Liste des termes du Darwin Core

Titre: Liste des termes du Darwin Core
Date de publication de la dernière mise à jour: 2026-05-26
Date de création: 2020-08-12
Fait partie du standard TDWG: http://www.tdwg.org/standards/450
Cette version: http://rs.tdwg.org/dwc/doc/list/2026-05-26
Dernière version: http://rs.tdwg.org/dwc/doc/list/
Version précédente: Previous version; http://rs.tdwg.org/dwc/doc/list/2025-07-10

Résumé : le Darwin Core est un standard conçu pour la transmission de données sur la biodiversité. Ce document dresse la liste de tous les termes des espaces de noms actuellement utilisés dans le vocabulaire.

Contributeurs: John Wieczorek (VertNet), Peter Desmet (Instituut voor Natuur- en Bosonderzoek (INBO)), Steve Baskauf (Vanderbilt University Libraries), Tim Robertson (Global Biodiversity Information Facility), Markus Döring (Global Biodiversity Information Facility), Quentin Groom (Botanic Garden Meise), Stijn Van Hoey (Instituut voor Natuur- en Bosonderzoek (INBO)), David Bloom (VertNet), Paula Zermoglio (VertNet), Robert Guralnick (University of Florida), John Deck (Genomic Biodiversity Working Group), Gail Kampmeier (Illinois Natural History Survey), Dave Vieglais (KU Natural History Museum), Renato De Giovanni (Centro de Referência em Informação Ambiental), Campbell Webb (TDWG RDF/OWL Task Group), Paul J. Morris (Harvard University Herbaria/Museum of Comparative Zoölogy), Mark Schildhauer (National Center for Ecological Analysis and Synthesis), Sophia Ratcliffe (National Biodiversity Network Trust), Teresa J. Mayfield-Meyer (The University of New Mexico, Arctos), Christian Bölling (Museum für Naturkunde Berlin - Leibniz-Institut für Evolutions- und Biodiversitätsforschung)

Créateur : Darwin Core Maintenance Group

Citation : Darwin Core Maintenance Group. 2026. Darwin Core List of Terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/2026-05-26

1 Introduction (À titre informatif)

Ce document contient les termes qui font partie de la version la plus récente du standard Darwin Core (http://rs.tdwg.org/version/dwc/2026-05-26).

Ce document inclut des termes dans quatre espaces de noms qui contiennent les termes recommandés dwc:, dwciri:, dc:, et dcterms:. Cependant, certains termes de ces espaces de noms sont obsolètes ou remplacés et ne doivent plus être utilisés. La dépréciation ou le remplacement d’un terme est indiqué dans les métadonnées de ce dernier. Les espaces de noms qui ne contiennent que des termes obsolètes ne sont pas inclus dans ce document, mais les métadonnées de ces termes peuvent être récupérées en déréférençant leurs IRI.

Pour une liste simplifiée ne contenant que les termes actuellement recommandés, voir le Guide de référence rapide du Darwin Core.

1.1 Statut du contenu de ce document

Les sections 1 et 3 ne sont pas normatives.

La section 2 est normative.

Dans la section 4, les valeurs de l’IRI du terme et de la Définition sont normatives. Les valeurs de Nom du Terme ne sont pas normatives, bien que l’on puisse s’attendre à ce que le préfixe de l’abréviation de l’espace de noms soit celui couramment utilisé pour l’espace de noms du terme. Le Label et les valeurs de toutes les autres propriétés (telles que les Exemples et les Notes) ne sont pas normatives.

1.2 Mots clés RFC 2119

Les mots clés “MUST/DOIT”, “MUST NOT/NE DOIT PAS”, “REQUIRED/OBLIGATOIRE”, “SHALL/DEVRA”, “SHALL NOT/NE DEVRA PAS”, “SHOULD/DEVRAIT”, “SHOULD NOT/NE DEVRAIT PAS”, “RECOMMENDED/RECOMMANDÉ”, “MAY/POURRAIT”, et “OPTIONAL/OPTIONNEL” dans ce document doivent être interprétés comme défini dans les références BCP 14 [RFC 2119] et [RFC 8174]] uniquement lorsqu’ils apparaissent en majuscules, comme ci-dessus.

1.3 Abréviation des espaces de noms

Les abréviations suivantes d’espace de noms sont utilisées dans ce document :

abréviation	IRI
dwc:	http://rs.tdwg.org/dwc/terms/
dwciri:	http://rs.tdwg.org/dwc/iri/
dc:	http://purl.org/dc/elements/1.1/
dcterms:	http://purl.org/dc/terms/

2 Utilisation des termes

En raison des exigences de la Section 1.4.3 du Darwin Core RDF Guide, les termes de l’espace de noms dwciri: DOIVENT être utilisés avec des valeurs IRI. Les termes des espaces de noms dwc: et dc: sont généralement censés avoir des chaînes de caractères pour valeur. Les valeurs des termes de l’espace de noms dcterms: varient selon le terme. Pour plus de détails, voir la section 3 du Darwin Core RDF Guide.

3 Index des termes

3.1 Index par Noms des Termes

(Voir aussi 3.2 Index Par Labels)

Classes

Record level

Dublin Core legacy namespace

dc:language | dc:type

Dublin Core terms namespace

Agent

dwc:agentID | dwc:agentRemarks | dwc:agentType

Assertion

Bibliographic Resource

dwc:referenceID | dwc:referenceRemarks | dwc:referenceType

Event

Geological Context

Identification

Location

Material Entity

Material Sample

dwc:materialSampleID

Measurement or Fact

Media

no_terms_organized_in_class

Molecular Protocol

dwc:assayType | dwc:molecularProtocolID

Nucleotide Analysis

dwc:processedTotalReadCount | dwc:readCount

Nucleotide Sequence

dwc:nucleotideSequenceRemarks | dwc:sequence

Occurrence

Organism

Organism Interaction

dwc:organismInteractionDescription | dwc:organismInteractionID | dwc:organismInteractionType

Protocol

dwc:protocolDescription | dwc:protocolID | dwc:protocolReferences | dwc:protocolRemarks | dwc:protocolType

Provenance

ac:fundingAttribution | dwc:fundingAttributionID | dwc:projectID | dwc:projectTitle

Resource Relationship

Taxon

Usage Policy

no_terms_organized_in_class

IRI-value terms

3.2 Index par Labels

(Voir aussi 3.1 Index par la dénomination des termes)

Classes

Record level

Dublin Core legacy namespace

Language | Type

Dublin Core terms namespace

Agent

Agent ID | Agent Remarks | Agent Type

Assertion

Bibliographic Resource

Reference ID | Reference Remarks | Reference Type

Event

Geological Context

Identification

Location

Material Entity

Material Sample

Material Sample ID

Measurement or Fact

Media

no_terms_organized_in_class

Molecular Protocol

Assay Type | Molecular Protocol ID

Nucleotide Analysis

Processed Total Read Count | Read Count

Nucleotide Sequence

Nucleotide Sequence Remarks | Sequence

Occurrence

Organism

Organism Interaction

Organism Interaction Description | Organism Interaction ID | Organism Interaction Type

Protocol

Protocol Description | Protocol ID | Protocol References | Protocol Remarks | Protocol Type

Provenance

Funding Attribution | Funding Attribution ID | Project ID | Project Title

Resource Relationship

Taxon

Usage Policy

no_terms_organized_in_class

IRI-value terms

4 Vocabulaire

Nom du Terme dwc:acceptedNameUsage
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsage-2025-06-12
Label	Usage du nom accepté
Définition	Le nom complet, avec les informations relatives à l'auteur et à la date si elles sont connues, du dwc:Taxon actuellement considéré valide (en zoologie) ou accepté (en botanique).
Notes	Le nom scientifique complet, avec les informations sur l'auteur et la date si elles sont connues, du nom accepté (botanique) ou valide (zoologie) dans les cas où le dwc:scientificName fourni est considéré par la référence indiquée dans la propriété dwc:nameAccordingTo, ou par le fournisseur de données comme un synonyme ou un nom mal appliqué. Lorsqu'il est appliqué à un dwc:Organism ou à une dwc:Occurrence, ce terme doit être utilisé dans les cas où un fournisseur de données considère que le dwc:scientificName fourni n'est pas cohérent avec l'opinion taxonomique du fournisseur de données. Par exemple, il existe de nombreuses divergences dans les collections et les ensembles de données d'observation entre le nom indiqué (par exemple, l'identification la plus récente d'un expert qui a examiné un spécimen, ou une identification sur le terrain pour un dwc:Organism observé) et le nom avancé par le fournisseur de données comme étant valable sur le plan taxonomique.
Exemples	`Tamias minimus` (nom valide pour `Eutamias minimus`)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:acceptedNameUsageID
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsageID-2023-06-28
Label	Identifiant de l'usage du nom accepté
Définition	Un identifiant pour l'usage du nom (signification documentée du nom selon une source) du taxon actuellement valide (zoologie) ou accepté (botanique).
Notes	Ce terme devrait être utilisé pour les synonymes ou les noms mal appliqués pour se référer au dwc:taxonID d'un enregistrement dwc:Taxon qui représente le nom accepté (botanique) ou valide (zoologie). Pour les Archives Darwin Core, l'enregistrement correspondant doit être présent dans la même archive.
Exemples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:acceptedScientificName
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedScientificName
Modifié	2009-09-21
Label	Accepted Scientific Name
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Définition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:acceptedScientificNameID
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Modifié	2009-08-24
Label	Accepted Scientific Name ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Définition	A unique identifier for the acceptedScientificName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:AcceptedTaxon
IRI du terme	http://rs.tdwg.org/dwc/terms/AcceptedTaxon
Modifié	2009-04-24
Label	Accepted Taxon
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Définition	The currently valid (zoological) or accepted (botanical) name for the ScientificName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:AcceptedTaxonID
IRI du terme	http://rs.tdwg.org/dwc/terms/AcceptedTaxonID
Modifié	2009-04-24
Label	Accepted Taxon ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Définition	A global unique identifier for the parent to the AcceptedTaxon.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:acceptedTaxonID
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Modifié	2009-09-21
Label	Accepted Taxon ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Définition	An identifier for the name of the currently valid (zoological) or accepted (botanical) taxon. See acceptedTaxon.
Notes	Example: "8fa58e08-08de-4ac1-b69c-1235340b7001"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:acceptedTaxonName
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Modifié	2009-07-06
Label	Accepted Taxon Name
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedScientificName
Définition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:acceptedTaxonNameID
IRI du terme	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Modifié	2009-07-06
Label	Accepted Taxon Name ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Définition	A unique identifier for the acceptedTaxonName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:AccessConstraints
IRI du terme	http://rs.tdwg.org/dwc/terms/AccessConstraints
Modifié	2009-09-21
Label	Access Constraints
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://purl.org/dc/terms/accessRights
Définition	A description of constraints on the use of the data as shared or access to further data that is not shared.
Notes	Example: "not-for-profit use only".
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/IPRStatements
Type	Propriété

Nom du Terme dcterms:accessRights
IRI du terme	http://purl.org/dc/terms/accessRights
Modifié	2023-06-28
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#accessRights-002
Label	Droits d'accès
Définition	Informations sur les personnes autorisées à accéder à la ressource ou indication de son statut de sécurité.
Notes	Les droits d'accès peuvent inclure des informations concernant l'accès ou les restrictions basées sur la confidentialité, la sécurité ou d'autres politiques.
Exemples	`not-for-profit use only` (exemple littéral) `https://www.fieldmuseum.org/field-museum-natural-history-conditions-and-suggested-norms-use-collections-data-and-images` (exemple d'URI)
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:accordingTo
IRI du terme	http://rs.tdwg.org/dwc/terms/accordingTo
Modifié	2020-08-06
Label	According To
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Abstract term to attribute information to a source.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:accuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/accuracy
Modifié	2009-04-24
Label	Accuracy
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Abstract term to capture error information about a measurement or fact.
Équivalent dans ABCD	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété

Nom du Terme dcterms:Agent
IRI du terme	http://purl.org/dc/terms/Agent
Modifié	2026-05-26
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#Agent-001
Label	Agent
Définition	A resource that acts or has the power to act.
Notes	A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
Exemples	`a person` `a team of participants on an expedition` `a funding agency` `a particular bioacoustic monitoring installation` `a software instance` `a particular camera trap`
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:agentID
IRI du terme	http://rs.tdwg.org/dwc/terms/agentID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/agentID-2026-05-26
Label	Agent ID
Définition	An identifier for a dcterms:Agent.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:agentRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/agentRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/agentRemarks-2026-05-26
Label	Agent Remarks
Définition	Comments or notes about a dcterms:Agent.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:agentRoleOrder
IRI du terme	http://rs.tdwg.org/dwc/terms/agentRoleOrder
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/agentRoleOrder-2026-05-26
Label	Agent Role Order
Définition	A numerical position of an AgentRole in a set of AgentRoles.
Notes	One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
Exemples	`1` `2`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:agentType
IRI du terme	http://rs.tdwg.org/dwc/terms/agentType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/agentType-2026-05-26
Label	Agent Type
Définition	A category that best matches the nature of a dcterms:Agent.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`person` `group` `organization` `camera`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:assayType
IRI du terme	http://rs.tdwg.org/dwc/iri/assayType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/assayType-2026-05-26
Label	Assay Type (IRI)
Définition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assayType
IRI du terme	http://rs.tdwg.org/dwc/terms/assayType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assayType-2026-05-26
Label	Assay Type
Définition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`targeted` `metabarcoding` `other`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Assertion
IRI du terme	http://rs.tdwg.org/dwc/terms/Assertion
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Assertion-2026-05-26
Label	Assertion
Définition	A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Les ressources peuvent être considérées comme des enregistrements identifiables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc : GeologicalContext, dwc:Identification, ou dwc:Taxon.
Exemples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
Équivalent dans ABCD	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:assertionBy
IRI du terme	http://rs.tdwg.org/dwc/iri/assertionBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/assertionBy-2026-05-26
Label	Assertion By (IRI)
Définition	An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionBy
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionBy-2026-05-26
Label	Assertion By
Définition	A name for a dcterms:Agent responsible for making a dwc:Assertion.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey` `ChatGPT` `Notes From Nature` `ROV SuBastian`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionEffectiveDate
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionEffectiveDate-2026-05-26
Label	Assertion Effective Date
Définition	A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionError
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionError
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionError-2026-05-26
Label	Assertion Error
Définition	A description of the potential error associated with a dwc:assertionValue.
Exemples	`0.01` `normal distribution with variation of 2 m`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionID
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionID-2026-05-26
Label	Assertion ID
Définition	An identifier for a dwc:Assertion.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionMadeDate
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionMadeDate
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionMadeDate-2026-05-26
Label	Assertion Made Date
Définition	A date on which a dwc:Assertion was created.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionProtocols
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionProtocols
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionProtocols-2026-05-26
Label	Assertion Protocols
Définition	Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
Équivalent dans ABCD	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionReferences
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionReferences
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionReferences-2026-05-26
Label	Assertion References
Définition	A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
Notes	La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionRemarks-2026-05-26
Label	Assertion Remarks
Définition	Comments or notes about a dwc:Assertion.
Exemples	`tip of tail missing` `error determined by independently calibrated measurements` `error provided is from the manufacturer’s standard instrument specification`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:assertionType
IRI du terme	http://rs.tdwg.org/dwc/iri/assertionType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/assertionType-2026-05-26
Label	Assertion Type (IRI)
Définition	A category that best matches the nature of a dwc:Assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionType
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionType-2026-05-26
Label	Assertion Type
Définition	A category that best matches the nature of a dwc:Assertion.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`tailLength` `waterTemperature` `trapLineLength` `surveyArea` `trapType`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:assertionUnit
IRI du terme	http://rs.tdwg.org/dwc/iri/assertionUnit
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/assertionUnit-2026-05-26
Label	Assertion Unit (IRI)
Définition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://www.ontology-of-units-of-measure.org/resource/om-2/metre` `http://www.ontology-of-units-of-measure.org/resource/om-2/second-Time`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionUnit
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionUnit-2026-05-26
Label	Assertion Unit
Définition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`m` `s` `g` `ml` `%` `individuals`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:assertionValue
IRI du terme	http://rs.tdwg.org/dwc/terms/assertionValue
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/assertionValue-2026-05-26
Label	Assertion Value
Définition	An asserted value.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`45` `20` `1` `14.5` `UV-light` `Hamon grab`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:assertionValue
IRI du terme	http://rs.tdwg.org/dwc/iri/assertionValue
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/assertionValue-2026-05-26
Label	Assertion Value (IRI)
Définition	An asserted value.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:associatedMedia
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedMedia
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedMedia-2023-06-28
Label	Média associé
Définition	Une liste (concaténée et séparée) d'identifiants (publication, identifiant unique global (GUI), URI) des médias associés à la dwc:Occurrence.
Exemples	`https://arctos.database.museum/media/10520962 \| https://arctos.database.museum/media/10520964`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MultimediaObjects
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:associatedOccurrences
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedOccurrences
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedOccurrences-2023-06-28
Label	Occurrences associées
Définition	Une liste (concaténée et séparée) d'identifiants d'autres enregistrements de dwc:Occurrence et de leurs associations à cette dwc:Occurrence.
Notes	Ce terme peut être utilisé pour fournir une liste d'associations avec d'autres dwc:Occurrences. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`"parasite collected from":"https://arctos.database.museum/guid/MSB:Mamm:215895?seid=950760"` `"encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3175067" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177393" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177394" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177392" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3609139"`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:associatedOrganisms
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedOrganisms
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedOrganisms-2023-06-28
Label	Organismes associés
Définition	Une liste (concaténée et séparée) d'identifiants d'autres dwc:Organisms et les associations de cet dwc:Organism à chacun d'entre eux.
Notes	Ce terme peut être utilisé pour fournir une liste d'associations avec d'autres dwc:Organisms. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`"sibling of":"http://arctos.database.museum/guid/DMNS:Mamm:14171"` `"parent of":"http://arctos.database.museum/guid/MSB:Mamm:196208" \| "parent of":"http://arctos.database.museum/guid/MSB:Mamm:196523" \| "sibling of":"http://arctos.database.museum/guid/MSB:Mamm:142638"`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Nom du Terme dwc:associatedReferences
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedReferences
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedReferences-2023-06-28
Label	Références associées
Définition	Une liste (concaténée et séparée) d'identifiants (publication, référence bibliographique, identifiant unique global (GUI), URI) de la littérature associée à la dwc:Occurrence.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. Notez également que l'usage prévu du terme dcterms:references dans le Darwin Core, lorsqu'il est appliqué à une dwc:Occurrence, est de pointer vers la source originale de cette dwc:Occurrence s'il y en a une. Notez également que l'usage prévu du terme dcterms:bibliographicCitation dans le Darwin Core lorsqu'il est appliqué à une dwc:Occurrence est de fournir la manière optimale de citer la dwc:Occurrence elle-même.
Exemples	`http://www.sciencemag.org/cgi/content/abstract/322/5899/261` `Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/UnitReferences
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:associatedSequences
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedSequences
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedSequences-2026-05-26
Label	Séquences associées
Définition	A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity.
Exemples	`http://www.ncbi.nlm.nih.gov/nuccore/U34853.1` `http://www.ncbi.nlm.nih.gov/nuccore/GU328060 \| http://www.ncbi.nlm.nih.gov/nuccore/AF326093`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Sequences/Sequence/ID-in-Database + constant
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:associatedTaxa
IRI du terme	http://rs.tdwg.org/dwc/terms/associatedTaxa
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/associatedTaxa-2023-06-28
Label	Taxons associés
Définition	Une liste (concaténée et séparée) d'identifiants ou des noms des enregistrements de dwc:Taxon et les associations de cette dwc:Occurrence à chacun d'entre eux.
Notes	Ce terme peut être utilisé pour fournir une liste d'associations à des enregistrements de dwc:Taxon autres que celles définies dans dwc:Occurrence. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. Ce terme ne convient pas pour établir des relations entre des enregistrements de dwc:Taxon, mais seulement entre des dwc:Occurrences spécifiques d'un dwc:Organisme et d'autres enregistrements de dwc:Taxon. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`"host":"Quercus alba"` `"host":"gbif.org/species/2879737"` `"parasitoid of":"Cyclocephala signaticollis" \| "predator of":"Apis mellifera"`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:basionym
IRI du terme	http://rs.tdwg.org/dwc/terms/basionym
Modifié	2009-09-21
Label	Basionym
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/originalNameUsage
Définition	The basionym (botany) or basonym (bacteriology) of the scientificName.
Notes	Example: "Pinus abies"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:basionymID
IRI du terme	http://rs.tdwg.org/dwc/terms/basionymID
Modifié	2009-09-21
Label	Basionym ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/originalNameUsageID
Définition	A unique identifier for the basionym (botany) or basonym (bacteriology) of the scientificName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:basisOfRecord
IRI du terme	http://rs.tdwg.org/dwc/terms/basisOfRecord
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/basisOfRecord-2023-09-13
Label	Catégorie d'enregistrement
Définition	La nature précise de l'enregistrement.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que l'ensemble des noms locaux des identifiants de classes du Darwin Core.
Exemples	`MaterialEntity` `PreservedSpecimen` `FossilSpecimen` `LivingSpecimen` `MaterialSample` `Event` `HumanObservation` `MachineObservation` `Taxon` `Occurrence` `MaterialCitation`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/RecordBasis
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2009-12-07_2
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:bed
IRI du terme	http://rs.tdwg.org/dwc/terms/bed
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/bed-2023-09-13
Label	Lit
Définition	Le nom complet du lit lithostratigraphique à partir de laquelle l'entité dwc:MaterialEntity a été collectée.
Exemples	`Harlem coal`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:behavior
IRI du terme	http://rs.tdwg.org/dwc/terms/behavior
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/behavior-2026-05-26
Label	Comportement
Définition	A behavior shown by a dwc:Organism.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`roosting` `foraging` `running`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:behavior
IRI du terme	http://rs.tdwg.org/dwc/iri/behavior
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/behavior-2026-05-26
Label	Behavior (IRI)
Définition	A behavior shown by a dwc:Organism.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dcterms:bibliographicCitation
IRI du terme	http://purl.org/dc/terms/bibliographicCitation
Modifié	2023-06-28
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#bibliographicCitation-002
Label	Référence Bibliographique
Définition	Une référence bibliographique pour la ressource.
Notes	D'après le Dublin Core, « la pratique recommandée est d'inclure suffisamment de détails bibliographiques pour identifier la ressource de la manière la moins ambiguë possible ». L'usage prévu de ce terme dans le Darwin Core est de fournir la méthode privilégiée pour citer la ressource elle-même - « comment citer cet enregistrement ». Notez que l'usage prévu de dcterms:references dans le Darwin Core, par contre, est de pointer vers la représentation de la source définitive de la ressource - « où trouver la référence la plus proche de l'original », s'il y en a une.
Exemples	`Museum of Vertebrate Zoology, UC Berkeley. MVZ Mammal Collection (Arctos). Record ID: http://arctos.database.museum/guid/MVZ:Mamm:165861?seid=101356. Source: http://ipt.vertnet.org:8080/ipt/resource.do?r=mvz_mammal.` (exemple d'Occurence) `https://www.gbif.org/species/2439608 Source: GBIF Taxonomic Backbone` (exemple de Taxon) `Rand, K.M., Logerwell, E.A. The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s. Polar Biol 34, 475–488 (2011). https://doi.org/10.1007/s00300-010-0900-2` (exemple d'Event)
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dcterms:BibliographicResource
IRI du terme	http://purl.org/dc/terms/BibliographicResource
Modifié	2026-05-26
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#BibliographicResource-001
Label	Bibliographic Resource
Définition	A book, article, or other documentary resource.
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:binomial
IRI du terme	http://rs.tdwg.org/dwc/terms/binomial
Modifié	2009-04-24
Label	Binomial
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The combination of genus and first (species) epithet of the scientificName.
Notes	Example: "Ctenomys sociabilis"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa/TaxonIdentified/ScientificName/FullScientificNameString
Type	Propriété

