliv nomenklaturní údaje o dwc:Taxon.
Příklady 8fa58e08-08de-4ac1-b69c-1235340b7001
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:taxonFormula
Termín IRI http://rs.tdwg.org/dwc/terms/taxonFormula
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonFormula-2026-05-26
Štítek Taxon Formula
Definice A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • A
  • not A
  • A ?
  • A or B
  • A and B
  • A x B
  • A cf.
  • A aff.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:taxonFormula
Termín IRI http://rs.tdwg.org/dwc/iri/taxonFormula
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/taxonFormula-2026-05-26
Štítek Taxon Formula (IRI)
Definice A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:TaxonID
Termín IRI http://rs.tdwg.org/dwc/terms/TaxonID
Změněno 2009-04-24
Štítek Taxon ID
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/taxonNameID
Definice A global unique identifier for the taxon (name in a classification).
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:taxonID
Termín IRI http://rs.tdwg.org/dwc/terms/taxonID
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonID-2026-05-26
Štítek ID taxonu
Definice An identifier for a dwc:Taxon.
Příklady
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:taxonNameID
Termín IRI http://rs.tdwg.org/dwc/terms/taxonNameID
Změněno 2009-07-06
Štítek Taxon Name ID
Tento termín je zastaralý a již by se neměl používat.
Definice A unique identifier for the scientificName.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:taxonomicStatus
Termín IRI http://rs.tdwg.org/dwc/terms/taxonomicStatus
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonomicStatus-2023-06-28
Štítek Taxonomický status
Definice Stav použití dwc:scientificName jako označení taxonu. Vyžaduje taxonomické stanovisko k vymezení rozsahu dwc:Taxon. Pravidla priority se pak používají k definování taxonomického statusu nomenklatury obsažené v tomto rozsahu v kombinaci se stanoviskem odborníků. Musí být propojen s konkrétním taxonomickým odkazem, který definuje daný pojem.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník.
Příklady
  • invalid
  • misapplied
  • homotypic synonym
  • accepted
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:taxonRank
Termín IRI http://rs.tdwg.org/dwc/terms/taxonRank
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonRank-2026-05-26
Štítek Zařazení taxonu
Definice Taxonomické zařazení nejkonkrétnějšího názvu v dwc:scientificName.
Poznámky Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
Příklady
  • subspecies
  • varietas
  • forma
  • species
  • genus
  • nothogenus
  • nothospecies
  • nothosubspecies
ABCD ekvivalence DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:taxonRemarks
Termín IRI http://rs.tdwg.org/dwc/terms/taxonRemarks
Změněno 2017-10-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/taxonRemarks-2017-10-06
Štítek Poznámky k taxonu
Definice Poznámky nebo poznámky k taxonu nebo názvu.
Příklady this name is a misspelling in common use
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:toDigitalSpecimen
Termín IRI http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/toDigitalSpecimen-2025-06-12
Štítek To Digital Specimen
Definice Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Poznámky Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:toTaxon
Termín IRI http://rs.tdwg.org/dwc/iri/toTaxon
Změněno 2015-03-27
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/toTaxon-2015-03-27
Štítek To Taxon
Definice Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Poznámky A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwc:tribe
Termín IRI http://rs.tdwg.org/dwc/terms/tribe
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/tribe-2023-06-28
Štítek Kmen
Definice Úplný vědecký název kmene, do kterého je dwc:Taxon zařazen.
Příklady
  • Ortaliini
  • Arethuseae
ABCD ekvivalence ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dc:type
Termín IRI http://purl.org/dc/elements/1.1/type
Změněno 2025-06-12
Verze termínu IRI http://dublincore.org/usage/terms/history/#type-006
Štítek Typ
Definice Povaha nebo druh zdroje.
