Guide de Référence Rapide du Darwin Core
Guide de Référence Rapide du Darwin Core
Ce document se veut une référence facile à lire des termes actuellement (au 2023-09-18) recommandés dans le cadre du standard Darwin Core et est maintenu par le Groupe de maintenance du Darwin Core.
Besoin d’aide ? Pour en savoir plus sur l’utilisation du Darwin Core, consultez le site de questions et réponses sur le Darwin Core. Vous avez d’autres questions ? Soumettez un nouveau sujet (question/problème) à la page des demandes dwc-qa sur GitHub, ou utilisez le formulaire. Voir au bas de ce document comment citer le Darwin Core.”
Vous voulez contribuer ? Pour plus d’informations sur la manière de contribuer au standard Darwin Core, y compris sur la manière de proposer des changements, voir le guide pour contribuer.
Cette page ne fait pas partie du standard, mais combine les noms et définitions des termes normatifs avec les commentaires et exemples non normatifs destinés à aider les utilisateurs à se servir des termes de manière cohérente. Les définitions, les commentaires et les exemples peuvent inclure des abréviations de l’espace de noms (par exemple, « dwc : »). Ils sont inclus pour montrer que le sens du mot auquel ils sont attachés signifie très précisément le terme tel qu’il est défini dans cet espace de noms. Ainsi, dwc:Event signifie Event tel que défini par Darwin Core à l’adresse https://dwc.tdwg.org/terms/#event. Les termes en majuscules qui suivent l’abréviation d’un espace de nommage, comme dwc:Occurrence, sont des termes de classes Darwin Core, qui constituent une catégorie spéciale de termes utilisés pour regrouper des ensembles de termes de propriétés (termes dont le nom en minuscules suit l’abréviation de l’espace de noms, par exemple dwc:eventID) pour des raisons pratiques. Des métadonnées complètes pour les termes actuels et obsolètes sous une forme humainement lisible se trouvent dans le document Liste des termes du Darwin Core.
Des fichiers supplémentaires contenant uniquement les noms des termes actuels et un fichier avec l’historique complet des termes sont disponibles dans le dépôt Darwin Core.
Niveau d’enregistrement
Cette catégorie contient des termes génériques qui peuvent s’appliquer à n’importe quel type d’enregistrement dans un jeu de données.
| type | |
|---|---|
| Identifiant | http://purl.org/dc/elements/1.1/type |
| Définition | La nature ou le genre de la ressource. |
| Commentaires | Doit être rempli avec une valeur issue du vocabulaire DCMI type (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/). |
| Exemples |
|
| modified | |
|---|---|
| Identifiant | http://purl.org/dc/terms/modified |
| Définition | Date à laquelle la ressource a été modifiée. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| language | |
|---|---|
| Identifiant | http://purl.org/dc/elements/1.1/language |
| Définition | Une langue de la ressource. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que RFC 5646. Ce terme a un équivalent dans le dcterms: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| license | |
|---|---|
| Identifiant | http://purl.org/dc/terms/license |
| Définition | Document juridique donnant l'autorisation officielle de faire quelque chose avec la ressource. |
| Commentaires | |
| Exemples | |
| rightsHolder | |
|---|---|
| Identifiant | http://purl.org/dc/terms/rightsHolder |
| Définition | Personne ou organisation possédant ou gérant des droits sur la ressource. |
| Commentaires | |
| Exemples | The Regents of the University of California |
| accessRights | |
|---|---|
| Identifiant | http://purl.org/dc/terms/accessRights |
| Définition | Informations sur les personnes autorisées à accéder à la ressource ou indication de son statut de sécurité. |
| Commentaires | Les droits d'accès peuvent inclure des informations concernant l'accès ou les restrictions basées sur la confidentialité, la sécurité ou d'autres politiques. |
| Exemples |
|
| bibliographicCitation | |
|---|---|
| Identifiant | http://purl.org/dc/terms/bibliographicCitation |
| Définition | Une référence bibliographique pour la ressource. |
| Commentaires | D'après le Dublin Core, « la pratique recommandée est d'inclure suffisamment de détails bibliographiques pour identifier la ressource de la manière la moins ambiguë possible ». L'usage prévu de ce terme dans le Darwin Core est de fournir la méthode privilégiée pour citer la ressource elle-même - « comment citer cet enregistrement ». Notez que l'usage prévu de dcterms:references dans le Darwin Core, par contre, est de pointer vers la représentation de la source définitive de la ressource - « où trouver la référence la plus proche de l'original », s'il y en a une. |
| Exemples |
|
| references | |
|---|---|
| Identifiant | http://purl.org/dc/terms/references |
| Définition | Une ressource apparentée qui est référencée, citée ou pointée d'une autre manière par la ressource décrite. |
| Commentaires | From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself. |
| Exemples |
|
| associatedMedia | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedMedia |
| Définition | Une liste (concaténée et séparée) d'identifiants (publication, identifiant unique global (GUI), URI) des médias associés à la dwc:Occurrence. |
| Commentaires | |
| Exemples | https://arctos.database.museum/media/10520962 | https://arctos.database.museum/media/10520964 |
| associatedReferences | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedReferences |
| Définition | Une liste (concaténée et séparée) d'identifiants (publication, référence bibliographique, identifiant unique global (GUI), URI) de la littérature associée à la dwc:Occurrence. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. Notez également que l'usage prévu du terme dcterms:references dans le Darwin Core, lorsqu'il est appliqué à une dwc:Occurrence, est de pointer vers la source originale de cette dwc:Occurrence s'il y en a une. Notez également que l'usage prévu du terme dcterms:bibliographicCitation dans le Darwin Core lorsqu'il est appliqué à une dwc:Occurrence est de fournir la manière optimale de citer la dwc:Occurrence elle-même. |