Nom du Terme dwciri:caste
IRI du terme	http://rs.tdwg.org/dwc/iri/caste
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/caste-2026-05-26
Label	Caste (IRI)
Définition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:caste
IRI du terme	http://rs.tdwg.org/dwc/terms/caste
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/caste-2026-05-26
Label	Caste
Définition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`queen` `male alate` `intercaste` `minor worker` `soldier` `ergatoid`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:catalogNumber
IRI du terme	http://rs.tdwg.org/dwc/terms/catalogNumber
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/catalogNumber-2026-05-26
Label	Numéro de catalogue
Définition	An identifier (preferably unique) for a resource within a collection.
Exemples	`145732` `145732a` `2008.1334` `R-4313`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/UnitID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:CatalogNumberNumeric
IRI du terme	http://rs.tdwg.org/dwc/terms/CatalogNumberNumeric
Modifié	2009-04-24
Label	Catalog Number Numeric
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The numeric value of the catalogNumber, used to facilitate numerical sorting and searching by ranges.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/UnitIDNumeric
Type	Propriété

Nom du Terme dwc:causeOfDeath
IRI du terme	http://rs.tdwg.org/dwc/terms/causeOfDeath
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/causeOfDeath-2025-06-12
Label	Cause de la Mort
Définition	Une indication de la cause connue ou supposée de la mort d'un dwc:Organism.
Notes	La cause peut être naturelle (par exemple, maladie, prédation), liée à des activités humaines (par exemple, animaux tués sur la route, pollution) ou à d'autres facteurs environnementaux (par exemple, phénomènes météorologiques extrêmes).
Exemples	`trap` `poison` `starvation` `drowning` `shooting` `old age` `vehicle collision` `disease` `herbicide` `burning` `infanticide`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:class
IRI du terme	http://rs.tdwg.org/dwc/terms/class
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/class-2023-06-28
Label	Classe
Définition	Le nom scientifique complet de la classe dans laquelle le dwc:Taxon est classé.
Exemples	`Mammalia` `Hepaticopsida`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = classis
Type	Propriété

Nom du Terme dwc:collectionCode
IRI du terme	http://rs.tdwg.org/dwc/terms/collectionCode
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/collectionCode-2026-05-26
Label	Code de la collection
Définition	A name, acronym, coden, or initialism identifying a collection.
Exemples	`Mammals` `Hildebrandt` `EBIRD` `VP`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SourceID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:collectionID
IRI du terme	http://rs.tdwg.org/dwc/terms/collectionID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/collectionID-2026-05-26
Label	Identifiant de la collection
Définition	An identifier for a collection.
Notes	Pour les spécimens physiques, la pratique optimale recommandée est d'utiliser un identifiant unique et résoluble à l'échelle mondiale provenant d'un registre de collections tel que le Global Registry of Scientific Collections (https://scientific-collections.gbif.org).
Exemples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SourceID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:continent
IRI du terme	http://rs.tdwg.org/dwc/terms/continent
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/continent-2023-06-28
Label	Continent
Définition	Le nom du continent dans lequel se trouve la dcterms:Location.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux.
Exemples	`Africa` `Antarctica` `Asia` `Europe` `North America` `Oceania` `South America`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Continent
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:coordinatePrecision
IRI du terme	http://rs.tdwg.org/dwc/terms/coordinatePrecision
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/coordinatePrecision-2023-06-28
Label	Précision des coordonnées
Définition	Une représentation décimale de la précision des coordonnées données dans dwc:decimalLatitude et dwc:decimalLongitude.
Exemples	`0.00001` (limite normale des GPS pour les degrés décimaux) `0.000278` (seconde la plus proche) `0.01667` (minute la plus proche) `1.0` (degré le plus proche)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/ISOAccuracy or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/AccuracyStatement
Type	Propriété

Nom du Terme dwc:coordinateUncertaintyInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/coordinateUncertaintyInMeters-2026-05-26
Label	Incertitude des coordonnées en mètres
Définition	A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term.
Notes	Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Exemples	`30` (limite inférieure raisonnable à partir du 2000-05-01 d'un relevé GPS dans de bonnes conditions si la précision réelle n'a pas été enregistrée à ce moment-là) `100` (limite inférieure raisonnable jusqu'au 2000-05-01 d'un relevé GPS dans de bonnes conditions si la précision réelle n'a pas été enregistrée à ce moment-là) `71` (incertitude pour une coordonnée UTM ayant une précision de 100 mètres et un système de référence spatial connu)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinateErrorDistanceInMeters
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:country
IRI du terme	http://rs.tdwg.org/dwc/terms/country
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/country-2023-06-28
Label	Pays
Définition	Le nom du pays ou de l'unité administrative principale dans lesquels se trouve la dcterms:Location.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux.
Exemples	`Denmark` `Colombia` `España`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Country/Name
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:countryCode
IRI du terme	http://rs.tdwg.org/dwc/terms/countryCode
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/countryCode-2026-05-26
Label	Code du pays
Définition	Le code standardisé du pays dans lequel se trouve la dcterms:Location.
Notes	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Exemples	`AR` `SV` `XZ` `ZZ`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Country/ISO3166Code
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:county
IRI du terme	http://rs.tdwg.org/dwc/terms/county
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/county-2023-06-28
Label	Division de deuxième ordre
Définition	Le nom complet et non abrégé de la région administrative immédiatement inférieure à stateProvince (comté, département, etc.) dans laquelle se trouve la dcterms:Location.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux.
Exemples	`Missoula` `Los Lagos` `Mataró`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= County
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:cultivarEpithet
IRI du terme	http://rs.tdwg.org/dwc/terms/cultivarEpithet
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/cultivarEpithet-2026-05-26
Label	Épithète de cultivar
Définition	Partie du nom d'un cultivar, d'un groupe de cultivars ou d'un grex qui suit le dwc:scientificName.
Notes	According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
Exemples	`King Edward` (pour le nom scientifique `Solanum tuberosum 'King Edward'` et le taxonRank `cultivar`) `Mishmiense` (pour le scientificName `Rhododendron boothii Mishmiense Group` et le taxonRank `cultivar group`) `Atlantis` (pour le scientificName `Paphiopedilum Atlantis grex` et le taxonRank `grex`)
Équivalent dans ABCD	http://rs.tdwg.org/abcd/terms/cultivarName or http://rs.tdwg.org/abcd/terms/cultivarGroupName or http://rs.tdwg.org/abcd/terms/breed (ABCD 3.0)
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:dataGeneralizations
IRI du terme	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/dataGeneralizations-2023-06-28
Label	Généralisation des données
Définition	Mesures prises pour rendre les données partagées moins précises ou moins complètes que dans leur forme originale. Cela peut signifier que des données de meilleure qualité peuvent être disponibles sur demande.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Coordinates generalized from original GPS coordinates to the nearest half degree grid cell`.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:dataGeneralizations
IRI du terme	http://rs.tdwg.org/dwc/iri/dataGeneralizations
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/dataGeneralizations-2025-07-10
Label	Data Generalizations (IRI)
Définition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:Dataset
IRI du terme	http://rs.tdwg.org/dwc/terms/Dataset
Modifié	2009-09-11
Label	Dataset
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The category of information pertaining to a logical set of records.
Équivalent dans ABCD	DataSets/DataSet
Type	Classe

Nom du Terme dwc:datasetID
IRI du terme	http://rs.tdwg.org/dwc/terms/datasetID
Modifié	2017-10-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/datasetID-2017-10-06
Label	Identifiant du jeu de données
Définition	Un identifiant pour le jeu de données. Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à une collection ou à une institution.
Exemples	`b15d4952-7d20-46f1-8a3e-556a512b04c5`
Équivalent dans ABCD	DataSets/DataSet/DataSetGUID
Type	Propriété

Nom du Terme dwc:datasetName
IRI du terme	http://rs.tdwg.org/dwc/terms/datasetName
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/datasetName-2026-05-26
Label	Nom du jeu de données
Définition	A name of a source dataset.
Exemples	`Grinnell Resurvey Mammals` `Lacey Ctenomys Recaptures`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SourceID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:dateIdentified
IRI du terme	http://rs.tdwg.org/dwc/terms/dateIdentified
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/dateIdentified-2025-06-12
Label	Date d'identification
Définition	Date à laquelle le sujet a été identifié comme appartenant au dwc:Taxon.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Date/DateText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:day
IRI du terme	http://rs.tdwg.org/dwc/terms/day
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/day-2023-06-28
Label	Jour
Définition	Le jour (nombre entier) du mois au cours duquel le dwc:Event s'est produit.
Exemples	`9` `28`
Équivalent dans ABCD	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Propriété

Nom du Terme dwc:decimalLatitude
IRI du terme	http://rs.tdwg.org/dwc/terms/decimalLatitude
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/decimalLatitude-2026-05-26
Label	Latitude en échelle décimale
Définition	A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
Exemples	`-41.0983423`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LatitudeDecimal
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:decimalLongitude
IRI du terme	http://rs.tdwg.org/dwc/terms/decimalLongitude
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/decimalLongitude-2026-05-26
Label	Longitude en échelle décimale
Définition	A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
Exemples	`-121.1761111`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LongitudeDecimal
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:degreeOfEstablishment
IRI du terme	http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/degreeOfEstablishment-2023-06-28
Label	Degré d'implantation
Définition	Le degré de survie, de reproduction et d'expansion de l'aire de répartition d'un dwc:Organism à un endroit et à un moment donnés.
Notes	La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/doe/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`native` `captive` `cultivated` `released` `failing` `casual` `reproducing` `established` `colonising` `invasive` `widespreadInvasive`
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_27
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:degreeOfEstablishment
IRI du terme	http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/degreeOfEstablishment-2025-07-10
Label	Degree of Establishment (IRI)
Définition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://rs.tdwg.org/dwcdoe/values/d003` `http://rs.tdwg.org/dwcdoe/values/d005`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_27
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:digitalSpecimenID
IRI du terme	http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/digitalSpecimenID-2026-05-26
Label	Digital Specimen ID
Définition	An identifier for a Digital Specimen resource.
Notes	Un Spécimen Numérique est défini à l'adresse https://doi.org/10.3897/rio.7.e67379. Un dwc:digitalSpecimenID est destiné à identifier de manière unique et permanente un spécimen numérique. La pratique optimale recommandée est d'utiliser un DOI avec des métadonnées interprétables par une machine dans l'enregistrement DOI qui utilise un profil de métadonnées convenu par la communauté (également connu sous le nom de profil FDO) pour un spécimen numérique. Pour un exemple, voir : https://doi.org/10.3535/N75-CR4-0SM?noredirect. L'identifiant est celui d'un artefact d'information numérique (le Spécimen Numérique) et non celui d'une instance spécifique d'une dwc:MaterialEntity.
Exemples	`https://doi.org/10.3535/M42-Z4P-DRD` `https://doi.org/10.3535/M42-Z4P-DRD?urlappend=/1` `https://doi.org/10.3535/M42-Z4P-DRD?locatt=/1` `doi:10.3535/M42-Z4P-DRD`
Équivalent dans ABCD	Note: /DataSets/DataSet/Units/Unit/UnitGUID could be used. A new term /DataSets/DataSet/Units/Unit/SpecimenUnit/digitalSpecimenID would make it distinguishable from URIs that identify the physical object or catalogue record.
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:discipline
IRI du terme	http://rs.tdwg.org/dwc/iri/discipline
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/discipline-2025-06-12
Label	Discipline (IRI)
Définition	The primary branch or branches of knowledge represented by the record.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:discipline
IRI du terme	http://rs.tdwg.org/dwc/terms/discipline
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/discipline-2026-05-26
Label	Discipline
Définition	The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( `\|` ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`Botany` `Botany \| Virology \| Taxonomy`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:disposition
IRI du terme	http://rs.tdwg.org/dwc/iri/disposition
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/disposition-2026-05-26
Label	Disposition (IRI)
Définition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:disposition
IRI du terme	http://rs.tdwg.org/dwc/terms/disposition
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/disposition-2026-05-26
Label	Mise à disposition
Définition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`in collection` `missing` `on loan` `used up` `destroyed` `deaccessioned`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/Disposition
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:DwCType
IRI du terme	http://rs.tdwg.org/dwc/terms/DwCType
Modifié	2014-10-23
Label	Darwin Core Type
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The set of classes specified by the Darwin Core Type Vocabulary, used to categorize the nature or genre of the resource.
Équivalent dans ABCD	not in ABCD
Type	http://purl.org/dc/dcam/VocabularyEncodingScheme

Nom du Terme dwc:dynamicProperties
IRI du terme	http://rs.tdwg.org/dwc/terms/dynamicProperties
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/dynamicProperties-2023-06-28
Label	Propriétés dynamiques
Définition	Une liste de mesures, de faits, de caractéristiques ou d'affirmations supplémentaires concernant le document. Il s'agit d'un mécanisme permettant de structurer le contenu.
Notes	La pratique optimale recommandée est d'utiliser un encodage clé:valeur pour un format d'échange de données tel que JSON.
Exemples	`{"heightInMeters":1.5}` `{"targusLengthInMeters":0.014, "weightInGrams":120}` `{"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}` `{"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}` `{"aspectHeading":277, "slopeInDegrees":6}` `{"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:earliestAgeOrLowestStage
IRI du terme	http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/earliestAgeOrLowestStage-2023-09-13
Label	Âge le plus ancien ou étage inférieur
Définition	Le nom complet de l'âge géochronologique le plus ancien possible ou de l'étage chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Atlantic` `Boreal` `Skullrockian`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:EarliestDateCollected
IRI du terme	http://rs.tdwg.org/dwc/terms/EarliestDateCollected
Modifié	2009-04-24
Label	Earliest Date Collected
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventDate
Définition	The earliest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Propriété

Nom du Terme dwc:earliestEonOrLowestEonothem
IRI du terme	http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/earliestEonOrLowestEonothem-2026-05-26
Label	Éon le plus ancien ou éonothème inférieur
Définition	The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Exemples	`Phanerozoic` `Proterozoic` `Precambrian`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:earliestEpochOrLowestSeries
IRI du terme	http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/earliestEpochOrLowestSeries-2023-09-13
Label	Époque la plus ancienne ou série la plus basse
Définition	Le nom complet de l'époque géochronologique la plus ancienne possible ou de la série chronostratigraphique la plus basse attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Holocene` `Pleistocene` `Ibexian Series`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:earliestEraOrLowestErathem
IRI du terme	http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/earliestEraOrLowestErathem-2023-09-13
Label	Ère la plus ancienne ou érathème inférieur
Définition	Le nom complet de l'ère géochronologique potentielle la plus ancienne ou de l'érythème chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée.
Exemples	`Cenozoic` `Mesozoic`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:earliestGeochronologicalEra
IRI du terme	http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/earliestGeochronologicalEra-2023-09-13
Label	Earliest Geochronological Era
Définition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:earliestPeriodOrLowestSystem
IRI du terme	http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/earliestPeriodOrLowestSystem-2023-09-13
Label	Première période ou système inférieur
Définition	Le nom complet de la période géochronologique la plus ancienne possible ou du système chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée.
Exemples	`Neogene` `Tertiary` `Quaternary`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:endDayOfYear
IRI du terme	http://rs.tdwg.org/dwc/terms/endDayOfYear
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/endDayOfYear-2026-05-26
Label	Numéro du jour de fin
Définition	The latest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Exemples	`1` (1er janvier) `32` (1er février) `366` (31 décembre) `365` (30 décembre d'une année bissextile, 31 décembre d'une année commune)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberEnd
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:EndTimeOfDay
IRI du terme	http://rs.tdwg.org/dwc/terms/EndTimeOfDay
Modifié	2009-04-24
Label	End Time of Day
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventTime
Définition	The time of day when the event ended, expressed as decimal hours from midnight, local time.
Notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/DateTime/TimeOfDayEnd
Type	Propriété