Poznámky Musí být vyplněn hodnotou ze slovníku typů DCMI (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
Příklady
  • StillImage
  • MovingImage
  • Sound
  • PhysicalObject
  • Event
  • Text
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_20
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dcterms:type
Termín IRI http://purl.org/dc/terms/type
Změněno 2008-01-14
Štítek Type
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://purl.org/dc/elements/1.1/type
Definice The nature or genre of the resource.
Poznámky To provide a string literal value for type, use dc:type rather than this term. In accordance with the Darwin Core RDF guide, rdf:type should be used instead of this term to indicate an IRI value for type.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2009-12-07_1
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_20
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-02-24_55
Název termínu dwc:typeOfType
Termín IRI http://rs.tdwg.org/dwc/terms/typeOfType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/typeOfType-2026-05-26
Štítek Type Of Type
Definice A category of nomenclatural type of a dwc:MaterialEntity.
Poznámky The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Příklady
  • holotype
  • isotype
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/TypeStatus
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:typeStatus
Termín IRI http://rs.tdwg.org/dwc/terms/typeStatus
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/typeStatus-2023-06-28
Štítek Typový status
Definice Seznam (spojený a oddělený) nomenklaturních typů (status typu, typizovaný vědecký název, publikace), které se na předmět vztahují.
Poznámky Doporučeným postupem je oddělovat hodnoty v seznamu mezerou svislou čarou mezerou ( | ). Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388
  • holotype of Pinus abies | holotype of Picea abies
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2014-10-30_16
Název termínu dwciri:typeStatus
Termín IRI http://rs.tdwg.org/dwc/iri/typeStatus
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/typeStatus-2025-07-10
Štítek Type Status (IRI)
Definice A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
Poznámky Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwc:typifiedName
Termín IRI http://rs.tdwg.org/dwc/terms/typifiedName
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/typifiedName-2026-05-26
Štítek Typizovaný název
Definice A scientific name for which a specimen or other name is the type.
Poznámky The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
Příklady Polysiphonia amphibolis Womersley
ABCD ekvivalence DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/TypifiedName
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:UsagePolicy
Termín IRI http://rs.tdwg.org/dwc/terms/UsagePolicy
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/UsagePolicy-2026-05-26
Štítek Usage Policy
Definice Information about rights, usage, and attribution statements applicable to an entity.
Poznámky This is a convenience class to group related properties.
ABCD ekvivalence not in ABCD
Typ Třída
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimAssertionType
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimAssertionType
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimAssertionType-2026-05-26
Štítek Verbatim Assertion Type
Definice A string representing the type of dwc:Assertion as it appeared in an original record.
Poznámky This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Příklady
  • water_temp
  • Fish biomass
  • sampling net mesh size
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimCoordinates
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimCoordinates-2026-05-26
Štítek Přesné souřadnice
Definice Verbatim original spatial coordinates of a dcterms:Location.
Poznámky The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Příklady
  • 41 05 54S 121 05 34W
  • 17T 630000 4833400
ABCD ekvivalence {DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinatesText or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesUTM/UTMText}
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwciri:verbatimCoordinateSystem
Termín IRI http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/verbatimCoordinateSystem-2026-05-26
Štítek Verbatim Coordinate System (IRI)
Definice A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimCoordinateSystem
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimCoordinateSystem-2026-05-26
Štítek Přesný souřadnicový systém
Definice A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • decimal degrees
  • degrees decimal minutes
  • degrees minutes seconds
  • UTM
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesGrid/GridCellSystem
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimDepth
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimDepth
Změněno 2017-10-06
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimDepth-2017-10-06
Štítek Přesná hloubka
Definice Původní popis hloubky pod místním povrchem.
Příklady 100-200 m
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactText
Typ Vlastnost
Název termínu dwc:verbatimElevation
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimElevation
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimElevation-2026-05-26
Štítek Přesná výška
Definice An original description of the elevation of a dcterms:Location.
Příklady 100-200 m
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimEventDate
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimEventDate
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimEventDate-2023-06-28
Štítek Přesné datum události
Definice Doslovná původní reprezentace informací o datu a čase pro dwc:Event.