Nom du Terme dwciri:establishmentMeans
IRI du terme	http://rs.tdwg.org/dwc/iri/establishmentMeans
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/establishmentMeans-2025-07-10
Label	Establishment Means (IRI)
Définition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_25
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:establishmentMeans
IRI du terme	http://rs.tdwg.org/dwc/terms/establishmentMeans
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/establishmentMeans-2026-05-26
Label	Moyens d'implantation
Définition	Indication selon laquelle un dwc:Organism a été introduit en un lieu et à un moment donnés par l'activité directe ou indirecte de l'humain moderne.
Notes	La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/em/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`native` `nativeEndemic` `nativeReintroduced` `introduced` `introducedAssistedColonisation` `vagrant` `uncertain`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/EstablishmentMeans
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_25
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Event
IRI du terme	http://rs.tdwg.org/dwc/terms/Event
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Event-2026-05-26
Label	Événement
Définition	An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
Exemples	`a material collecting event` `a bird observation` `a camera trap image capture` `an organism occurrence` `a biotic survey`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:EventAttribute
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttribute
Modifié	2009-04-24
Label	Event Attribute
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Container class for information about attributes related to a given sampling event.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Classe

Nom du Terme dwc:EventAttributeAccuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeAccuracy
Modifié	2009-04-24
Label	Event Attribute Accuracy
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Définition	The description of the error associated with the EventAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
Équivalent dans ABCD	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété

Nom du Terme dwc:EventAttributeDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedBy
Modifié	2009-04-24
Label	Event Attribute Determined By
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Définition	The agent responsible for having determined the value of the measurement or characteristic of the sampling event.
Notes	Example: "Robert Hijmans"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété

Nom du Terme dwc:EventAttributeDeterminedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedDate
Modifié	2009-04-24
Label	Event Attribute Determined Date
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Définition	The date on which the the measurement or characteristic of the sampling event was made.
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété

Nom du Terme dwc:EventAttributeID
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeID
Modifié	2009-04-24
Label	Event Attribute ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementID
Définition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:EventAttributeRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeRemarks
Modifié	2009-04-24
Label	Event Attribute Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Comments or notes accompanying the measurement or characteristic of the sampling event.
Notes	Example: "temperature taken at 15:00"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:eventAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/eventAttributes
Modifié	2009-10-09
Label	Event Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements or characteristics of the Event.
Notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Propriété

Nom du Terme dwc:EventAttributeType
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeType
Modifié	2009-04-24
Label	Event Attribute Type
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementType
Est remplacé par	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Définition	The nature of the measurement or characteristic of the sampling event. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "Temperature"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété

Nom du Terme dwc:EventAttributeUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeUnit
Modifié	2009-04-24
Label	Event Attribute Unit
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Définition	The units for the value of the measurement or characteristic of the sampling event. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "C"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété

Nom du Terme dwc:EventAttributeValue
IRI du terme	http://rs.tdwg.org/dwc/terms/EventAttributeValue
Modifié	2009-04-24
Label	Event Attribute
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Définition	The value of the measurement or characteristic of the sampling event.
Notes	Example: "22"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Propriété

Nom du Terme dwciri:eventCategory
IRI du terme	http://rs.tdwg.org/dwc/iri/eventCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/eventCategory-2026-05-26
Label	Event Category (IRI)
Définition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:eventCategory
IRI du terme	http://rs.tdwg.org/dwc/terms/eventCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventCategory-2026-05-26
Label	Event Category
Définition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: `Event`, `MaterialGathering`, `Occurrence`, `OrganismInteraction`, or `Survey`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`Event` `MaterialGathering` `Occurrence` `OrganismInteraction` `Survey`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:eventDate
IRI du terme	http://rs.tdwg.org/dwc/terms/eventDate
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventDate-2026-05-26
Label	Date de l'événement
Définition	A date-time or time interval during which a dwc:Event occurred.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:eventID
IRI du terme	http://rs.tdwg.org/dwc/terms/eventID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventID-2023-06-28
Label	Identifiant de l'événement
Définition	Un identifiant pour l'ensemble des informations associées à un dwc:Event (quelque chose qui se produit à un endroit et à un temps donnés). Il peut s'agir d'un identifiant unique global ou d'un identifiant spécifique à un jeu de données.
Exemples	`INBO:VIS:Ev:00009375`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Propriété

Nom du Terme dwc:EventMeasurement
IRI du terme	http://rs.tdwg.org/dwc/terms/EventMeasurement
Modifié	2009-10-09
Label	Event Measurement
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Définition	The category of information pertaining to measurements associated with an event.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Classe

Nom du Terme dwc:eventMeasurementAccuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Modifié	2009-10-09
Label	Event Measurement Accuracy
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Définition	The description of the error associated with the EventAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
Équivalent dans ABCD	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété

Nom du Terme dwc:eventMeasurementDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Modifié	2009-10-09
Label	Event Measurement Determined By
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Définition	The agent responsible for having determined the value of the measurement or characteristic of the event.
Notes	Example: "Robert Hijmans"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété

Nom du Terme dwc:eventMeasurementDeterminedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Modifié	2009-10-09
Label	Event Measurement Determined Date
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Définition	The date on which the the measurement or characteristic of the event was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété

Nom du Terme dwc:eventMeasurementID
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementID
Modifié	2009-10-09
Label	Event Measurement ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementID
Définition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:eventMeasurementRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementRemarks
Modifié	2009-10-09
Label	Event Measurement Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementRemarks
Définition	Comments or notes accompanying the measurement or characteristic of the event.
Notes	Example: "temperature taken at 15:00"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:eventMeasurementType
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementType
Modifié	2009-10-09
Label	Event Measurement Type
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementType
Définition	The nature of the measurement or characteristic of the event. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "temperature"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété

Nom du Terme dwc:eventMeasurementUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Modifié	2009-10-09
Label	Event Measurement Unit
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementUnit
Définition	The units for the value of the measurement or characteristic of the event. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "C"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété

Nom du Terme dwc:eventMeasurementValue
IRI du terme	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Modifié	2009-10-09
Label	Event Measurement Value
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementValue
Définition	The value of the measurement or characteristic of the event.
Notes	Example: "22"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Propriété

Nom du Terme dwc:eventRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/eventRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventRemarks-2023-06-28
Label	Remarques sur l'événement
Définition	Commentaires ou notes sur le dwc:Event.
Exemples	`After the recent rains the river is nearly at flood stage.`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Notes
Type	Propriété

Nom du Terme dwc:eventTime
IRI du terme	http://rs.tdwg.org/dwc/terms/eventTime
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventTime-2025-06-12
Label	Heure de l'événement
Définition	Le moment ou l'intervalle de temps pendant lequel un dwc:Event s'est produit.
Notes	La pratique optimale recommandée est d'utiliser une heure conforme à la norme ISO 8601-1:2019.
Exemples	`14:07-06:00` (à ou après 14h07 et avant 14h08 dans le fuseau horaire six heures plus tôt que UTC) `08:40:21Z` (à ou après 8h40m21s et avant 8h41m22s UTC) `13:00:00Z/15:30:00Z` (à ou après 13h00 et avant 15h30 UTC)
Équivalent dans ABCD	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:eventType
IRI du terme	http://rs.tdwg.org/dwc/iri/eventType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/eventType-2026-05-26
Label	Event Type (IRI)
Définition	A narrow category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:eventType
IRI du terme	http://rs.tdwg.org/dwc/terms/eventType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/eventType-2026-05-26
Label	Type d'événement
Définition	A narrow category that best matches the nature of a dwc:Event.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`bioBlitz` `cameraTrapDeployment` `expedition` `project` `siteVisit` `trawl`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:family
IRI du terme	http://rs.tdwg.org/dwc/terms/family
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/family-2023-06-28
Label	Famille
Définition	Le nom scientifique complet de la famille dans laquelle le dwc:Taxon est classé.
Exemples	`Felidae` `Monocleaceae`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = familia
Type	Propriété

Nom du Terme dwc:feedbackURL
IRI du terme	http://rs.tdwg.org/dwc/terms/feedbackURL
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/feedbackURL-2025-06-12
Label	URL du Retour d'Information
Définition	Un localisateur de ressources uniforme (URL) qui pointe vers une page web sur laquelle un formulaire peut être soumis pour recueillir des commentaires sur l'enregistrement.
Notes	La pratique optimale recommandée est d'inclure facultativement des éléments de requête qui servent à pré-remplir les éléments du formulaire de la page web et à communiquer le contexte.
Exemples	`https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:fieldNotes
IRI du terme	http://rs.tdwg.org/dwc/iri/fieldNotes
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/fieldNotes-2023-06-28
Label	Field Notes (IRI)
Définition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes	The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:fieldNotes
IRI du terme	http://rs.tdwg.org/dwc/terms/fieldNotes
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/fieldNotes-2023-06-28
Label	Notes de terrain
Définition	L'un des éléments suivants : a) un indicateur de l'existence de, b) une référence à (publication, URI), ou c) les notes prises sur le terrain concernant le dwc:Event.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'une IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Notes available in the Grinnell-Miller Library.`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/FieldNotes
Type	Propriété

Nom du Terme dwc:fieldNumber
IRI du terme	http://rs.tdwg.org/dwc/terms/fieldNumber
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/fieldNumber-2026-05-26
Label	Numéro de terrain
Définition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`RV Sol 87-03-08`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:fieldNumber
IRI du terme	http://rs.tdwg.org/dwc/iri/fieldNumber
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/fieldNumber-2026-05-26
Label	Field Number (IRI)
Définition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:footprintSpatialFit
IRI du terme	http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/footprintSpatialFit-2026-05-26
Label	Ajustement de l'emprise au sol
Définition	A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Exemples	`0` `1` `1.5708`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/FootprintSpatialFit
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:footprintSRS
IRI du terme	http://rs.tdwg.org/dwc/terms/footprintSRS
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/footprintSRS-2025-06-12
Label	SRS de l'emprise au sol
Définition	L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel la géométrie donnée dans dwc:footprintWKT est basée.
Notes	La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur `not recorded` (non documenté). Il est également permis de fournir le SRS en Well-Known-Text, en particulier si aucun code EPSG ne fournit les valeurs nécessaires pour les attributs du SRS. N'utilisez pas ce terme pour décrire le SRS de dwc:decimalLatitude et de dwc:decimalLongitude, ni de coordonnées verbatim - utilisez plutôt dwc:geodeticDatum et dwc:verbatimSRS respectivement. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`EPSG:4326` `GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]]` (WKT pour le WGS84 Spatial Reference System EPSG:4326 standard) `not recorded`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:footprintSRS
IRI du terme	http://rs.tdwg.org/dwc/iri/footprintSRS
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/footprintSRS-2025-06-12
Label	Footprint SRS (IRI)
Définition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:footprintWKT
IRI du terme	http://rs.tdwg.org/dwc/terms/footprintWKT
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/footprintWKT-2026-05-26
Label	WKT de l'emprise au sol
Définition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Notes	A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Exemples	`POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))` (la délimitation d'un degré avec des coins opposés à longitude=10, latitude=20 et longitude=11, latitude=21)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/FootprintWKT (ABCD v2.06b)
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:footprintWKT
IRI du terme	http://rs.tdwg.org/dwc/iri/footprintWKT
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/footprintWKT-2025-07-10
Label	Footprint WKT (IRI)
Définition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:formation
IRI du terme	http://rs.tdwg.org/dwc/terms/formation
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/formation-2023-09-13
Label	Formation
Définition	Le nom complet de la formation lithostratigraphique à partir de laquelle la dwc:MaterialEntity a été collectée.
Exemples	`Notch Peak Formation` `House Limestone` `Fillmore Formation`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:FossilSpecimen
IRI du terme	http://rs.tdwg.org/dwc/terms/FossilSpecimen
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/FossilSpecimen-2023-09-18
Label	Spécimen fossile
Définition	Un spécimen fossile en collection .
Exemples	`a body fossil` `a coprolite` `a gastrolith` `an ichnofossil` `a piece of a petrified tree`
Équivalent dans ABCD	RecordBasisEnum/FossileSpecimen
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwciri:fromLithostratigraphicUnit
IRI du terme	http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/fromLithostratigraphicUnit-2015-03-27
Label	From Lithostratigraphic Unit
Définition	Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:fundingAttribution
IRI du terme	http://rs.tdwg.org/dwc/iri/fundingAttribution
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/fundingAttribution-2025-07-10
Label	Funding Attribution (IRI)
Définition	An organization or agency that provided funding for a project.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme ac:fundingAttribution
IRI du terme	http://rs.tdwg.org/ac/terms/fundingAttribution
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/ac/terms/version/fundingAttribution-2020-01-27
Label	Source du Financement
Définition	Description textuelle des organisations ou des personnes qui ont financé la création de la ressource.
Notes	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`Artsdatabanken` `National Science Foundation` `Norges forskningsråd` `Ocean Census \| Nippon Foundation`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:fundingAttributionID
IRI du terme	http://rs.tdwg.org/dwc/terms/fundingAttributionID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/fundingAttributionID-2026-05-26
Label	Identifiant de la Source du Financement
Définition	An identifier for a dcterms:Agent that financially supported a project.
Notes	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Generalizations
IRI du terme	http://rs.tdwg.org/dwc/terms/Generalizations
Modifié	2009-04-24
Label	Generalizations
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Définition	Actions taken to make the data as shared less specific or complete than in its original form. Suggests that alternative data of highly quality may be available on request.
Notes	Examples: "Coordinates generalized from original GPS coordinates to the nearest half degree grid cell", "locality information given only to nearest county".
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:genericName
IRI du terme	http://rs.tdwg.org/dwc/terms/genericName
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/genericName-2023-06-28
Label	Nom générique
Définition	La partie générique du dwc:scientificName sans l'autorité.
Notes	Pour les synonymes, le genre accepté et la partie générique du nom peuvent être différents. Le terme dwc:genericName doit être utilisé avec dwc:specificEpithet pour former un binôme et avec dwc:infraspecificEpithet pour former un trinôme. Le terme dwc:genericName ne doit être utilisé que pour les combinaisons. Les uninomiaux de rang genre n'ont pas de dwc:genericName.
Exemples	`Felis` (pour le nom scientifique `Felis concolor`, avec les valeurs associées de `Puma concolor` dans acceptedNameUsage et `Puma` dans genus)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:genus
IRI du terme	http://rs.tdwg.org/dwc/terms/genus
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/genus-2023-06-28
Label	Genre
Définition	Le nom scientifique complet du genre dans lequel le dwc:Taxon est classé.
Exemples	`Puma` `Monoclea`
Équivalent dans ABCD	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Viral/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/GenusOrMonomial}
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:geodeticDatum
IRI du terme	http://rs.tdwg.org/dwc/terms/geodeticDatum
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/geodeticDatum-2025-06-12
Label	Système géodésique
Définition	L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel sont basées les coordonnées géographiques données dans dwc:decimalLatitude et dwc:decimalLongitude.
Notes	La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur `not recorded` (non documenté). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/SpatialDatum
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:geodeticDatum
IRI du terme	http://rs.tdwg.org/dwc/iri/geodeticDatum
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/geodeticDatum-2025-06-12
Label	Geodetic Datum (IRI)
Définition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value `not recorded`.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:GeologicalContext
IRI du terme	http://rs.tdwg.org/dwc/terms/GeologicalContext
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/GeologicalContext-2026-05-26
Label	Contexte géologique
Définition	A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity.
Exemples	`a particular lithostratigraphic layer` `a specific chronostratigraphic unit`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:geologicalContextID
IRI du terme	http://rs.tdwg.org/dwc/terms/geologicalContextID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/geologicalContextID-2023-06-28
Label	Identifiant du contexte géologique
Définition	Un identifiant pour l'ensemble des informations associées à un dwc:GeologicalContext (l'emplacement dans un contexte géologique, tel que la stratigraphie). Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données.
Exemples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:georeferencedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferencedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferencedBy-2026-05-26
Label	Géoréférencé par
Définition	A name for a dcterms:Agent responsible for providing a georeference.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Brad Millen (ROM)` `Kristina Yamamoto \| Janet Fang`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:georeferencedBy
IRI du terme	http://rs.tdwg.org/dwc/iri/georeferencedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/georeferencedBy-2026-05-26
Label	Georeferenced By (IRI)
Définition	An IRI identifying a dcterms:Agent responsible for providing a georeference.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:georeferencedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferencedDate
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferencedDate-2025-06-12
Label	Date de géoréférencement
Définition	Date à laquelle la dcterms:Location a été géoréférencée.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2011-10-16_9
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:georeferenceProtocol
IRI du terme	http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/georeferenceProtocol-2026-05-26
Label	Georeference Protocol (IRI)
Définition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:georeferenceProtocol
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferenceProtocol-2026-05-26
Label	Protocole de géoréférencement
Définition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinateMethod
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:georeferenceRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferenceRemarks-2025-06-12
Label	Remarques sur le géoréférencement
Définition	Des commentaires ou des notes sur la définition de la description spatiale, expliquant les hypothèses formulées en plus ou en contradiction avec celles formalisées dans la méthode mentionnée dans dwc:georeferenceProtocol.
Exemples	`Assumed distance by road (Hwy. 101)`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceRemarks
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:georeferenceSources
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferenceSources
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferenceSources-2026-05-26
Label	Sources du géoréférencement
Définition	A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`GeoLocate`, `GeoPick` `https://www.geonames.org/` `USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceSources
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:georeferenceSources
IRI du terme	http://rs.tdwg.org/dwc/iri/georeferenceSources
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/georeferenceSources-2026-05-26
Label	Georeference Sources (IRI)
Définition	An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
Notes	Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:georeferenceVerificationStatus
IRI du terme	http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/georeferenceVerificationStatus-2025-07-10
Label	Georeference Verification Status (IRI)
Définition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:georeferenceVerificationStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/georeferenceVerificationStatus-2023-06-28
Label	Statut de vérification du géoréférencement
Définition	Une description qualitative de la mesure dans laquelle le géoréférencement est considéré comme représentant la meilleure description spatiale possible pour la dcterms:Location de la dwc:Occurrence.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`unable to georeference` `requires georeference` `requires verification` `verified by data custodian` `verified by contributor`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceVerificationStatus
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Nom du Terme dwc:group
IRI du terme	http://rs.tdwg.org/dwc/terms/group
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/group-2023-09-13
Label	Groupe
Définition	Le nom complet du groupe lithostratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Bathurst` `Lower Wealden`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:habitat
IRI du terme	http://rs.tdwg.org/dwc/terms/habitat
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/habitat-2023-06-28
Label	Habitat
Définition	Une catégorie ou description de l'habitat dans lequel le dwc:Event s'est produit.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`oak savanna` `pre-cordilleran steppe`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Biotope/Text
Type	Propriété

Nom du Terme dwciri:habitat
IRI du terme	http://rs.tdwg.org/dwc/iri/habitat
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/habitat-2025-07-10
Label	Habitat (IRI)
Définition	A category or description of the habitat in which the dwc:Event occurred.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:higherClassification
IRI du terme	http://rs.tdwg.org/dwc/terms/higherClassification
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/higherClassification-2023-06-28
Label	Classification supérieure
Définition	Une liste (concaténée et séparée) de noms de taxons s'arrêtant au rang immédiatement supérieur au dwc:Taxon référencé.
Notes	La pratique optimale recommandée est de séparer les valeurs dans une liste par des barres verticales ( `\|` ), les termes étant classés du rang taxonomique le plus inclusif au moins inclusif.
Exemples	`Plantae \| Tracheophyta \| Magnoliopsida \| Ranunculales \| Ranunculaceae \| Ranunculus` `Animalia` `Animalia \| Chordata \| Vertebrata \| Mammalia \| Theria \| Eutheria \| Rodentia \| Hystricognatha \| Hystricognathi \| Ctenomyidae \| Ctenomyini \| Ctenomys`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:higherGeography
IRI du terme	http://rs.tdwg.org/dwc/terms/higherGeography
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/higherGeography-2023-06-28
Label	Géographie supérieure
Définition	Une liste (concaténée et séparée) de noms géographiques moins spécifiques que l'information saisie dans le terme dwc:locality.
Notes	La pratique optimale recommandée est de séparer les valeurs dans une liste par des barres verticales ( `\|` ), les termes étant classés du moins précis au plus précis.
Exemples	`North Atlantic Ocean` `South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos` avec les valeurs associées `South America` (continent) `Argentina` (country), `Neuquén` (first order division), et `Los Lagos` (second order division)
Équivalent dans ABCD	{DataSets/DataSet/Units/Unit/Gathering/LocalityText or DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName}
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:higherGeographyID
IRI du terme	http://rs.tdwg.org/dwc/terms/higherGeographyID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/higherGeographyID-2023-06-28
Label	Identifiant de la géographie supérieure
Définition	Un identifiant pour la région géographique dans laquelle la dcterms:Location se situe.
Notes	La pratique optimale recommandée consiste à utiliser un identifiant permanent issu d'un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names.
Exemples	`http://vocab.getty.edu/tgn/1002002` (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:HigherTaxon
IRI du terme	http://rs.tdwg.org/dwc/terms/HigherTaxon
Modifié	2009-08-24
Label	Higher Taxon
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than the ScientificName.
Notes	Example: "Animalia, Chordata, Vertebrata, Mammalia, Theria, Eutheria, Rodentia, Hystricognatha, Hystricognathi, Ctenomyidae, Ctenomyini, Ctenomys".
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Propriété

Nom du Terme dwc:higherTaxonconceptID
IRI du terme	http://rs.tdwg.org/dwc/terms/higherTaxonconceptID
Modifié	2009-08-24
Label	Higher Taxon Concept ID
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A unique identifier for the taxon concept less specific than that given in the taxonConceptID.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:HigherTaxonID
IRI du terme	http://rs.tdwg.org/dwc/terms/HigherTaxonID
Modifié	2009-08-24
Label	Higher Taxon ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Définition	A global unique identifier for the parent to the taxon.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:higherTaxonName
IRI du terme	http://rs.tdwg.org/dwc/terms/higherTaxonName
Modifié	2009-08-24
Label	Higher Taxon Name
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/higherClassification
Définition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than that given in the scientificName.
Notes	Example: "Animalia; Chordata; Vertebrata; Mammalia; Theria; Eutheria; Rodentia; Hystricognatha; Hystricognathi; Ctenomyidae; Ctenomyini; Ctenomys"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Propriété

Nom du Terme dwc:higherTaxonNameID
IRI du terme	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Modifié	2009-08-24
Label	Higher Taxon Name ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/parentNameUsageID
Définition	A unique identifier for the name of the next higher rank than the scientificName in a taxonomic classification. See higherTaxonName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:highestBiostratigraphicZone
IRI du terme	http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/highestBiostratigraphicZone-2023-09-13
Label	Zone biostratigraphique supérieure
Définition	Le nom complet de la zone géologique biostratigraphique la plus élevée possible de l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Blancan`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:HumanObservation
IRI du terme	http://rs.tdwg.org/dwc/terms/HumanObservation
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/HumanObservation-2023-09-18
Label	Observation humaine
Définition	Le résultat du processus d'une observation humaine.
Exemples	`evidence of a dwc:Occurrence taken from field notes or literature` `a record of a dwc:Occurrence without physical evidence or evidence captured with a machine`
Équivalent dans ABCD	RecordBasisEnum/HumanObservation
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwc:Identification
IRI du terme	http://rs.tdwg.org/dwc/terms/Identification
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Identification-2026-05-26
Label	Identification
Définition	A classification of a resource according to a classification scheme.
Notes	For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
Exemples	`a subspecies determination of an organism` `a nomenclatural act designating a specimen as a holotype`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:identificationAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationAttributes
Modifié	2009-10-09
Label	Identification Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Identification.
Notes	Example: "natureOfID=expert identification; identificationEvidence=cytochrome B sequence"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:identificationID
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationID-2026-05-26
Label	Identifiant de l'identification
Définition	An identifier for a dwc:Identification.
Notes	Recommended best practice is to use a globally unique identifier.
Exemples	`9992`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:identificationQualifier
IRI du terme	http://rs.tdwg.org/dwc/iri/identificationQualifier
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/identificationQualifier-2025-07-10
Label	Identification Qualifier (IRI)
Définition	A controlled value to express the determiner's doubts about the dwc:Identification.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:identificationQualifier
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationQualifier
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationQualifier-2023-06-28
Label	Qualificatif de l'identification
Définition	Une phrase courte ou une abréviation standardisée ("cf.", "aff.") pour exprimer les doutes liés à l'identification.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'une IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`aff. agrifolia var. oxyadenia` (pour `Quercus aff. agrifolia var. oxyadenia` avec les valeurs associées `Quercus` dans genus, `agrifolia` dans specificEpithet, `oxyadenia` dans infraspecificEpithet, et `var.` dans taxonRank) `cf. var. oxyadenia` (pour `Quercus agrifolia cf. var. oxyadenia` avec les valeurs associées `Quercus` dans le genus, `agrifolia` dans specificEpithet, `oxyadenia` dans infraspecificEpithet, et `var.` dans taxonRank)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/IdentificationQualifier
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Nom du Terme dwc:identificationReferences
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationReferences
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationReferences-2026-05-26
Label	Références associées à l'identification
Définition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/References
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:identificationRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationRemarks-2023-06-28
Label	Remarques sur l'identification
Définition	Commentaires ou notes sur la dwc:Identification.
Exemples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Notes
Type	Propriété

Nom du Terme dwc:identificationType
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationType-2026-05-26
Label	Identification Type
Définition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`geography` `taxonomicRevision` `functionalAttributes` `nucleotideAnalysis` `karyotype` `media` `relationship` `features` `fineFeatures` `unknown`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:identificationType
IRI du terme	http://rs.tdwg.org/dwc/iri/identificationType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/identificationType-2026-05-26
Label	Identification Type (IRI)
Définition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:identificationVerificationStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identificationVerificationStatus-2026-05-26
Label	Statut de la vérification de l'identification
Définition	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que celui utilisé dans HISPID et ABCD. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`0` (unverified in HISPID/ABCD)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2011-10-16_10
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:identificationVerificationStatus
IRI du terme	http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/identificationVerificationStatus-2026-05-26
Label	Identification Verification Status (IRI)
Définition	A categorical indicator of the extent to which a taxonomic determination has been verified to be correct.
Notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:identifiedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/identifiedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identifiedBy-2026-05-26
Label	Identifié par
Définition	A name for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey` `MegaDetector V5`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Identifiers/IdentifiersText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:identifiedBy
IRI du terme	http://rs.tdwg.org/dwc/iri/identifiedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/identifiedBy-2026-05-26
Label	Identified By (IRI)
Définition	An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:identifiedByID
IRI du terme	http://rs.tdwg.org/dwc/terms/identifiedByID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/identifiedByID-2026-05-26
Label	Identifiant de l'identificateur
Définition	An identifier for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`https://orcid.org/0000-0002-1825-0097` (pour un individu) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (pour une liste de personnes)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:inCollection
IRI du terme	http://rs.tdwg.org/dwc/iri/inCollection
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/inCollection-2015-03-27
Label	In Collection
Définition	Use to link any subject resource that is part of a collection to the collection containing the resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:inDataset
IRI du terme	http://rs.tdwg.org/dwc/iri/inDataset
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/inDataset-2015-03-27
Label	In Dataset
Définition	Use to link a subject dataset record to the dataset which contains it.
Notes	A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:inDescribedPlace
IRI du terme	http://rs.tdwg.org/dwc/iri/inDescribedPlace
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/inDescribedPlace-2015-03-27
Label	In Described Place
Définition	Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
Exemples	`http://vocab.getty.edu/tgn/1019987`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:individualCount
IRI du terme	http://rs.tdwg.org/dwc/terms/individualCount
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/individualCount-2023-06-28
Label	Nombre d'individus
Définition	Le nombre d'individus présents au moment de la dwc:Occurrence.
Exemples	`0` `1` `25`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue
Type	Propriété

Nom du Terme dwc:individualID
IRI du terme	http://rs.tdwg.org/dwc/terms/individualID
Modifié	2014-10-23
Label	Individual ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/organismID
Définition	An identifier for an individual or named group of individual organisms represented in the Occurrence. Meant to accommodate resampling of the same individual or group for monitoring purposes. May be a global unique identifier or an identifier specific to a data set.
Notes	Examples: "U.amer. 44", "Smedley", "Orca J 23"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/NamedIndividual or DataSets/DataSet/Units/Unit/ObservationUnit/ObservationUnitIdentifiers/ObservationUnitIdentifier or DataSets/DataSet/Units/Unit/SpecimenUnit/Accessions/AccessionNumber
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwciri:informationWithheld
IRI du terme	http://rs.tdwg.org/dwc/iri/informationWithheld
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/informationWithheld-2026-05-26
Label	Information Withheld (IRI)
Définition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:informationWithheld
IRI du terme	http://rs.tdwg.org/dwc/terms/informationWithheld
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/informationWithheld-2026-05-26
Label	Information non renseignée
Définition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/InformationWithheld
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:infragenericEpithet
IRI du terme	http://rs.tdwg.org/dwc/terms/infragenericEpithet
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/infragenericEpithet-2023-06-28
Label	Épithète infragénérique
Définition	Partie infragénérique d'un nom binomial dont le rang est supérieur à celui de l'espèce mais inférieur à celui du genre.
Notes	Le terme dwc:infragenericEpithet doit être utilisé conjointement avec dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank et dwc:scientificNameAuthorship pour représenter les éléments individuels du dwc:scientificName complet. Il peut être utilisé pour indiquer l'emplacement du sous-genre d'une espèce, qui est souvent indiqué entre parenthèses en zoologie. Il peut également être utilisé pour partager des noms infragénériques tels que des sections en botanique (par exemple, `Vicia sect. Cracca`).
Exemples	`Abacetillus` (pour le scientificName`Abacetus (Abacetillus) ambiguus`) `Cracca` (pour le scientificName `Vicia sect. Cracca`)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Bacterial/Subgenus (for bacterial names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/Subgenus (for zoological names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet (for botanical names)
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:infraspecificEpithet
IRI du terme	http://rs.tdwg.org/dwc/terms/infraspecificEpithet
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/infraspecificEpithet-2026-05-26
Label	Épithète infraspécifique
Définition	The name of the lowest or terminal infraspecific of the dwc:scientificName.
Notes	In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string `Indigofera charlieriana subsp. sessilis var. scaberrima` is `scaberrima` and the dwc:scientificName is `Indigofera charlieriana var. scaberrima`. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
Exemples	`concolor` (for scientificName `Puma concolor concolor`) `oxyadenia` (for scientificName `Quercus agrifolia var. oxyadenia`) `laxa` (for scientificName `Cheilanthes hirta f. laxa`) `scaberrima` (for scientificName `Indigofera charlieriana var. scaberrima`)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SubspeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/SecondEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SubspeciesEpithet
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:institutionCode
IRI du terme	http://rs.tdwg.org/dwc/terms/institutionCode
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/institutionCode-2026-05-26
Label	Code de l'institution
Définition	A name (or acronym) in use by an institution having custody of a resource.
Notes	The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
Exemples	`MVZ` `FMNH` `CLO` `UCMP` `National Museum of Kenya` `Kew Gardens`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SourceInstitutionID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:institutionID
IRI du terme	http://rs.tdwg.org/dwc/terms/institutionID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/institutionID-2026-05-26
Label	Identifiant de l'institution
Définition	An identifier for an organization.
Notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Exemples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://www.gbif.org/grscicoll/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SourceInstitutionID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:isAcceptedIdentification
IRI du terme	http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/isAcceptedIdentification-2026-05-26
Label	Is Accepted Identification
Définition	An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Exemples	`true` `false`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:island
IRI du terme	http://rs.tdwg.org/dwc/terms/island
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/island-2023-06-28
Label	Île
Définition	Le nom de l'île sur laquelle ou à proximité de laquelle se trouve la dcterms:Location.
Notes	La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names.
Exemples	`Nosy Be` `Bikini Atoll` `Vancouver` `Viti Levu` `Zanzibar`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:islandGroup
IRI du terme	http://rs.tdwg.org/dwc/terms/islandGroup
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/islandGroup-2023-06-28
Label	Groupement d'îles
Définition	Le nom du groupement d'îles dans lequel se trouve la dcterms:Location.
Notes	La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names.
Exemples	`Alexander Archipelago` `Archipiélago Diego Ramírez` `Seychelles`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island group
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:kingdom
IRI du terme	http://rs.tdwg.org/dwc/terms/kingdom
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/kingdom-2023-06-28
Label	Règne
Définition	Le nom scientifique complet du règne dans lequel le dwc:Taxon est classé.
Exemples	`Animalia` `Archaea` `Bacteria` `Chromista` `Fungi` `Plantae` `Protozoa` `Viruses`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = regnum
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dcterms:language
IRI du terme	http://purl.org/dc/terms/language
Modifié	2008-01-14
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#languageT-001
Label	Langue
Définition	Une langue de la ressource.
Notes	La pratique optimale recommandée est d'utiliser un IRI du schéma ISO 639-2 de la Bibliothèque du Congrès US http://id.loc.gov/vocabulary/iso639-2
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Nom du Terme dc:language
IRI du terme	http://purl.org/dc/elements/1.1/language
Modifié	2023-06-28
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#language-007
Label	Langue
Définition	Une langue de la ressource.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que RFC 5646. Ce terme a un équivalent dans le dcterms: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`en` (pour l'anglais) `es` (pour l'espagnol)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Nom du Terme dwc:latestAgeOrHighestStage
IRI du terme	http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/latestAgeOrHighestStage-2023-09-13
Label	Âge le plus récent ou étage supérieur
Définition	Le nom complet de l'âge géochronologique le plus récent possible ou de l'étage chronostratigraphique le plus haut attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Atlantic` `Boreal` `Skullrockian`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:LatestDateCollected
IRI du terme	http://rs.tdwg.org/dwc/terms/LatestDateCollected
Modifié	2009-04-24
Label	Latest Date Collected
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventDate
Définition	The latest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Propriété

Nom du Terme dwc:latestEonOrHighestEonothem
IRI du terme	http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/latestEonOrHighestEonothem-2026-05-26
Label	Éon le plus récent ou Eonothème le plus élevé
Définition	The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Exemples	`Phanerozoic` `Proterozoic` `Precambrian`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:latestEpochOrHighestSeries
IRI du terme	http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/latestEpochOrHighestSeries-2023-09-13
Label	Époque la plus récente ou série la plus haute
Définition	Le nom complet de l'époque géochronologique la plus récente possible ou de la série chronostratigraphique la plus haute attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Holocene` `Pleistocene` `Ibexian Series`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:latestEraOrHighestErathem
IRI du terme	http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/latestEraOrHighestErathem-2023-09-13
Label	Dernière ère ou érathème supérieur
Définition	Le nom complet de l'ère géochronologique la plus récente possible ou de l'érathème chronostratigraphique la plus haute attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Cenozoic` `Mesozoic`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:latestGeochronologicalEra
IRI du terme	http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/latestGeochronologicalEra-2023-09-13
Label	Latest Geochronological Era
Définition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:latestPeriodOrHighestSystem
IRI du terme	http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/latestPeriodOrHighestSystem-2023-09-13
Label	Période la plus récente ou système supérieur
Définition	Le nom complet de la dernière période géochronologique possible ou du système chronostratigraphique le plus élevé attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée.
Exemples	`Neogene` `Tertiary` `Quaternary`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dcterms:license
IRI du terme	http://purl.org/dc/terms/license
Modifié	2023-06-28
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#license-002
Label	Licence
Définition	Document juridique donnant l'autorisation officielle de faire quelque chose avec la ressource.
Exemples	`http://creativecommons.org/publicdomain/zero/1.0/legalcode` `http://creativecommons.org/licenses/by/4.0/legalcode`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-11-06_17
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:lifeStage
IRI du terme	http://rs.tdwg.org/dwc/terms/lifeStage
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/lifeStage-2026-05-26
Label	Stade de développement
Définition	An age class or life stage of a dwc:Organism.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`zygote` `larva` `juvenile` `adult` `seedling` `flowering` `fruiting`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalSexualStage or DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalLiveStages/MycologicalLiveStage or DataSets/DataSet/Units/Unit/ZoologicalUnit/PhasesOrStages/PhaseOrStage
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:lifeStage
IRI du terme	http://rs.tdwg.org/dwc/iri/lifeStage
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/lifeStage-2026-05-26
Label	Life Stage (IRI)
Définition	An age class or life stage of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:lithostratigraphicTerms
IRI du terme	http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/lithostratigraphicTerms-2025-06-12
Label	Termes lithostratigraphiques
Définition	La combinaison de tous les noms lithostratigraphiques de la roche à partir de laquelle la dwc:MaterialEntity a été collectée.
Exemples	`Pleistocene-Weichselien`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy/LithostratigraphicTerms
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:LivingSpecimen
IRI du terme	http://rs.tdwg.org/dwc/terms/LivingSpecimen
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/LivingSpecimen-2023-09-18
Label	Spécimen vivant
Définition	Un spécimen qui est en vie.
Exemples	`a living plant in a botanical garden` `a living animal in a zoo`
Équivalent dans ABCD	RecordBasisEnum/LivingSpecimen
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwc:locality
IRI du terme	http://rs.tdwg.org/dwc/terms/locality
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/locality-2023-06-28
Label	Localité
Définition	La description précise du lieu.
Notes	Des informations géographiques moins spécifiques peuvent être fournies dans d'autres termes géographiques (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). Ce terme peut contenir des informations modifiées par rapport à l'original afin de corriger des erreurs apparentes ou de normaliser la description.
Exemples	`Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)` `Queets Rainforest, Olympic National Park`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dcterms:Location
IRI du terme	http://purl.org/dc/terms/Location
Modifié	2023-09-18
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#Location-001
Label	Localisation
Définition	Une région spatiale ou un lieu nommé.
Exemples	`the municipality of San Carlos de Bariloche, Río Negro, Argentina` `the place defined by a georeference`
Équivalent dans ABCD	not in ABCD
Type	Classe

Nom du Terme dwciri:locationAccordingTo
IRI du terme	http://rs.tdwg.org/dwc/iri/locationAccordingTo
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/locationAccordingTo-2025-07-10
Label	Location According To (IRI)
Définition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:locationAccordingTo
IRI du terme	http://rs.tdwg.org/dwc/terms/locationAccordingTo
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/locationAccordingTo-2023-06-28
Label	Localité selon
Définition	Informations sur la source des informations sur la dcterms:Location. Il peut s'agir d'une publication (gazetteer/index géographique), d'une institution ou d'un ensemble d'individus.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Getty Thesaurus of Geographic Names` `GADM`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:locationAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/locationAttributes
Modifié	2014-10-23
Label	Location Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the location.
Notes	Example: "aspectheading=277; slopeindegrees=6"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:locationID
IRI du terme	http://rs.tdwg.org/dwc/terms/locationID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/locationID-2026-05-26
Label	Identifiant de la localité
Définition	An identifier for a dcterms:Location.
Notes	Recommended best practice is to use a globally unique identifier.
Exemples	`https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:locationRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/locationRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/locationRemarks-2023-06-28
Label	Remarques sur la localité
Définition	Commentaires ou notes à propos de la dcterms:Location.
Exemples	`under water since 2005`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type	Propriété