Příklady
  • spring 1910
  • Marzo 2002
  • 1999-03-XX
  • 17IV1934
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/DateTime/DateText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:verbatimIdentification
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimIdentification
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimIdentification-2023-06-28
Štítek Přesná identifikace
Definice Řetězec představující taxonomickou identifikaci, jak je uvedena v původním záznamu.
Poznámky Tento termín má umožnit zachycení nezměněné původní identifikace/určení, včetně identifikačních kvalifikátorů, hybridních vzorců, nejistot atd. Tento termín je určen k použití jako doplněk k dwc:scientificName (a dwc:identificationQualifier atd.), nikoli místo něj.
Příklady
  • Peromyscus sp.
  • Ministrymon sp. nov. 1
  • Anser anser × Branta canadensis
  • Pachyporidae?
  • Potentilla × pantotricha Soják
  • Aconitum pilipes × A. variegatum
  • Lepomis auritus x cyanellus
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Název termínu dwc:verbatimLabel
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimLabel
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimLabel-2026-05-26
Štítek Přesný štítek
Definice A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
Poznámky The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
ABCD ekvivalence Marks/Mark/MarkText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimLatitude
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimLatitude
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimLatitude-2026-05-26
Štítek Přesná zeměpisná šířka
Definice A verbatim original latitude of a dcterms:Location.
Poznámky The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Příklady 41 05 54.03S
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLatitude
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimLocality
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimLocality
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimLocality-2026-05-26
Štítek Přesná lokalita
Definice An original textual description of a dcterms:Location.
Příklady 25 km NNE Bariloche por R. Nac. 237
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/LocalityText
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimLongitude
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimLongitude
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimLongitude-2026-05-26
Štítek Přesná zeměpisná délka
Definice A verbatim original longitude of a dcterms:Location.
Poznámky The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Příklady 121d 10' 34" W
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLongitude
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verbatimMeasurementType
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimMeasurementType-2025-06-12
Štítek Přesný typ měření
Definice Řetězec představující typ měření nebo skutečnosti, jak je uveden v původním záznamu.
Poznámky Tento termín má umožnit zachycení nezměněného původního názvu měření nebo typu skutečnosti. Tento termín se má používat jako doplněk k dwc:measurementType, nikoli místo něj.
Příklady
  • water_temp
  • Fish biomass
  • sampling net mesh size
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:verbatimScientificNameRank
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimScientificNameRank
Změněno 2009-09-21
Štítek Verbatim Scientific Name Rank
Tento termín je zastaralý a již by se neměl používat.
Je nahrazen http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Definice The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
Poznámky Examples: "Agamospecies", "sub-lesus", "prole", "apomict", "nothogrex".
ABCD ekvivalence not in ABCD
Typ Vlastnost
Název termínu dwciri:verbatimSRS
Termín IRI http://rs.tdwg.org/dwc/iri/verbatimSRS
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/verbatimSRS-2025-06-12
Štítek Verbatim SRS (IRI)
Definice The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Poznámky Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:verbatimSRS
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimSRS
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimSRS-2025-06-12
Štítek Přesný SRS
Definice Elipsoid, geodetický referenční bod nebo prostorový referenční systém (SRS), na kterém jsou založeny souřadnice uvedené v dwc:verbatimLatitude a dwc:verbatimLongitude nebo dwc:verbatimCoordinates.
Poznámky Doporučeným osvědčeným postupem je použít kód EPSG SRS, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód geodetického podkladu, pokud je znám. V opačném případě použijte řízený slovník pro název nebo kód elipsoidu, je-li znám. Není-li žádný z těchto údajů znám, použijte hodnotu nezaznamenáno. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který umožňuje jako hodnotu pouze IRI, zatímco tento termín umožňuje jakoukoli textovou hodnotu řetězce.