Nom du Terme dwc:lowestBiostratigraphicZone
IRI du terme	http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/lowestBiostratigraphicZone-2023-09-13
Label	Zone biostratigraphique inférieure
Définition	Le nom complet de la zone géologique biostratigraphique la plus basse possible de l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Maastrichtian`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:MachineObservation
IRI du terme	http://rs.tdwg.org/dwc/terms/MachineObservation
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MachineObservation-2023-09-18
Label	Observation faite par une machine
Définition	Le résultat du processus d'une observation par une machine.
Exemples	`a photograph` `a video` `an audio recording` `a remote sensing image` `a dwc:Occurrence record based on telemetry`
Équivalent dans ABCD	RecordBasisEnum/MachineObservation
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwc:MaterialCitation
IRI du terme	http://rs.tdwg.org/dwc/terms/MaterialCitation
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MaterialCitation-2023-09-18
Label	Référence à un matériel
Définition	Une référence ou citation d'un, d'une partie ou de plusieurs spécimens dans des publications scientifiques.
Notes	Cette classe constitue une nouvelle valeur pour le vocabulaire contrôlé dans les recommandations pour basisOfRecord. Lors de l'importation dans le GBIF d'archives Darwin Core de jeux de données basés sur la littérature, la basisOfRecord doit être modifiée de "Occurrence", "PreservedSpecimen" ou "Literature" à "MaterialCitation".
Exemples	`a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication` `a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication`
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Nom du Terme dwc:MaterialEntity
IRI du terme	http://rs.tdwg.org/dwc/terms/MaterialEntity
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MaterialEntity-2026-05-26
Label	Entité matérielle
Définition	Une entité qui peut être identifiée, qui existe pendant un certain temps et qui est constituée en tout ou en partie de matière physique pendant son existence.
Notes	The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Exemples	`the entire contents of a trawl` `a subset of the contents of a trawl` `the body of a fish` `the stomach contents of a fish` `a rock containing fossils` `a fossil within a rock` `an herbarium sheet with its attached plant specimen` `a flower on a plant specimen` `a pollen grain` `a specific water sample` `an isolated molecule of DNA`
Équivalent dans ABCD	not in ABCD (Specimen Unit, when used to denote a class of things, appears to be a broadly construed subclass.)
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:materialEntityCategory
IRI du terme	http://rs.tdwg.org/dwc/iri/materialEntityCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/materialEntityCategory-2026-05-26
Label	Material Entity Category (IRI)
Définition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:materialEntityCategory
IRI du terme	http://rs.tdwg.org/dwc/terms/materialEntityCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/materialEntityCategory-2026-05-26
Label	Material Entity Category
Définition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`liveOrganism`, `deadOrganism`, `partOfOrganism`, `nonMolecularBiologicalExtract`, `molecularBiologicalExtract`, `mineral`, `rock`, `fossil`, `chemical`, `humanArtifactWithBiologicalConstituent`, `humanArtifactWithoutBiologicalConstituent`, and `mixed`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:materialEntityID
IRI du terme	http://rs.tdwg.org/dwc/terms/materialEntityID
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/materialEntityID-2023-09-13
Label	Identifiant d'entité matérielle
Définition	Identifiant d'une instance particulière d'une dwc:MaterialEntity.
Notes	Les valeurs de dwc:materialEntityID sont destinées à identifier de manière unique et permanente une dwc:MaterialEntity particulière dans un certain contexte. Les exemples de contexte comprennent une collection d'échantillons donnée, une organisation donnée ou l'échelle globale. La pratique optimale recommandée est d'utiliser un identifiant permanent et unique au niveau mondial. L'identifiant est lié à un objet physique (la dwc:MaterialEntity) par opposition à un enregistrement numérique particulier (représentation) de cet objet physique.
Exemples	`06809dc5-f143-459a-be1a-6f03e63fc083`
Équivalent dans ABCD	Unit/UnitGUID or Unit/UnitID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:materialEntityRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/materialEntityRemarks-2026-05-26
Label	Remarques sur l'entité matérielle
Définition	Comments or notes about a dwc:MaterialEntity.
Exemples	`found in association with charred remains` `some original fragments missing`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Notes
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:materialEntityType
IRI du terme	http://rs.tdwg.org/dwc/iri/materialEntityType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/materialEntityType-2026-05-26
Label	Material Entity Type (IRI)
Définition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:materialEntityType
IRI du terme	http://rs.tdwg.org/dwc/terms/materialEntityType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/materialEntityType-2026-05-26
Label	Type d'entité matérielle
Définition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes	Classification plus générique d'une dwc:MaterialEntity que dwc:preparations. La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Équivalent dans ABCD	skos:closeMatch to /DataSets/DataSet/Units/Unit/KindOfUnit. ABCD structural considerations prevent an exactMatch.
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:MaterialSample
IRI du terme	http://rs.tdwg.org/dwc/terms/MaterialSample
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MaterialSample-2023-09-13
Label	Échantillon matériel
Définition	Une entité matérielle qui représente une entité d'intérêt en totalité ou en partie.
Exemples	`a whole organism preserved in a collection` `a part of an organism isolated for some purpose` `a soil sample` `a marine microbial sample`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2013-10-09_11
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:materialSampleID
IRI du terme	http://rs.tdwg.org/dwc/terms/materialSampleID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/materialSampleID-2023-06-28
Label	Identifiant de l'échantillon matériel
Définition	Un identifiant pour le dwc:MaterialSample (par opposition à un enregistrement numérique particulier du dwc:MaterialSample). En l'absence d'un identifiant unique global permanent, en construire un à partir d'une combinaison d'identifiants dans l'enregistrement qui rendra le dwc:materialSampleID le plus unique possible à l'échelle globale.
Notes	La pratique optimale recommandée est d'utiliser un identifiant permanent et unique au niveau mondial (GUI).
Exemples	`06809dc5-f143-459a-be1a-6f03e63fc083`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2013-10-09_13

Nom du Terme dwc:maximumDepthInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/maximumDepthInMeters-2026-05-26
Label	Profondeur maximale en mètres
Définition	The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Exemples	`0` `200`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:maximumDistanceAboveSurfaceInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/maximumDistanceAboveSurfaceInMeters-2023-06-28
Label	Distance maximale au-dessus de la surface en mètres
Définition	La plus grande distance d'une plage de distances par rapport à une surface de référence dans la dimension verticale, en mètres. Utilisez des valeurs positives pour les emplacements situés au-dessus de la surface, et des valeurs négatives pour les emplacements situés en dessous. Si des mesures de profondeur sont données, la surface de référence est l'emplacement donné par la profondeur, sinon la surface de référence est l'emplacement donné par l'élévation.
Exemples	`-1.5` (sous la surface) `4.2` (au-dessus de la surface) Pour une carotte de sédiments de 1,5 mètre prélevée au fond d'un lac (à une profondeur de 20 m) à une altitude de 300 m : verbatimElevation : `300m` minimumElevationInMeters : `300`, maximumElevationInMeters : `300`, verbatimDepth : `20m`, minimumDepthInMeters : `20`, maximumDepthInMeters : `20`, minimumDistanceAboveSurfaceInMeters : `0`, maximumDistanceAboveSurfaceInMeters : `-1.5`.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Propriété

Nom du Terme dwc:maximumElevationInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/maximumElevationInMeters-2026-05-26
Label	Altitude maximale en mètres
Définition	The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Exemples	`-205` `1236`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:measurementAccuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementAccuracy-2023-06-28
Label	Précision de la mesure
Définition	La description de l'erreur ou marge d'erreur potentielle associée à la dwc:measurementValue.
Exemples	`0.01` `normal distribution with variation of 2 m`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:measurementDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedBy-2023-06-28
Label	Mesure effectuée par
Définition	Une liste (concaténée et séparée) de noms de personnes, de groupes ou d'organisations qui ont déterminé la valeur du dwc:MeasurementOrFact.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwciri:measurementDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/measurementDeterminedBy-2025-07-10
Label	Measurement Determined By (IRI)
Définition	A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:measurementDeterminedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedDate-2025-06-12
Label	Date de la mesure
Définition	La date à laquelle la dwc:MeasurementOrFact a été effectuée.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:measurementID
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementID-2023-06-28
Label	Identifiant de la mesure
Définition	Un identifiant pour le dwc:MeasurementOrFact (informations relatives aux mesures, aux faits, aux caractéristiques ou aux affirmations). Il peut s'agir d'un identifiant unique global ou d'un identifiant spécifique à un jeu de données.
Exemples	`9c752d22-b09a-11e8-96f8-529269fb1459`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:measurementMethod
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementMethod
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementMethod-2023-06-28
Label	Méthode de mesure
Définition	Une description ou référence (publication, URI) de la méthode ou du protocole utilisé pour déterminer la mesure, le fait, la caractéristique ou l'affirmation.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`polygone convexe minimal autour des entrées de terriers` (pour un territoire) `altimètre barométrique` (pour une altitude)
Équivalent dans ABCD	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:measurementMethod
IRI du terme	http://rs.tdwg.org/dwc/iri/measurementMethod
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/measurementMethod-2025-07-10
Label	Measurement Method (IRI)
Définition	The method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:MeasurementOrFact
IRI du terme	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MeasurementOrFact-2023-09-13
Label	Mesure ou Fait
Définition	Une mesure ou un fait concernant une rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Les ressources peuvent être considérées comme des enregistrements identifiables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc : GeologicalContext, dwc:Identification, ou dwc:Taxon.
Exemples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
Équivalent dans ABCD	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:measurementRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementRemarks-2023-06-28
Label	Remarques sur la mesure
Définition	Commentaires ou notes accompagnant la dwc:MeasurementOrFact.
Exemples	`tip of tail missing`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:measurementType
IRI du terme	http://rs.tdwg.org/dwc/iri/measurementType
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/measurementType-2025-07-10
Label	Measurement Type (IRI)
Définition	The nature of the measurement, fact, characteristic, or assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:measurementType
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementType
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementType-2023-06-28
Label	Type de mesure
Définition	La nature de la mesure, du fait, de la caractéristique ou de l'affirmation.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`tail length` `temperature` `trap line length` `survey area` `trap type`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:measurementUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementUnit
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementUnit-2023-06-28
Label	Unité de mesure
Définition	Les unités associées à la dwc:measurementValue.
Notes	La pratique optimale recommandée est d'utiliser est d'utiliser les unités du système international (SI). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`m` `g` `l` `°C` `mm` `km²` `%` `hh:mm:ss`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:measurementUnit
IRI du terme	http://rs.tdwg.org/dwc/iri/measurementUnit
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/measurementUnit-2023-06-28
Label	Measurement Unit (IRI)
Définition	The units associated with the dwc:measurementValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:measurementValue
IRI du terme	http://rs.tdwg.org/dwc/terms/measurementValue
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/measurementValue-2023-06-28
Label	Valeur de la mesure
Définition	La valeur de la mesure, du fait, de l'affirmation ou de la caractéristique.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`45` `20` `1` `14.5` `UV-light`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:measurementValue
IRI du terme	http://rs.tdwg.org/dwc/iri/measurementValue
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/measurementValue-2025-07-10
Label	Measurement Value (IRI)
Définition	The value of the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme ac:Media
IRI du terme	http://rs.tdwg.org/ac/terms/Media
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/ac/terms/version/Media-2026-02-24
Label	Media Entity
Définition	A digital or physical media resource.
Notes	An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
Exemples	`dcmi:Sound` `dcmi:StillImage` `dcmi:MovingImage` `dcmi:InteractiveResource` `ac:Digital3DResource`
Équivalent dans ABCD	This term is equivalent to the ABCD term http://rs.tdwg.org/abcd/terms/MultimediaObject .
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:member
IRI du terme	http://rs.tdwg.org/dwc/terms/member
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/member-2023-09-13
Label	Membre
Définition	Le nom complet du membre lithostratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée.
Exemples	`Lava Dam Member` `Hellnmaria Member`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:minimumDepthInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/minimumDepthInMeters-2026-05-26
Label	Profondeur minimale en mètres
Définition	The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Exemples	`0` `100`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:minimumDistanceAboveSurfaceInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/minimumDistanceAboveSurfaceInMeters-2023-06-28
Label	Distance minimale au-dessus de la surface en mètres
Définition	La plus petite distance d'une plage de distances par rapport à une surface de référence dans la dimension verticale, en mètres. Utilisez des valeurs positives pour les emplacements situés au-dessus de la surface, et des valeurs négatives pour les emplacements situés en dessous. Si des mesures de profondeur sont données, la surface de référence est l'emplacement donné par la profondeur, sinon la surface de référence est l'emplacement donné par l'élévation.
Exemples	`-1.5` (sous la surface) `4.2` (au-dessus de la surface) Pour une carotte de sédiments de 1,5 mètre prélevée au fond d'un lac (à une profondeur de 20 m) à une altitude de 300 m : verbatimElevation : `300m` minimumElevationInMeters : `300`, maximumElevationInMeters : `300`, verbatimDepth : `20m`, minimumDepthInMeters : `20`, maximumDepthInMeters : `20`, minimumDistanceAboveSurfaceInMeters : `0`, maximumDistanceAboveSurfaceInMeters : `-1.5`.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue
Type	Propriété

Nom du Terme dwc:minimumElevationInMeters
IRI du terme	http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/minimumElevationInMeters-2026-05-26
Label	Altitude minimale en mètres
Définition	The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Exemples	`-100` `802`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dcterms:modified
IRI du terme	http://purl.org/dc/terms/modified
Modifié	2025-06-12
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#modified-003
Label	Date de Modification
Définition	Date à laquelle la ressource a été modifiée.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55

Nom du Terme dwc:MolecularProtocol
IRI du terme	http://rs.tdwg.org/dwc/terms/MolecularProtocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/MolecularProtocol-2026-05-26
Label	Molecular Protocol
Définition	A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
Exemples	`a standard DNA barcoding workflow using Sanger sequencing` `a shotgun metagenomics pipeline for microbial community profiling` `a high-throughput amplicon sequencing protocol targeting 16S rRNA`
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:molecularProtocolID
IRI du terme	http://rs.tdwg.org/dwc/terms/molecularProtocolID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/molecularProtocolID-2026-05-26
Label	Molecular Protocol ID
Définition	An identifier for a dwc:MolecularProtocol.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:month
IRI du terme	http://rs.tdwg.org/dwc/terms/month
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/month-2023-06-28
Label	Mois
Définition	Le mois (nombre entier) au cours duquel le dwc:Event s'est produit.
Exemples	`1` (janvier) `10` (octobre)
Équivalent dans ABCD	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Propriété

Nom du Terme dwc:municipality
IRI du terme	http://rs.tdwg.org/dwc/terms/municipality
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/municipality-2023-06-28
Label	Division de troisième ordre
Définition	Le nom complet et non abrégé de la région administrative immédiatement inférieure au comté (ville, municipalité, etc.) dans laquelle se trouve la dcterms:Location. N'utilisez pas ce terme pour un lieu nommé à proximité qui ne contient pas la dcterms:Location elle-même.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux.
Exemples	`Holzminden` `Araçatuba` `Ga-Segonyana`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:nameAccordingTo
IRI du terme	http://rs.tdwg.org/dwc/terms/nameAccordingTo
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/nameAccordingTo-2026-05-26
Label	Nom selon
Définition	La référence à la source dans laquelle la délimitation du taxon concept est définie ou suggérée - traditionnellement signifiée par le latin "sensu" ou "sec." (de secundum qui signifie "selon"). Pour les taxons résultant d'identifications, une référence aux clés, monographies, experts et autres sources doit être donnée.
Notes	This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by `sensu` or `sec.`, it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
Exemples	`Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236.` (pour la citation complète de l'article de Franz & Cardona-Duque (2013) dans Perelleschus splendida sec. Franz & Cardona-Duque (2013))
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:nameAccordingToID
IRI du terme	http://rs.tdwg.org/dwc/terms/nameAccordingToID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/nameAccordingToID-2023-06-28
Label	Identifiant du nom selon
Définition	Un identifiant de la source dans laquelle la circonscription du concept de taxon associé est définie ou sous-entendue. Voir dwc:nameAccordingTo.
Exemples	`https://doi.org/10.1016/S0269-915X(97)80026-2`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:namePublicationID
IRI du terme	http://rs.tdwg.org/dwc/terms/namePublicationID
Modifié	2009-09-21
Label	Name Publication ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/namePublishedInID
Définition	A resolvable globally unique identifier for the original publication of the scientificName.
Notes	Example: "http://hdl.handle.net/10199/7"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:namePublishedIn
IRI du terme	http://rs.tdwg.org/dwc/terms/namePublishedIn
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/namePublishedIn-2023-06-28
Label	Nom publié dans
Définition	Une référence à la publication dans laquelle le dwc:scientificName a été établi à l'origine selon les règles du dwc:nomenclaturalCode associé.
Notes	Une référence à la première publication du nom dans sa combinaison indiquée, et non le basionyme / nom original. Les recombinaisons ne sont souvent pas publiées en tant que telles en zoologie, auquel cas dwc:namePublishedIn devrait être vide.
Exemples	`Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:namePublishedInID
IRI du terme	http://rs.tdwg.org/dwc/terms/namePublishedInID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/namePublishedInID-2023-06-28
Label	Identifiant du travail où un nom est publié
Définition	Un identifiant de la publication dans laquelle le dwc:scientificName a été établi à l'origine selon les règles du dwc:nomenclaturalCode associé.
Notes	Une référence à la première publication du nom dans la combinaison utilisé, pas le basionyme / la combinaison originale. Les recombinaisons ne sont souvent pas publiées en tant que telles en zoologie, auquel cas dwc:namePublishedInID doit être vide.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dwc:namePublishedInYear
IRI du terme	http://rs.tdwg.org/dwc/terms/namePublishedInYear
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/namePublishedInYear-2023-06-28
Label	Année de publication du nom
Définition	L'année en quatre chiffres au cours de laquelle le dwc:scientificName a été publié.
Exemples	`1915` `2008`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2011-10-16_8
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:nomenclaturalCode
IRI du terme	http://rs.tdwg.org/dwc/terms/nomenclaturalCode
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/nomenclaturalCode-2023-06-28
Label	Code de nomenclature
Définition	Le code de nomenclature (ou les codes, dans le cas d'un nom appliqué à un taxon dont le Règne est ambigu) régissant le dwc:scientificName.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`ICN` `ICZN` `BC` `ICNCP` `BioCode`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/Code
Type	Propriété

Nom du Terme dwc:nomenclaturalStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/nomenclaturalStatus-2023-06-28
Label	Statut nomenclatural
Définition	Le statut lié à la publication originale du nom et à sa conformité aux règles correspondantes en nomenclature. Ce statut est déterminé essentiellement sur un algorithme de prise de décision conforme aux règles du code. Il ne nécessite pas d'opinion taxonomique.
Exemples	`nom. ambig.` `nom. illeg.` `nom. subnud.`
Équivalent dans ABCD	(DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation) pro parte
Type	Propriété

Nom du Terme dwc:NucleotideAnalysis
IRI du terme	http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/NucleotideAnalysis-2026-05-26
Label	Nucleotide Analysis
Définition	A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:NucleotideSequence
IRI du terme	http://rs.tdwg.org/dwc/terms/NucleotideSequence
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/NucleotideSequence-2026-05-26
Label	Nucleotide Sequence
Définition	A digital representation of a nucleotide sequence.
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:nucleotideSequenceRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/nucleotideSequenceRemarks-2026-05-26
Label	Nucleotide Sequence Remarks
Définition	Comments or notes about a dwc:NucleotideSequence.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:objectQuantity
IRI du terme	http://rs.tdwg.org/dwc/terms/objectQuantity
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/objectQuantity-2026-05-26
Label	Object Quantity
Définition	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Notes	An dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
Exemples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:objectQuantityType
IRI du terme	http://rs.tdwg.org/dwc/iri/objectQuantityType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/objectQuantityType-2026-05-26
Label	Object Quantity Type (IRI)
Définition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:objectQuantityType
IRI du terme	http://rs.tdwg.org/dwc/terms/objectQuantityType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/objectQuantityType-2026-05-26
Label	Object Quantity Type
Définition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Occurrence
IRI du terme	http://rs.tdwg.org/dwc/terms/Occurrence
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Occurrence-2026-05-26
Label	Occurrence
Définition	A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
Notes	In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Exemples	`a wolf pack on the shore of Kluane Lake in 1988` `a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23` `a fungus in Central Park in the summer of 1929` `a male lance-tailed manakin in a courtship display on Isla Boca Brava`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:occurrenceAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceAttributes
Modifié	2009-10-09
Label	Occurrence Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Occurrence.
Notes	Examples: "Tragus length: 14mm; Weight: 120g", "Height: 1-1.5 meters tall; flowers yellow; uncommon".
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts
Type	Propriété

Nom du Terme dwc:occurrenceDetails
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceDetails
Modifié	2009-10-09
Label	Occurrence Details
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A reference (publication, URI) to the most detailed information available about the Occurrence.
Notes	Example: "http://mvzarctos.berkeley.edu/guid/MVZ:Mamm:165861"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/RecordURI
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2011-10-16_7

Nom du Terme dwc:occurrenceID
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/occurrenceID-2026-05-26
Label	Identifiant de l'occurrence
Définition	An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
Notes	In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Exemples	`https://arctos.database.museum/guid/MSB:Mamm:231731?seid=966527` `3854b337a-da0b-483f-a1c7-107403bdbb40` `http://n2t.net/ark:/65665/3854b337a-da0b-483f-a1c7-107403bdbb40`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/UnitGUID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:OccurrenceMeasurement
IRI du terme	http://rs.tdwg.org/dwc/terms/OccurrenceMeasurement
Modifié	2009-10-09
Label	Occurrence Measurement
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The category of information pertaining to measurements accociated with an occurrence.
Équivalent dans ABCD	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type	Classe

Nom du Terme dwc:occurrenceMeasurementAccuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Modifié	2009-10-09
Label	Occurrence Measurement Accuracy
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Définition	The description of the error associated with the occurrenceAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Modifié	2009-10-09
Label	Occurrence Measurement Determined By
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The agent responsible for having determined the value of the measurement or characteristic of the occurrence.
Notes	Example: "Javier de la Torre"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementDeterminedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Modifié	2009-10-09
Label	Occurrence Measurement Determined Date
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Définition	The date on which the the measurement or characteristic of the occurrence was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementID
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementID
Modifié	2009-10-09
Label	Occurrence Measurement ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementID
Définition	An identifier for the occurrence attribute. May be a global unique identifier or an identifier specific to the data set.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementRemarks
Modifié	2009-10-09
Label	Occurrence Measurement Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementRemarks
Définition	Comments or notes accompanying the measurement or characteristic of the occurrence.
Notes	Example: "tip of tail missing"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementType
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementType
Modifié	2009-10-09
Label	Occurrence Measurement Type
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementType
Définition	The nature of the measurement or characteristic of the occurrence. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "tail length"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Modifié	2009-10-09
Label	Occurrence Measurement Unit
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementUnit
Définition	The units for the value of the measurement or characteristic of the occurrence. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "mm"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété

Nom du Terme dwc:occurrenceMeasurementValue
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Modifié	2009-10-09
Label	Occurrence Measurement Value
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/measurementValue
Définition	The value of the measurement or characteristic of the occurrence.
Notes	Example: "45"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type	Propriété

Nom du Terme dwc:occurrenceRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/occurrenceRemarks-2023-06-28
Label	Remarques sur l'occurrence
Définition	Commentaires ou notes sur le dwc:Occurence.
Exemples	`found dead on road`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Notes
Type	Propriété

Nom du Terme dwciri:occurrenceStatus
IRI du terme	http://rs.tdwg.org/dwc/iri/occurrenceStatus
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/occurrenceStatus-2026-05-26
Label	Occurrence Status (IRI)
Définition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:occurrenceStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/occurrenceStatus
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/occurrenceStatus-2026-05-26
Label	Statut de l'occurrence
Définition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`detected` `notDetected`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:order
IRI du terme	http://rs.tdwg.org/dwc/terms/order
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/order-2023-06-28
Label	Ordre
Définition	Le nom scientifique complet de l'ordre dans lequel le dwc:Taxon est classé.
Exemples	`Carnivora` `Monocleales`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = ordo
Type	Propriété

Nom du Terme dwc:Organism
IRI du terme	http://rs.tdwg.org/dwc/terms/Organism
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Organism-2026-05-26
Label	Organisme
Définition	Un organisme particulier ou groupe défini d'organismes considérés comme homogènes sur le plan taxonomique.
Notes	Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Exemples	`a specific bird` `a specific wolf pack` `a specific instance of a bacterial culture` `a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection`
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismID
IRI du terme	http://rs.tdwg.org/dwc/terms/organismID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismID-2023-06-28
Label	Identifiant de l’organisme
Définition	Un identifiant de l'instance de dwc:Organism (par opposition à un enregistrement numérique particulier du dwc:Organism). Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données.
Exemples	`http://arctos.database.museum/guid/WNMU:Mamm:1249`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Nom du Terme dwc:OrganismInteraction
IRI du terme	http://rs.tdwg.org/dwc/terms/OrganismInteraction
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/OrganismInteraction-2026-05-26
Label	Organism Interaction
Définition	An interaction between two dwc:Organisms during a dwc:Event.
Notes	Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
Exemples	`a bee visiting a flower` `a Mallophora ruficauda hunting an Apis mellifera in flight` `a viral infection in a plant` `a female spider mating with a male spider` `a lion cub nursing from its mother` `a mosquito sucking blood from a chimpanzee's arm` `a slug eating a fungus growing on decomposing stump (2 interactions)`
Équivalent dans ABCD	/abcd:DataSets/abcd:DataSet/abcd:Units/abcd:Unit/abcd:Associations/abcd:UnitAssociation
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismInteractionDescription
IRI du terme	http://rs.tdwg.org/dwc/terms/organismInteractionDescription
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismInteractionDescription-2026-05-26
Label	Organism Interaction Description
Définition	A verbatim description of a dwc:OrganismInteraction.
Exemples	`Mallophora ruficauda captured an Apis mellifera worker in flight.`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismInteractionID
IRI du terme	http://rs.tdwg.org/dwc/terms/organismInteractionID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismInteractionID-2026-05-26
Label	Organism Interaction ID
Définition	An identifier for a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismInteractionType
IRI du terme	http://rs.tdwg.org/dwc/terms/organismInteractionType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismInteractionType-2026-05-26
Label	Organism Interaction Type
Définition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`visitedFlowerOf` `parasitized` `matedWith` `wasAttachedTo`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:organismInteractionType
IRI du terme	http://rs.tdwg.org/dwc/iri/organismInteractionType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/organismInteractionType-2026-05-26
Label	Organism Interaction Type (IRI)
Définition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismName
IRI du terme	http://rs.tdwg.org/dwc/terms/organismName
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismName-2023-06-28
Label	Nom de l'organisme
Définition	Nom littéral ou étiquette attribuée à une instance de dwc:Organism.
Exemples	`Huberta` `Boab Prison Tree` `J pod`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Nom du Terme dwc:organismQuantity
IRI du terme	http://rs.tdwg.org/dwc/terms/organismQuantity
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismQuantity-2023-06-28
Label	Nombre d'organismes
Définition	Un nombre ou une valeur numérique pour la quantité de dwc:Organisms.
Notes	Une dwc:organismQuantity doit avoir un dwc:organismQuantityType correspondant.
Exemples	`27` (organismQuantity) avec `individuals` [individus] (organismQuantityType) `12.5` (organismQuantity) avec `% biomass` [% de biomasse] (organismQuantityType) `r` (organismQuantity) avec `Braun-Blanquet Scale` [échelle de Braun-Blanquet] (organismQuantityType) `many` [plusieurs] (organismQuantity) avec `individuals` [individus] (organismQuantityType)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Nom du Terme dwciri:organismQuantityType
IRI du terme	http://rs.tdwg.org/dwc/iri/organismQuantityType
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/organismQuantityType-2015-03-27
Label	Organism Quantity Type (IRI)
Définition	The type of quantification system used for the quantity of organisms.
Notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:organismQuantityType
IRI du terme	http://rs.tdwg.org/dwc/terms/organismQuantityType
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismQuantityType-2023-06-28
Label	Type de la quantité d'organismes
Définition	Le type de système de mesure utilisé pour la quantification des dwc:Organisms.
Notes	Un dwc:organismQuantityType doit avoir un dwc:organismQuantity correspondant. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`27` (organismQuantity) avec `individuals` [individus] (organismQuantityType) `12.5` (organismQuantity) avec `% biomass` [% de biomasse] (organismQuantityType) `r` (organismQuantity) avec `Braun-Blanquet Scale` [échelle de Braun-Blanquet] (organismQuantityType) `many` [plusieurs] (organismQuantity) avec `individuals` [individus] (organismQuantityType)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Nom du Terme dwc:organismRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/organismRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismRemarks-2023-06-28
Label	Remarques sur l’organisme
Définition	Commentaires ou notes sur l'instance de dwc:Organism.
Exemples	`One of a litter of six`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Nom du Terme dwciri:organismScope
IRI du terme	http://rs.tdwg.org/dwc/iri/organismScope
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/organismScope-2026-05-26
Label	Organism Scope (IRI)
Définition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes	Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:organismScope
IRI du terme	http://rs.tdwg.org/dwc/terms/organismScope
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/organismScope-2023-06-28
Label	Périmètre de l'organisme
Définition	Une description du type d'instance de dwc:Organism. Peut être utilisée pour indiquer si l'instance de dwc:Organism représente un organisme isolé ou si elle représente un type particulier d'agrégat ou de regroupement.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme n'est pas destiné à être utilisé pour spécifier un type de dwc:Taxon. Pour décrire le type de dwc:Organism à l'aide d'un objet URI en RDF, utilisez plutôt rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type).
Exemples	`multicellular organism` `virus` `clone` `pack` `colony`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Nom du Terme dwc:originalNameUsage
IRI du terme	http://rs.tdwg.org/dwc/terms/originalNameUsage
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/originalNameUsage-2023-06-28
Label	Usage original du nom
Définition	Le nom du taxon, avec les informations relatives à l'auteur et à la date si elles sont connues, tel qu'il apparaissait à l'origine lorsqu'il a été établi pour la première fois selon les règles du dwc:nomenclaturalCode associé. Le basionyme (botanique) ou le basonyme (bactériologie) du dwc:scientificName ou l'homonyme senior pour les noms remplacés.
Notes	Le nom scientifique complet, avec les informations relatives à l'auteur et à la date si elles sont connues, de l'usage du nom dans lequel l'élément terminal du dwc:scientificName a été établi à l'origine selon les règles du dwc:nomenclaturalCode associé. Par exemple, pour les noms régis par le ICNafp, ce terme indiquerait le basionyme d'un enregistrement lié à une combinaison subséquente. Contrairement aux basionymes, ce terme peut s'appliquer aux noms scientifiques de tous rangs.
Exemples	`Pinus abies` `Gasterosteus saltatrix Linnaeus 1768`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:originalNameUsageID
IRI du terme	http://rs.tdwg.org/dwc/terms/originalNameUsageID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/originalNameUsageID-2023-06-28
Label	Identifiant de l'usage original du nom
Définition	Un identifiant pour l'usage du nom (signification documentée du nom selon une source) dans lequel l'élément terminal du dwc:scientificName a été établi à l'origine selon les règles du dwc:nomenclaturalCode associé.
Notes	Ce terme devrait être utilisé pour désigner le dwc:taxonID d'un enregistrement dwc:Taxon qui représente l'usage de l'élément terminal du dwc:scientificName tel qu'il a été établi à l'origine selon les règles du dwc:nomenclaturalCode associé. Par exemple, pour les noms régis par l'ICNafp, ce terme établirait la relation entre un enregistrement représentant une combinaison subséquente et l'enregistrement du basionyme correspondant. Contrairement aux basionymes, ce terme peut s'appliquer aux noms scientifiques de tous rangs. Pour les archives Darwin Core, l'enregistrement correspondant doit être présent localement dans la même archive.
Exemples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:otherCatalogNumbers
IRI du terme	http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/otherCatalogNumbers-2026-05-26
Label	Autres numéros de catalogue
Définition	A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Notes	La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`FMNH:Mammal:1234` `NPS YELLO6778 \| MBG 33424`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/History/PreviousUnitsText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:ownerInstitutionCode
IRI du terme	http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/ownerInstitutionCode-2026-05-26
Label	Code de l'institution propriétaire
Définition	A name (or acronym) in use by an institution having ownership of a resource.
Exemples	`NPS` `APN` `InBio`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:parentEventID
IRI du terme	http://rs.tdwg.org/dwc/terms/parentEventID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/parentEventID-2026-05-26
Label	Identifiant de l'événement parent
Définition	An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
Notes	Recommended best practice is to use a globally unique identifier.
Exemples	`A1` (parentEventID pour identifier la parcelle principale de Whittaker dans les échantillons imbriqués, chacun avec son propre eventID - `A1:1`, `A1:2`).
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2015-03-19_18
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:parentMeasurementID
IRI du terme	http://rs.tdwg.org/dwc/terms/parentMeasurementID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/parentMeasurementID-2023-06-28
Label	Identifiant de la mesure parente
Définition	Un identifiant pour un dwc:MeasurementOrFact plus large qui comprend ce dwc:MeasurementOrFact et potentiellement d'autres dwc:MeasurementOrFacts.
Notes	Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données.
Exemples	`9c752d22-b09a-11e8-96f8-529269fb1459` `E1_E1_O1_M1`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dwc:parentNameUsage
IRI du terme	http://rs.tdwg.org/dwc/terms/parentNameUsage
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/parentNameUsage-2023-06-28
Label	Usage du nom parent
Définition	Le nom complet, avec les informations relatives à l'auteur et à la date, si elles sont connues, du dwc:Taxon directement de rang supérieur (dans une classification) à l'élément le moins inclusif du dwc:scientificName.
Exemples	`Rubiaceae` `Gruiformes` `Testudinae`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Propriété

Nom du Terme dwc:parentNameUsageID
IRI du terme	http://rs.tdwg.org/dwc/terms/parentNameUsageID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/parentNameUsageID-2023-06-28
Label	Identifiant de l'usage du nom parent
Définition	Un identifiant pour l'usage du nom (signification documentée du nom selon une source) du taxon de rang supérieur direct (dans une classification) de l'élément le moins inclusif du dwc:scientificName.
Notes	Ce terme devrait être utilisé pour les noms acceptés pour se référer au dwc:taxonID d'un enregistrement dwc:Taxon qui représente le taxon de rang immédiatement supérieur dans la même classification. Pour les Archives Darwin Core, l'enregistrement correspondant doit être présent dans la même archive.
Exemples	`tsn:41074` (ITIS) `urn:lsid:ipni.org:names:30001404-2` (IPNI) `2704173` (GBIF) `6T8N` (COL)
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:pathway
IRI du terme	http://rs.tdwg.org/dwc/iri/pathway
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/pathway-2025-07-10
Label	Pathway (IRI)
Définition	The process by which a dwc:Organism came to be in a given place at a given time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Exemples	`http://rs.tdwg.org/dwcpw/values/p002` `http://rs.tdwg.org/dwcpw/values/p046`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_23
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:pathway
IRI du terme	http://rs.tdwg.org/dwc/terms/pathway
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/pathway-2023-06-28
Label	Voie d'accès
Définition	Le processus par lequel un dwc:Organism s'est retrouvé à un endroit donné à un moment donné.
Notes	La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/pw/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`releasedForUse` `otherEscape` `transportContaminant` `transportStowaway` `corridor` `unaided`
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2020-10-13_23

Nom du Terme dwc:phylum
IRI du terme	http://rs.tdwg.org/dwc/terms/phylum
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/phylum-2023-06-28
Label	Phylum (Embranchement)
Définition	Le nom scientifique complet du phylum (embranchement) ou division dans lequel le dwc:Taxon est classé.
Exemples	`Chordata` (phylum) `Bryophyta` (division)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = phylum
Type	Propriété

Nom du Terme dwc:pointRadiusSpatialFit
IRI du terme	http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/pointRadiusSpatialFit-2026-05-26
Label	Ajustement du centre et du rayon
Définition	A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Exemples	`0` `1` `1.5708`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/PointRadiusSpatialFit
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:preferredSpatialRepresentation
IRI du terme	http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/preferredSpatialRepresentation-2026-05-26
Label	Preferred Spatial Representation
Définition	An indication of which spatial representation best represents the dcterms:Location.
Exemples	`point-radius` `footprint`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:preferredSpatialRepresentation
IRI du terme	http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/preferredSpatialRepresentation-2026-05-26
Label	Preferred Spatial Representation (IRI)
Définition	An indication of which spatial representation best represents the dcterms:Location.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:preparations
IRI du terme	http://rs.tdwg.org/dwc/terms/preparations
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/preparations-2026-05-26
Label	Procédés de préparation
Définition	Une liste (concaténée et séparée) de procédés de préparation et de conservation pour une dwc:MaterialEntity.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`fossil` `cast` `photograph` `DNA extract` `skin \| skull \| skeleton` `whole animal (EtOH) \| tissue (EDTA)`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/Preparations/PreparationsText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:preparations
IRI du terme	http://rs.tdwg.org/dwc/iri/preparations
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/preparations-2025-07-10
Label	Preparations (IRI)
Définition	A preparation or preservation method for a specimen.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:PreservedSpecimen
IRI du terme	http://rs.tdwg.org/dwc/terms/PreservedSpecimen
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/PreservedSpecimen-2023-09-18
Label	Spécimen en collection
Définition	Un spécimen conservé.
Exemples	`a plant on an herbarium sheet` `a cataloged lot of fish in a jar`
Équivalent dans ABCD	RecordBasisEnum/PreservedSpecimen
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwc:PreviousIdentifications
IRI du terme	http://rs.tdwg.org/dwc/terms/PreviousIdentifications
Modifié	2009-04-24
Label	Previous Identifications
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/previousIdentifications
Définition	A list (concatenated and separated) of previous ScientificNames to which the sample was identified.
Notes	Example: "Anthus correndera".
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type	Propriété