Příklady
  • EPSG:4326
  • WGS84
  • NAD27
  • Campo Inchauspe
  • European 1950
  • Clarke 1866
  • not recorded
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwc:verbatimTaxonRank
Termín IRI http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verbatimTaxonRank-2023-06-28
Štítek Přesné zařazení taxonu
Definice Taxonomické zařazení nejkonkrétnějšího jména v dwc:scientificName, jak je uvedeno v původním záznamu.
Příklady
  • Agamospecies
  • sub-lesus
  • prole
  • apomict
  • nothogrex
  • sp.
  • subsp.
  • var.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-12-11_54
Název termínu dwc:vernacularName
Termín IRI http://rs.tdwg.org/dwc/terms/vernacularName
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/vernacularName-2026-05-26
Štítek Místní název
Definice Obecný nebo místní název.
Příklady
  • cóndor andino
  • death cap
  • rainbow trout
  • Gänsegeier
  • smoky quartz
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2019-12-01_19
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:verticalDatum
Termín IRI http://rs.tdwg.org/dwc/terms/verticalDatum
Změněno 2025-06-12
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/verticalDatum-2025-06-12
Štítek Vertikální georeferenční údaj
Definice Svislý referenční bod, který se používá jako referenční bod, na němž jsou založeny hodnoty v nadmořských výškách.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu umožňuje pouze IRI, zatímco tento termín umožňuje jakoukoli řetězcovou literální hodnotu.
Příklady
  • EGM84
  • EGM96
  • EGM2008
  • PGM2000A
  • PGM2004
  • PGM2006
  • PGM2007
  • EPSG:7030
  • not recorded
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-06-12_44
Název termínu dwciri:verticalDatum
Termín IRI http://rs.tdwg.org/dwc/iri/verticalDatum
Změněno 2025-07-10
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/verticalDatum-2025-07-10
Štítek Vertical Datum (IRI)
Definice The vertical datum used as the reference upon which the values in the elevation terms are based.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2021-07-15_34
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Název termínu dwciri:vitality
Termín IRI http://rs.tdwg.org/dwc/iri/vitality
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/iri/version/vitality-2026-05-26
Štítek Vitality (IRI)
Definice An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Poznámky Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2025-07-10_50
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:vitality
Termín IRI http://rs.tdwg.org/dwc/terms/vitality
Změněno 2026-05-26
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/vitality-2026-05-26
Štítek Vitalita
Definice Údaj o tom, zda byl dwc:Organism v době sběru nebo pozorování živý nebo mrtvý.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník. Tento termín má ekvivalent ve jmenném prostoru dwciri:, který jako hodnotu povoluje pouze IRI, zatímco tento termín povoluje jakoukoli řetězcovou literální hodnotu.
Příklady
  • alive
  • dead
  • mixedLot
  • uncertain
  • notAssessed
ABCD ekvivalence not in ABCD
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-06-28_40
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2023-09-13_41
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2026-05-26_58
Název termínu dwc:waterBody
Termín IRI http://rs.tdwg.org/dwc/terms/waterBody
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/waterBody-2023-06-28
Štítek Vodní plocha
Definice Název vodního útvaru, ve kterém se dcterms:Location vyskytuje.
Poznámky Doporučeným osvědčeným postupem je používat řízený slovník, například Getty Thesaurus of Geographic Names.
Příklady
  • Indian Ocean
  • Baltic Sea
  • Hudson River
  • Lago Nahuel Huapi
ABCD ekvivalence DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Water body
Typ Vlastnost
Rozhodnutí výkonného výboru http://rs.tdwg.org/decisions/decision-2024-02-28_43
Název termínu dwc:year
Termín IRI http://rs.tdwg.org/dwc/terms/year
Změněno 2023-06-28
Verze termínu IRI http://rs.tdwg.org/dwc/terms/version/year-2023-06-28
Štítek Rok
Definice Čtyřmístný rok, ve kterém došlo k dwc:Event podle kalendáře Common Era.
Příklady
  • 1160
  • 2008
ABCD ekvivalence accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Typ Vlastnost