Nom du Terme dwc:previousIdentifications
IRI du terme	http://rs.tdwg.org/dwc/terms/previousIdentifications
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/previousIdentifications-2023-06-28
Label	Identifications précédentes
Définition	Une liste (concaténée et séparée) des attributions précédentes de noms au dwc:Organism.
Notes	La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`Chalepidae` `Pinus abies` `Anthus sp., field ID by G. Iglesias \| Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwc:processedTotalReadCount
IRI du terme	http://rs.tdwg.org/dwc/terms/processedTotalReadCount
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/processedTotalReadCount-2026-05-26
Label	Processed Total Read Count
Définition	The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Exemples	`50638`, `345987`, `764032`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:projectID
IRI du terme	http://rs.tdwg.org/dwc/terms/projectID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/projectID-2026-05-26
Label	Identifiant du Projet
Définition	Une liste (concaténée et séparée) d'identifiants pour les projets qui ont contribué à un dwc:Event.
Notes	A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`https://arvenetternansen.com/` `https://doi.org/10.26259/3b15eca7` `https://doi.org/10.3030/101180559` `OC202405` `RCN276730` `RCN276730 \| Artsproject_7-24`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:projectTitle
IRI du terme	http://rs.tdwg.org/dwc/terms/projectTitle
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/projectTitle-2026-05-26
Label	Titre du Projet
Définition	Une liste (concaténée et séparée) de titres ou de noms de projets qui ont contribué à un dwc:Event.
Notes	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Exemples	`Arctic Deep` `Scalidophora i Noreg` `The Nansen Legacy` `Underwater Oases of the Mar del Plata Canyon: Talud Continental IV`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Project/ProjectTitle
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Protocol
IRI du terme	http://rs.tdwg.org/dwc/terms/Protocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Protocol-2026-05-26
Label	Protocol
Définition	A method used during an action.
Exemples	`a pitfall trap method for sampling ground-dwelling arthropods` `a point-radius georeferencing method` `a linear regression model to estimate body mass from skeletal measurements` `a Bayesian phylogenetic inference method`
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:protocolDescription
IRI du terme	http://rs.tdwg.org/dwc/terms/protocolDescription
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/protocolDescription-2026-05-26
Label	Protocol Description
Définition	A detailed description of a dwc:Protocol.
Exemples	`Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:protocolID
IRI du terme	http://rs.tdwg.org/dwc/terms/protocolID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/protocolID-2026-05-26
Label	Protocol ID
Définition	An identifier for a dwc:Protocol.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:protocolReferences
IRI du terme	http://rs.tdwg.org/dwc/terms/protocolReferences
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/protocolReferences-2026-05-26
Label	Références au Protocole
Définition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
Exemples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:protocolRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/protocolRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/protocolRemarks-2026-05-26
Label	Protocol Remarks
Définition	Comments or notes about a dwc:Protocol.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:protocolType
IRI du terme	http://rs.tdwg.org/dwc/terms/protocolType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/protocolType-2026-05-26
Label	Protocol Type
Définition	A category that best matches the nature of a dwc:Protocol.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`measurement` `georeference` `chronometricAge` `chronometricAgeConversion` `samplingEffort`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:protocolType
IRI du terme	http://rs.tdwg.org/dwc/iri/protocolType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/protocolType-2026-05-26
Label	Protocol Type (IRI)
Définition	A category that best matches the nature of a dwc:Protocol.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:Provenance
IRI du terme	http://rs.tdwg.org/dwc/terms/Provenance
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Provenance-2026-05-26
Label	Provenance
Définition	Information about an entity’s origins.
Notes	This is a convenience class to group related properties.
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:readCount
IRI du terme	http://rs.tdwg.org/dwc/terms/readCount
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/readCount-2026-05-26
Label	Read Count
Définition	The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Exemples	`325` `73591` `8302`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:recordedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/recordedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/recordedBy-2026-05-26
Label	Enregistré par
Définition	A name for a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `Megatherium Club` `The Natural History Society of Northumbria` `ROV SuBastian`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/GatheringAgents/GatheringAgentsText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:recordedBy
IRI du terme	http://rs.tdwg.org/dwc/iri/recordedBy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/recordedBy-2026-05-26
Label	Recorded By (IRI)
Définition	An IRI identifying a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:recordedByID
IRI du terme	http://rs.tdwg.org/dwc/terms/recordedByID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/recordedByID-2026-05-26
Label	Identifiant de l'enregistreur
Définition	An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence.
Notes	La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( `\|` ).
Exemples	`https://orcid.org/0000-0002-1825-0097` (pour un individu) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (pour une liste de personnes)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:recordNumber
IRI du terme	http://rs.tdwg.org/dwc/iri/recordNumber
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/recordNumber-2023-06-28
Label	Record Number (IRI)
Définition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number.
Notes	The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:recordNumber
IRI du terme	http://rs.tdwg.org/dwc/terms/recordNumber
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/recordNumber-2023-06-28
Label	Numéro d'enregistrement
Définition	Un identifiant donné à la dwc:Occurrence au moment où elle a été enregistrée. Il sert souvent de lien entre les notes de terrain et l'enregistrement d'une dwc:Occurrence, comme le numéro de terrain d'un spécimen.
Notes	Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`OPP 7101`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/CollectorsFieldNumber
Type	Propriété

Nom du Terme dwc:referenceID
IRI du terme	http://rs.tdwg.org/dwc/terms/referenceID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/referenceID-2026-05-26
Label	Reference ID
Définition	An identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:referenceRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/referenceRemarks
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/referenceRemarks-2026-05-26
Label	Reference Remarks
Définition	Comments or notes about a dcterms:BibliographicResource.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dcterms:references
IRI du terme	http://purl.org/dc/terms/references
Modifié	2026-05-26
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#references-003
Label	Références
Définition	Une ressource apparentée qui est référencée, citée ou pointée d'une autre manière par la ressource décrite.
Notes	From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
Exemples	`http://arctos.database.museum/guid/MVZ:Mamm:165861` (MaterialEntity example) `https://www.catalogueoflife.org/data/taxon/32664 (Taxon example)`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2011-10-16_7
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:referenceType
IRI du terme	http://rs.tdwg.org/dwc/terms/referenceType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/referenceType-2026-05-26
Label	Type de Référence
Définition	A category that best matches the nature of a dcterms:BibliographicResource.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`book`, `bookSection`, `journalArticle`, `thesis` `proceedingsPaper` `report` `poster` `fieldNotebook` `log` `oralCommunication`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:RelatedBasisOfRecord
IRI du terme	http://rs.tdwg.org/dwc/terms/RelatedBasisOfRecord
Modifié	2009-01-26
Label	Related Basis of Record
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The nature of the related resource. Recommended best practice is to use the same controlled vocabulary as for basisOfRecord.
Notes	Example: "PreservedSpecimen"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:relatedResourceID
IRI du terme	http://rs.tdwg.org/dwc/terms/relatedResourceID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relatedResourceID-2026-05-26
Label	Identifiant de la ressource liée
Définition	An identifier for the related resource (the object) of a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
Exemples	`dc609808-b09b-11e8-96f8-529269fb1459`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:relatedResourceType
IRI du terme	http://rs.tdwg.org/dwc/terms/relatedResourceType
Modifié	2009-10-09
Label	Related Resource Type
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The type of the related resource. Recommended best practice is to use a controlled vocabulary.
Notes	Examples: "StillImage", "MovingImage", "Sound", PhysicalObject", "PreservedSpecimen", FossilSpecimen", LivingSpecimen", "HumanObservation", "MachineObservation", "Location", "Taxonomy", "NomeclaturalChecklist", "Publication"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:relationshipAccordingTo
IRI du terme	http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Modifié	2018-09-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relationshipAccordingTo-2018-09-06
Label	Relation selon
Définition	La source (personne, organisation, publication, référence) établissant la relation entre les deux ressources.
Exemples	`Julie Woodruff`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:relationshipEstablishedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relationshipEstablishedDate-2025-06-12
Label	Date d'établissement de la relation
Définition	Date à laquelle la relation entre les deux ressources a été établie.
Notes	La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019.
Exemples	`1963-03-08T14:07-0600` (8 mars 1963 à ou après 14h07 mais avant 14h08 dans le fuseau horaire six heures plus tôt que l'UTC) `2009-02-20T08:40Z` (20 février 2009 à ou après 8h40 mais avant 8h41 UTC) `2018-08-29T15:19` (29 août 2018 à ou après 15h19 mais avant 15h20 heure locale) `1809-02-12` (durant le 12 février 1809) `1906-06` (durant le mois de juin 1906) `1971` (durant l'année 1971) ;`2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (durant une période comprise entre le 1er mars 2007, 13h UTC, et le 11 mai 2008, 15h30 UTC) `1900/1909` (durant une période comprise entre le début de l'année 1900 et la fin de l'année 1909) `2007-11-13/15` (durant une période comprise entre le début du 13 novembre 2007 et avant le 15 novembre 2007)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:relationshipOfResource
IRI du terme	http://rs.tdwg.org/dwc/terms/relationshipOfResource
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relationshipOfResource-2023-06-28
Label	Relation entre les ressources
Définition	La relation entre le sujet (identifié par dwc:resourceID) et l'objet (identifié par dwc:relatedResourceID).
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`same as` `duplicate of` `mother of` `offspring of` `sibling of` `parasite of` `host of` `valid synonym of` `located within` `pollinator of members of taxon` `pollinated specific plant` `pollinated by members of taxon` `on slab with`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociationType
Type	Propriété

Nom du Terme dwc:relationshipOfResourceID
IRI du terme	http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relationshipOfResourceID-2023-06-28
Label	Identifiant de la relation entre les ressources
Définition	Un identifiant pour le type de relation (prédicat) qui relie le sujet identifié par dwc:resourceID à son objet identifié par dwc:relatedResourceID.
Notes	La pratique optimale recommandée est d'utiliser les identifiants des termes d'un vocabulaire contrôlé, tel que l'ontologie des relations de l'OBO.
Exemples	`http://purl.obolibrary.org/obo/RO_0002456` (pour la relation `pollinated by` [pollinisé par]) `http://purl.obolibrary.org/obo/RO_0002455` (pour la relation `pollinates` [pollinise]) `https://www.inaturalist.org/observation_fields/879` (pour la relation `eaten by` [mangé par])
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Nom du Terme dwc:relationshipRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/relationshipRemarks
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/relationshipRemarks-2023-06-28
Label	Remarques sur les relations
Définition	Commentaires ou notes sur la relation entre les deux ressources.
Exemples	`mother and offspring collected from the same nest` `pollinator captured in the act`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/Comments
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwciri:reproductiveCondition
IRI du terme	http://rs.tdwg.org/dwc/iri/reproductiveCondition
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/reproductiveCondition-2026-05-26
Label	Reproductive Condition (IRI)
Définition	A reproductive condition of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:reproductiveCondition
IRI du terme	http://rs.tdwg.org/dwc/terms/reproductiveCondition
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/reproductiveCondition-2026-05-26
Label	État reproductif
Définition	A reproductive condition of a dwc:Organism.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`non-reproductive` `pregnant` `in bloom` `fruit-bearing`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:resourceID
IRI du terme	http://rs.tdwg.org/dwc/terms/resourceID
Modifié	2018-09-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/resourceID-2018-09-06
Label	Identifiant de la ressource
Définition	Un identifiant de la ressource qui prend part à la relation en tant que sujet.
Exemples	`f809b9e0-b09b-11e8-96f8-529269fb1459`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:ResourceRelationship
IRI du terme	http://rs.tdwg.org/dwc/terms/ResourceRelationship
Modifié	2023-09-13
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/ResourceRelationship-2023-09-13
Label	Relation entre les ressources
Définition	Une relation entre une rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) et une autre.
Notes	Les ressources peuvent être considérées comme des enregistrements reconnaissables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, ou dwc:Taxon.
Exemples	`an instance of a dwc:Organism is the mother of another instance of a dwc:Organism` `a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence` `a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Associations
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Nom du Terme dwc:resourceRelationshipID
IRI du terme	http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/resourceRelationshipID-2026-05-26
Label	Identifiant de relation entre les ressources
Définition	An identifier for a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dcterms:rights
IRI du terme	http://purl.org/dc/terms/rights
Modifié	2008-01-14
Label	Rights
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://purl.org/dc/terms/license
Définition	Information about rights held in and over the resource.
Notes	Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-11-06_17
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dcterms:rightsHolder
IRI du terme	http://purl.org/dc/terms/rightsHolder
Modifié	2008-01-14
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#rightsHolder-002
Label	Titulaire des Droits
Définition	Personne ou organisation possédant ou gérant des droits sur la ressource.
Exemples	`The Regents of the University of California`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:Sample
IRI du terme	http://rs.tdwg.org/dwc/terms/Sample
Modifié	2009-04-29
Label	Sample
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/Occurrence
Définition	Container class for information about the results of a sampling event (specimen, observation, etc.)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit
Type	Classe

Nom du Terme dwc:SampleAttribute
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttribute
Modifié	2009-04-29
Label	Sample Attribute
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Container class for information about attributes related to a given sample.
Équivalent dans ABCD	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type	Classe

Nom du Terme dwc:SampleAttributeAccuracy
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeAccuracy
Modifié	2009-04-29
Label	Sample Attribute Accuracy
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Définition	The description of the error associated with the SampleAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Propriété

Nom du Terme dwc:SampleAttributeDeterminedBy
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedBy
Modifié	2009-04-29
Label	Sample Attribute Determined By
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Définition	The agent responsible for having determined the value of the measurement or characteristic of the sample.
Notes	Example: "Javier de la Torre"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type	Propriété

Nom du Terme dwc:SampleAttributeDeterminedDate
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedDate
Modifié	2009-04-29
Label	Sample Attribute Determined Date
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Définition	The date on which the the measurement or characteristic of the sample was made.
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type	Propriété

Nom du Terme dwc:SampleAttributeRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeRemarks
Modifié	2009-04-29
Label	Sample Attribute Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Comments or notes accompanying the measurement or characteristic of the sample.
Notes	Example: "tip of tail missing"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:SampleAttributeUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeUnit
Modifié	2009-04-29
Label	Sample Attribute Unit
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Définition	The units for the value of the measurement or characteristic of the sample. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "mm"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Propriété

Nom du Terme dwc:SampleAttributeValue
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleAttributeValue
Modifié	2009-04-29
Label	Sample Attribute Value
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Définition	The value of the measurement or characteristic of the sample.
Notes	Example: "45"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type	Propriété

Nom du Terme dwciri:sampledSubstrateCategory
IRI du terme	http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateCategory-2026-05-26
Label	Sampled Substrate Category (IRI)
Définition	A category or type of substrate sampled during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:sampledSubstrateCategory
IRI du terme	http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateCategory-2026-05-26
Label	Sampled Substrate Category
Définition	A category or type of substrate sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`vegetation` `soil` `ocean`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:sampledSubstrateLayer
IRI du terme	http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateLayer-2026-05-26
Label	Sampled Substrate Layer
Définition	A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`forest floor` `herbaceous \| shrub` `understory` `canopy` `organic (O)` `surface (A)` `eluviated (E)` `subsoil (B)` `parent material (C)` `bedrock (R)` `epipelagic \| mesopelagic` `bathypelagic` `abysopelagic` `hadalpelagic`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:sampledSubstrateLayer
IRI du terme	http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateLayer-2026-05-26
Label	Sampled Substrate Layer (IRI)
Définition	An IRI identifying a substrate layer sampled during a dwc:Event.
Notes	Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:SampleRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/SampleRemarks
Modifié	2009-04-29
Label	Sample Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Définition	Comments or notes about the sample or record.
Notes	Example: "found dead on road"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Notes
Type	Propriété

Nom du Terme dwc:sampleSizeUnit
IRI du terme	http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sampleSizeUnit-2023-06-28
Label	Unité de la taille de l'échantillon
Définition	L'unité d'une mesure de la taille (durée, longueur, surface ou volume) d'un échantillon dans un dwc:Event d'échantillonnage.
Notes	Une dwc:sampleSizeUnit doit avoir une dwc:sampleSizeValue correspondante, par exemple, `5` pour dwc:sampleSizeValue avec `m` pour dwc:sampleSizeUnit. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`minute` `hour` `day` `metre` `square metre` `cubic metre`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Nom du Terme dwciri:sampleSizeUnit
IRI du terme	http://rs.tdwg.org/dwc/iri/sampleSizeUnit
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/sampleSizeUnit-2025-07-10
Label	Sampling Size Unit (IRI)
Définition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:sampleSizeValue
IRI du terme	http://rs.tdwg.org/dwc/terms/sampleSizeValue
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sampleSizeValue-2023-06-28
Label	Valeur de la taille de l'échantillon
Définition	Une valeur numérique pour une mesure de la taille (durée, longueur, surface ou volume) d'un échantillon dans un dwc:Event d'échantillonnage.
Notes	Une dwc:sampleSizeValue doit avoir une dwc:sampleSizeUnit correspondante.
Exemples	`5` (sampleSizeValue) avec `metre` [mètre] (sampleSizeUnit)
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Nom du Terme dwc:SamplingAttributeID
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingAttributeID
Modifié	2009-04-29
Label	Sample Attribute ID
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	An identifier for the sampling attribute. May be a global unique identifier or an identifier specific to the data set.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:SamplingAttributeType
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Modifié	2009-04-29
Label	Sample Attribute Type
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	The nature of the measurement or characteristic of the sample. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "tail length"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Propriété

Nom du Terme dwc:samplingEffort
IRI du terme	http://rs.tdwg.org/dwc/terms/samplingEffort
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/samplingEffort-2023-06-28
Label	Pression d'échantillonnage
Définition	La quantité d'efforts déployés au cours d'un dwc:Event.
Exemples	`40 trap-nights` `10 observer-hours` `10 km by foot` `30 km by car`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:SamplingEvent
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingEvent
Modifié	2009-04-29
Label	Sampling Event
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/Event
Définition	Container class for information about the conditions and methods of acquisition of samples.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering
Type	Classe

Nom du Terme dwc:SamplingEventAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingEventAttributes
Modifié	2009-04-29
Label	Sampling Event Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements or characteristics of the sampling event.
Notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Propriété

Nom du Terme dwc:SamplingEventID
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingEventID
Modifié	2009-04-29
Label	Sampling Event ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventID
Définition	An identifier for the sampling event. May be a global unique identifier or an identifier specific to the data set.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Propriété

Nom du Terme dwc:SamplingEventRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingEventRemarks
Modifié	2009-04-29
Label	Sampling Event Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Comments or notes about the sampling event.
Notes	Example: "found dead on road"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:SamplingLocation
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingLocation
Modifié	2009-04-29
Label	Sampling Location
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	Container class for information about the location where a sampling event occurred.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type	Classe

Nom du Terme dwc:SamplingLocationID
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingLocationID
Modifié	2009-04-29
Label	Sampling Location ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/locationID
Définition	An identifier for the sampling location. May be a global unique identifier or an identifier specific to the data set.
Notes	Example: "MVZ:LocID:12345"
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:SamplingLocationRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/SamplingLocationRemarks
Modifié	2009-04-29
Label	Sampling Location Remarks
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/locationRemarks
Définition	Comments or notes about the sampling location.
Notes	Example: "under water since 2005"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type	Propriété

Nom du Terme dwc:samplingProtocol
IRI du terme	http://rs.tdwg.org/dwc/terms/samplingProtocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/samplingProtocol-2026-05-26
Label	Protocole d'échantillonnage
Définition	Les noms, références ou descriptions des méthodes ou protocoles utilisés lors d'un dwc:Event.
Notes	Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`UV light trap` `mist net` `bottom trawl` `ad hoc observation \| point count` `Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x` `Takats et al. 2001. Guidelines for Nocturnal Owl Monitoring in North America. Beaverhill Bird Observatory and Bird Studies Canada, Edmonton, Alberta. 32 pp., http://www.bsc-eoc.org/download/Owl.pdf`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Method
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:samplingProtocol
IRI du terme	http://rs.tdwg.org/dwc/iri/samplingProtocol
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/samplingProtocol-2026-05-26
Label	Sampling Protocol (IRI)
Définition	The methods or protocols used during a dwc:Event, denoted by an IRI.
Notes	Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:scientificName
IRI du terme	http://rs.tdwg.org/dwc/terms/scientificName
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/scientificName-2026-05-26
Label	Nom scientifique
Définition	The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
Notes	This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign `×` (Unicode `U+00D7`, HTML `×`) to identify a hybrid, not `x` or `X`, if possible.
Exemples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship) `×Agropogon littoralis (Sm.) C. E. Hubb.` `Mentha ×smithiana R. A. Graham` `Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/FullScientificNameString
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:scientificNameAuthorship
IRI du terme	http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/scientificNameAuthorship-2023-06-28
Label	Auteur du nom scientifique
Définition	Les informations relatives à l'autorité du dwc:scientificName formatées selon les conventions du dwc:nomenclaturalCode correspondant.
Exemples	`(Torr.) J.T. Howell` `(Martinovský) Tzvelev` `(Györfi, 1952)`
Équivalent dans ABCD	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/ParentheticalAuthorTeamAndYear + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/AuthorTeamAndYear} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeamParenthesis + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeam} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamOriginalAndYear + [= or] DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamParenthesisAndYear}
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:scientificNameID
IRI du terme	http://rs.tdwg.org/dwc/terms/scientificNameID
Modifié	2017-10-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/scientificNameID-2017-10-06
Label	Identifiant du nom scientifique
Définition	Un identifiant pour les détails nomenclaturaux (et non taxonomiques) d'un nom scientifique.
Exemples	`urn:lsid:ipni.org:names:37829-1:1.3`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Nom du Terme dwc:scientificNameRank
IRI du terme	http://rs.tdwg.org/dwc/terms/scientificNameRank
Modifié	2009-09-21
Label	Scientific Name Rank
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/taxonRank
Définition	The taxonomic rank of the most specific name in the scientificName. Recommended best practice is to use a controlled vocabulary.
Notes	Examples: "subsp.", "var.", "forma", "species", "genus"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type	Propriété

Nom du Terme dwc:sequence
IRI du terme	http://rs.tdwg.org/dwc/terms/sequence
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sequence-2026-05-26
Label	Sequence
Définition	A string representing nucleotide base pairs.
Notes	Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
Exemples	`TCTATCCTCAATTATAGGTCATAATTCACCATCAG`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:sex
IRI du terme	http://rs.tdwg.org/dwc/terms/sex
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/sex-2026-05-26
Label	Sexe
Définition	A sex of a dwc:Organism.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`female` `male` `hermaphrodite`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Sex
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:sex
IRI du terme	http://rs.tdwg.org/dwc/iri/sex
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/sex-2026-05-26
Label	Sex (IRI)
Définition	A sex of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:siteNumber
IRI du terme	http://rs.tdwg.org/dwc/iri/siteNumber
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/siteNumber-2026-05-26
Label	Site Number (IRI)
Définition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:siteNumber
IRI du terme	http://rs.tdwg.org/dwc/terms/siteNumber
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/siteNumber-2026-05-26
Label	Site Number
Définition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`USGS CENO LOC 21387` `UCM 2025001`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:specificEpithet
IRI du terme	http://rs.tdwg.org/dwc/terms/specificEpithet
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/specificEpithet-2023-06-28
Label	Épithète spécifique
Définition	Le nom de la première épithète ou de l'épithète spécifique du dwc:scientificName.
Exemples	`concolor` `gottschei`
Équivalent dans ABCD	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SpeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SpeciesEpithet}
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:startDayOfYear
IRI du terme	http://rs.tdwg.org/dwc/terms/startDayOfYear
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/startDayOfYear-2026-05-26
Label	Premier jour pour une année donnée
Définition	The earliest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Exemples	`1` (1er janvier) `32` (1er février) `366` (31 décembre) `365` (30 décembre d'une année bissextile, 31 décembre d'une année commune)
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberBegin
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:StartTimeOfDay
IRI du terme	http://rs.tdwg.org/dwc/terms/StartTimeOfDay
Modifié	2009-04-24
Label	Start Time of Day
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/eventTime
Définition	The time of day when the event began, expressed as decimal hours from midnight, local time.
Notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
Équivalent dans ABCD	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Propriété

Nom du Terme dwc:stateProvince
IRI du terme	http://rs.tdwg.org/dwc/terms/stateProvince
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/stateProvince-2023-06-28
Label	Division de premier ordre
Définition	Le nom de la région administrative immédiatement inférieure au pays (état, province, canton, département, région, etc.) dans laquelle se trouve la dcterms:Location.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux.
Exemples	`Montana` `Minas Gerais` `Córdoba`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= State or = Province (etc.)
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:subfamily
IRI du terme	http://rs.tdwg.org/dwc/terms/subfamily
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/subfamily-2023-06-28
Label	Sous-famille
Définition	Le nom scientifique complet de la sous-famille dans laquelle le dwc:Taxon est classé.
Exemples	`Periptyctinae` `Orchidoideae` `Sphindociinae`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName if DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonRank == "subfamilia"
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Nom du Terme dwc:subgenus
IRI du terme	http://rs.tdwg.org/dwc/terms/subgenus
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/subgenus-2025-06-12
Label	Sous-genre
Définition	Le nom scientifique complet du sous-genre dans lequel le dwc:Taxon est classé.
Notes	La valeur de ce terme doit être un nom de sous-genre complet tel que requis par le code de nomenclature approprié.
Exemples	`Abacetus (Parastygis)` `Dicranum subgen. Orthodicranum`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:subtribe
IRI du terme	http://rs.tdwg.org/dwc/terms/subtribe
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/subtribe-2023-06-28
Label	Sous-tribu
Définition	Le nom scientifique complet de la sous-tribu dans laquelle le dwc:Taxon est classé.
Exemples	`Plotinini` `Typhaeini`
Équivalent dans ABCD	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dwc:superfamily
IRI du terme	http://rs.tdwg.org/dwc/terms/superfamily
Modifié	2023-07-07
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/superfamily-2023-07-07
Label	Super-famille
Définition	Le nom scientifique complet de la super-famille dans laquelle le dwc:Taxon est classé.
Notes	Une catégorie taxonomique subordonnée à un ordre et supérieure à une famille. Selon l'article 29.2 de l'ICZN, le suffixe `-oidea` est utilisé pour un nom de super-famille.
Exemples	`Achatinoidea` `Cerithioidea` `Helicoidea` `Hypsibioidea` `Valvatoidea` `Zonitoidea`
Équivalent dans ABCD	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: superfamilia)
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dwc:Taxon
IRI du terme	http://rs.tdwg.org/dwc/terms/Taxon
Modifié	2023-09-18
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/Taxon-2023-09-18
Label	Taxon
Définition	Groupe d'organismes (sensu http://purl.obolibrary.org/obo/OBI_0100026) considérés par les taxonomistes comme formant une unité homogène.
Exemples	`the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820`
Équivalent dans ABCD	no simple equivalent in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Nom du Terme dwc:taxonAccordingTo
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonAccordingTo
Modifié	2009-09-21
Label	Taxon According To
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/nameAccordingTo
Définition	Information about the authorship of this taxon concept which uses the scientificName in their sense (secundum, sensu). Could be a publication (identification key), institution or team of individuals.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:taxonAttributes
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonAttributes
Modifié	2009-10-09
Label	Taxon Attributes
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the taxon.
Notes	Example: "iucnstatus=vulnerable; distribution=Neuquen, Argentina"
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/InformalNameString
Type	Propriété

Nom du Terme dwc:taxonConceptID
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonConceptID
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonConceptID-2023-06-28
Label	Identifiant du concept de taxon
Définition	Un identifiant pour le concept taxonomique auquel l'enregistrement se réfère - pas pour les détails nomenclaturaux d'un dwc:Taxon.
Exemples	`8fa58e08-08de-4ac1-b69c-1235340b7001`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:taxonFormula
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonFormula
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonFormula-2026-05-26
Label	Taxon Formula
Définition	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`A` `not A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:taxonFormula
IRI du terme	http://rs.tdwg.org/dwc/iri/taxonFormula
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/taxonFormula-2026-05-26
Label	Taxon Formula (IRI)
Définition	A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:TaxonID
IRI du terme	http://rs.tdwg.org/dwc/terms/TaxonID
Modifié	2009-04-24
Label	Taxon ID
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/taxonNameID
Définition	A global unique identifier for the taxon (name in a classification).
Équivalent dans ABCD	not in ABCD
Type	Propriété

</tbody> </table>

Nom du Terme dwc:taxonID
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonID
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonID-2026-05-26
Label	Identifiant de taxon
Définition	An identifier for a dwc:Taxon.
Exemples	`8fa58e08-08de-4ac1-b69c-1235340b7001</li>` `32567</code>` `https://www.gbif.org/species/212 </ul></td> </tr>`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:taxonNameID
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonNameID
Modifié	2009-07-06
Label	Taxon Name ID
	Ce terme est obsolète et ne doit plus être utilisé.
Définition	A unique identifier for the scientificName.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:taxonomicStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonomicStatus
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonomicStatus-2023-06-28
Label	Statut taxonomique
Définition	Le statut de l'utilisation d'un dwc:scientificName comme étiquette pour un taxon. Cela nécessite un avis taxonomique pour définir le périmètre d'un dwc:Taxon. Les règles de priorité et l'avis des experts sont ensuite utilisées pour définir le statut taxonomique du nom donné à ce taxon. Ce statut doit être lié à une référence taxonomique spécifique qui définit le concept.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé.
Exemples	`invalid` `misapplied` `homotypic synonym` `accepted`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:taxonRank
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonRank
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonRank-2026-05-26
Label	Rang du taxon
Définition	Le rang taxonomique du nom le moins inclusif composant le dwc:scientificName .
Notes	Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
Exemples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:taxonRemarks
IRI du terme	http://rs.tdwg.org/dwc/terms/taxonRemarks
Modifié	2017-10-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/taxonRemarks-2017-10-06
Label	Remarques sur le taxon
Définition	Commentaires ou notes sur le taxon ou le nom.
Exemples	`this name is a misspelling in common use`
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:toDigitalSpecimen
IRI du terme	http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/toDigitalSpecimen-2025-06-12
Label	To Digital Specimen
Définition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:toTaxon
IRI du terme	http://rs.tdwg.org/dwc/iri/toTaxon
Modifié	2015-03-27
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/toTaxon-2015-03-27
Label	To Taxon
Définition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwc:tribe
IRI du terme	http://rs.tdwg.org/dwc/terms/tribe
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/tribe-2023-06-28
Label	Tribu
Définition	Le nom scientifique complet de la tribu dans laquelle le dwc:Taxon est classé.
Exemples	`Ortaliini` `Arethuseae`
Équivalent dans ABCD	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dc:type
IRI du terme	http://purl.org/dc/elements/1.1/type
Modifié	2025-06-12
IRI de la version du Terme	http://dublincore.org/usage/terms/history/#type-006
Label	Type
Définition	La nature ou le genre de la ressource.
Notes	Doit être rempli avec une valeur issue du vocabulaire DCMI type (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
Exemples	`StillImage` `MovingImage` `Sound` `PhysicalObject` `Event` `Text`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_20
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dcterms:type
IRI du terme	http://purl.org/dc/terms/type
Modifié	2008-01-14
Label	Type
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://purl.org/dc/elements/1.1/type
Définition	The nature or genre of the resource.
Notes	To provide a string literal value for type, use dc:type rather than this term. In accordance with the Darwin Core RDF guide, rdf:type should be used instead of this term to indicate an IRI value for type.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2009-12-07_1
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_20
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-02-24_55

Nom du Terme dwc:typeOfType
IRI du terme	http://rs.tdwg.org/dwc/terms/typeOfType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/typeOfType-2026-05-26
Label	Type Of Type
Définition	A category of nomenclatural type of a dwc:MaterialEntity.
Notes	The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Exemples	`holotype` `isotype`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/TypeStatus
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:typeStatus
IRI du terme	http://rs.tdwg.org/dwc/terms/typeStatus
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/typeStatus-2023-06-28
Label	Statut de typification
Définition	Une liste (concaténée et séparée) des dimensions liées à la typification (statut de type, nom scientifique typifié, publication) appliquées au sujet.
Notes	La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( `\|` ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Nom du Terme dwciri:typeStatus
IRI du terme	http://rs.tdwg.org/dwc/iri/typeStatus
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/typeStatus-2025-07-10
Label	Type Status (IRI)
Définition	A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwc:typifiedName
IRI du terme	http://rs.tdwg.org/dwc/terms/typifiedName
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/typifiedName-2026-05-26
Label	Nom Typifié
Définition	A scientific name for which a specimen or other name is the type.
Notes	The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
Exemples	`Polysiphonia amphibolis Womersley`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/TypifiedName
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:UsagePolicy
IRI du terme	http://rs.tdwg.org/dwc/terms/UsagePolicy
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/UsagePolicy-2026-05-26
Label	Usage Policy
Définition	Information about rights, usage, and attribution statements applicable to an entity.
Notes	This is a convenience class to group related properties.
Équivalent dans ABCD	not in ABCD
Type	Classe
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimAssertionType
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimAssertionType
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimAssertionType-2026-05-26
Label	Verbatim Assertion Type
Définition	A string representing the type of dwc:Assertion as it appeared in an original record.
Notes	This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimCoordinates
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinates-2026-05-26
Label	Verbatim des coordonnées
Définition	Verbatim original spatial coordinates of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Exemples	`41 05 54S 121 05 34W` `17T 630000 4833400`
Équivalent dans ABCD	{DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinatesText or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesUTM/UTMText}
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwciri:verbatimCoordinateSystem
IRI du terme	http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/verbatimCoordinateSystem-2026-05-26
Label	Verbatim Coordinate System (IRI)
Définition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimCoordinateSystem
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinateSystem-2026-05-26
Label	Verbatim du système de coordonnées
Définition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`decimal degrees` `degrees decimal minutes` `degrees minutes seconds` `UTM`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesGrid/GridCellSystem
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimDepth
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimDepth
Modifié	2017-10-06
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimDepth-2017-10-06
Label	Verbatim de la profondeur
Définition	La description originale de la profondeur sous la surface locale.
Exemples	`100-200 m`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactText
Type	Propriété

Nom du Terme dwc:verbatimElevation
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimElevation
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimElevation-2026-05-26
Label	Verbatim de l'altitude
Définition	An original description of the elevation of a dcterms:Location.
Exemples	`100-200 m`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimEventDate
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimEventDate
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimEventDate-2023-06-28
Label	Verbatim de la date de l'événement
Définition	La représentation originale tel quel des informations de date et d'heure pour un dwc:Event.
Exemples	`spring 1910` `Marzo 2002` `1999-03-XX` `17IV1934`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/DateTime/DateText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:verbatimIdentification
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimIdentification-2023-06-28
Label	Verbatim de l'identification
Définition	Une chaîne de caractères représentant l'identification taxonomique telle qu'elle apparaît dans l'enregistrement original.
Notes	Ce terme est destiné à permettre la saisie d'une identification/détermination originale non modifiée, y compris les qualificatifs d'identification, les formules hybrides, les incertitudes, etc. Ce terme doit être utilisé en complément de dwc:scientificName (et de dwc:identificationQualifier, etc.), et non en remplacement de ce dernier.
Exemples	`Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?` `Potentilla × pantotricha Soják` `Aconitum pilipes × A. variegatum` `Lepomis auritus x cyanellus`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Nom du Terme dwc:verbatimLabel
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimLabel
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimLabel-2026-05-26
Label	Verbatim de l'étiquette
Définition	A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
Notes	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
Équivalent dans ABCD	Marks/Mark/MarkText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimLatitude
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimLatitude
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimLatitude-2026-05-26
Label	Verbatim de la latitude
Définition	A verbatim original latitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Exemples	`41 05 54.03S`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLatitude
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimLocality
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimLocality
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimLocality-2026-05-26
Label	Verbatim de la localité
Définition	An original textual description of a dcterms:Location.
Exemples	`25 km NNE Bariloche por R. Nac. 237`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimLongitude
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimLongitude
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimLongitude-2026-05-26
Label	Verbatim de la longitude
Définition	A verbatim original longitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Exemples	`121d 10' 34" W`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLongitude
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verbatimMeasurementType
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimMeasurementType-2025-06-12
Label	Verbatim du Type de Mesure
Définition	Une chaîne de caractères représentant le type de mesure ou de fait tel qu'il apparaît dans l'enregistrement original.
Notes	Ce terme est destiné à permettre la saisie d'un nom original non modifié pour un type de mesure ou de fait. Ce terme est destiné à être utilisé en complément de dwc:measurementType, et non à sa place.
Exemples	`water_temp` `Fish biomass` `sampling net mesh size`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:verbatimScientificNameRank
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimScientificNameRank
Modifié	2009-09-21
Label	Verbatim Scientific Name Rank
	Ce terme est obsolète et ne doit plus être utilisé.
Est remplacé par	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Définition	The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
Notes	Examples: "Agamospecies", "sub-lesus", "prole", "apomict", "nothogrex".
Équivalent dans ABCD	not in ABCD
Type	Propriété

Nom du Terme dwciri:verbatimSRS
IRI du terme	http://rs.tdwg.org/dwc/iri/verbatimSRS
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/verbatimSRS-2025-06-12
Label	Verbatim SRS (IRI)
Définition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:verbatimSRS
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimSRS
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimSRS-2025-06-12
Label	Verbatim du Système de Référence Spatiale
Définition	L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel sont basées les coordonnées données dans dwc:verbatimLatitude et dwc:verbatimLongitude, ou dwc:verbatimCoordinates.
Notes	La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur `not recorded` (non documenté). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwc:verbatimTaxonRank
IRI du terme	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verbatimTaxonRank-2023-06-28
Label	Verbatim du rang du taxon
Définition	Le rang taxonomique du nom le moins inclusif composant le dwc:scientificName tel qu'il apparaît dans l'enregistrement original.
Exemples	`Agamospecies` `sub-lesus` `prole` `apomict` `nothogrex` `sp.` `subsp.` `var.`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Nom du Terme dwc:vernacularName
IRI du terme	http://rs.tdwg.org/dwc/terms/vernacularName
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/vernacularName-2026-05-26
Label	Nom vernaculaire
Définition	Un nom commun ou vernaculaire.
Exemples	`cóndor andino` `death cap` `rainbow trout` `Gänsegeier` `smoky quartz`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:verticalDatum
IRI du terme	http://rs.tdwg.org/dwc/terms/verticalDatum
Modifié	2025-06-12
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/verticalDatum-2025-06-12
Label	Référent altimétrique
Définition	Le référentiel altimétrique utilisé comme référence sur laquelle sont basées les valeurs des termes d'élévation.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`EGM84` `EGM96` `EGM2008` `PGM2000A` `PGM2004` `PGM2006` `PGM2007` `EPSG:7030` `not recorded`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Nom du Terme dwciri:verticalDatum
IRI du terme	http://rs.tdwg.org/dwc/iri/verticalDatum
Modifié	2025-07-10
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/verticalDatum-2025-07-10
Label	Vertical Datum (IRI)
Définition	The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Nom du Terme dwciri:vitality
IRI du terme	http://rs.tdwg.org/dwc/iri/vitality
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/iri/version/vitality-2026-05-26
Label	Vitality (IRI)
Définition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:vitality
IRI du terme	http://rs.tdwg.org/dwc/terms/vitality
Modifié	2026-05-26
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/vitality-2026-05-26
Label	En vie
Définition	Une indication sur le fait qu'un dwc:Organism était vivant ou mort au moment de la collecte ou de l'observation.
Notes	La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères.
Exemples	`alive` `dead` `mixedLot` `uncertain` `notAssessed`
Équivalent dans ABCD	not in ABCD
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Nom du Terme dwc:waterBody
IRI du terme	http://rs.tdwg.org/dwc/terms/waterBody
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/waterBody-2023-06-28
Label	Étendue d'eau
Définition	Le nom du plan d'eau dans laquelle se situe la dcterms:Location.
Notes	La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names.
Exemples	`Indian Ocean` `Baltic Sea` `Hudson River` `Lago Nahuel Huapi`
Équivalent dans ABCD	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Water body
Type	Propriété
Décision du Comité Exécutif	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Nom du Terme dwc:year
IRI du terme	http://rs.tdwg.org/dwc/terms/year
Modifié	2023-06-28
IRI de la version du Terme	http://rs.tdwg.org/dwc/terms/version/year-2023-06-28
Label	Année
Définition	L'année en quatre chiffres au cours de laquelle dwc:Event s'est produit, selon le calendrier de l'ère commune.
Exemples	`1160` `2008`
Équivalent dans ABCD	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Propriété

On this page

Liste des termes du Darwin Core

1 Introduction (À titre informatif)

1.1 Statut du contenu de ce document

1.2 Mots clés RFC 2119

1.3 Abréviation des espaces de noms

2 Utilisation des termes

3 Index des termes

3.1 Index par Noms des Termes

3.2 Index par Labels

4 Vocabulaire