| Exemples |
|
| feedbackURL | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/feedbackURL |
| Définition | Un localisateur de ressources uniforme (URL) qui pointe vers une page web sur laquelle un formulaire peut être soumis pour recueillir des commentaires sur l'enregistrement. |
| Commentaires | La pratique optimale recommandée est d'inclure facultativement des éléments de requête qui servent à pré-remplir les éléments du formulaire de la page web et à communiquer le contexte. |
| Exemples | https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345 |
| institutionID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/institutionID |
| Définition | An identifier for an organization. |
| Commentaires | For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/). |
| Exemples | |
| collectionID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/collectionID |
| Définition | An identifier for a collection. |
| Commentaires | Pour les spécimens physiques, la pratique optimale recommandée est d'utiliser un identifiant unique et résoluble à l'échelle mondiale provenant d'un registre de collections tel que le Global Registry of Scientific Collections (https://scientific-collections.gbif.org). |
| Exemples | https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c |
| datasetID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/datasetID |
| Définition | Un identifiant pour le jeu de données. Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à une collection ou à une institution. |
| Commentaires | |
| Exemples | b15d4952-7d20-46f1-8a3e-556a512b04c5 |
| institutionCode | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/institutionCode |
| Définition | A name (or acronym) in use by an institution having custody of a resource. |
| Commentaires | The institution having ownership of a resource should be given in dwc:ownerInstitutionCode. |
| Exemples |
|
| collectionCode | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/collectionCode |
| Définition | A name, acronym, coden, or initialism identifying a collection. |
| Commentaires | |
| Exemples |
|
| ownerInstitutionCode | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/ownerInstitutionCode |
| Définition | A name (or acronym) in use by an institution having ownership of a resource. |
| Commentaires | |
| Exemples |
|
| datasetName | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/datasetName |
| Définition | A name of a source dataset. |
| Commentaires | |
| Exemples |
|
| basisOfRecord | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/basisOfRecord |
| Définition | La nature précise de l'enregistrement. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que l'ensemble des noms locaux des identifiants de classes du Darwin Core. |
| Exemples |
|
| informationWithheld | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/informationWithheld |
| Définition | Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| dataGeneralizations | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/dataGeneralizations |
| Définition | Mesures prises pour rendre les données partagées moins précises ou moins complètes que dans leur forme originale. Cela peut signifier que des données de meilleure qualité peuvent être disponibles sur demande. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | Coordinates generalized from original GPS coordinates to the nearest half degree grid cell. |
| dynamicProperties | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/dynamicProperties |
| Définition | Une liste de mesures, de faits, de caractéristiques ou d'affirmations supplémentaires concernant le document. Il s'agit d'un mécanisme permettant de structurer le contenu. |
| Commentaires | La pratique optimale recommandée est d'utiliser un encodage clé:valeur pour un format d'échange de données tel que JSON. |
| Exemples |
|
Agent
| Agent Classe | |
|---|---|
| Identifiant | http://purl.org/dc/terms/Agent |
| Définition | A resource that acts or has the power to act. |
| Commentaires | A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious. |
| Exemples |
|
| agentID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/agentID |
| Définition | An identifier for a dcterms:Agent. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| agentType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/agentType |
| Définition | A category that best matches the nature of a dcterms:Agent. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. |
| Exemples |
|
| agentRoleOrder | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/agentRoleOrder |
| Définition | A numerical position of an AgentRole in a set of AgentRoles. |
| Commentaires | One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2. |
| Exemples |
|
| agentRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/agentRemarks |
| Définition | Comments or notes about a dcterms:Agent. |
| Commentaires | |
| Exemples | |
Assertion
| Assertion Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Assertion |
| Définition | A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Commentaires | Les ressources peuvent être considérées comme des enregistrements identifiables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc : GeologicalContext, dwc:Identification, ou dwc:Taxon. |
| Exemples |
|
| assertionID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionID |
| Définition | An identifier for a dwc:Assertion. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| assertionType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionType |
| Définition | A category that best matches the nature of a dwc:Assertion. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| verbatimAssertionType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimAssertionType |
| Définition | A string representing the type of dwc:Assertion as it appeared in an original record. |
| Commentaires | This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it. |
| Exemples | |
| assertionValue | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionValue |
| Définition | An asserted value. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| assertionUnit | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionUnit |
| Définition | A unit associated with the value in dwc:assertionValue. |
| Commentaires | Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., g/cm^3 for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., individuals). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| assertionError | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionError |
| Définition | A description of the potential error associated with a dwc:assertionValue. |
| Commentaires | |
| Exemples |
|
| assertionBy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionBy |
| Définition | A name for a dcterms:Agent responsible for making a dwc:Assertion. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| assertionMadeDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionMadeDate |
| Définition | A date on which a dwc:Assertion was created. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| assertionEffectiveDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionEffectiveDate |
| Définition | A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| assertionProtocols | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionProtocols |
| Définition | Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion. |
| Commentaires | |
| Exemples | |
| assertionReferences | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionReferences |
| Définition | A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion. |
| Commentaires | La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples | |
| assertionRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assertionRemarks |
| Définition | Comments or notes about a dwc:Assertion. |
| Commentaires | |
| Exemples |
|
BibliographicResource
| BibliographicResource Classe | |
|---|---|
| Identifiant | http://purl.org/dc/terms/BibliographicResource |
| Définition | A book, article, or other documentary resource. |
| Commentaires | |
| Exemples | |
| referenceID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/referenceID |
| Définition | An identifier for a dcterms:BibliographicResource. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| referenceType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/referenceType |
| Définition | A category that best matches the nature of a dcterms:BibliographicResource. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. |
| Exemples |
|
| referenceRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/referenceRemarks |
| Définition | Comments or notes about a dcterms:BibliographicResource. |
| Commentaires | |
| Exemples | |
Event
| Event Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Event |
| Définition | An action, process, or set of circumstances occurring at a dcterms:Location during a period of time. |
| Commentaires | |
| Exemples |
|
| eventID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventID |
| Définition | Un identifiant pour l'ensemble des informations associées à un dwc:Event (quelque chose qui se produit à un endroit et à un temps donnés). Il peut s'agir d'un identifiant unique global ou d'un identifiant spécifique à un jeu de données. |
| Commentaires | |
| Exemples | INBO:VIS:Ev:00009375 |
| parentEventID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/parentEventID |
| Définition | An identifier for a broader dwc:Event that contains this and potentially other dwc:Events. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | A1 (parentEventID pour identifier la parcelle principale de Whittaker dans les échantillons imbriqués, chacun avec son propre eventID - A1:1, A1:2). |
| eventCategory | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventCategory |
| Définition | A broad category that best matches the nature of a dwc:Event. |
| Commentaires | Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: Event, MaterialGathering, Occurrence, OrganismInteraction, or Survey. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| eventType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventType |
| Définition | A narrow category that best matches the nature of a dwc:Event. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| fieldNumber | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/fieldNumber |
| Définition | An identifier given to a dwc:Event in the field. |
| Commentaires | Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples | RV Sol 87-03-08 |
| eventDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventDate |
| Définition | A date-time or time interval during which a dwc:Event occurred. |
| Commentaires | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context. |
| Exemples |
|
| eventTime | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventTime |
| Définition | Le moment ou l'intervalle de temps pendant lequel un dwc:Event s'est produit. |
| Commentaires | La pratique optimale recommandée est d'utiliser une heure conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| startDayOfYear | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/startDayOfYear |
| Définition | The earliest integer day of the year on which a dwc:Event occurred. |
| Commentaires | The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366. |
| Exemples |
|
| endDayOfYear | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/endDayOfYear |
| Définition | The latest integer day of the year on which a dwc:Event occurred. |
| Commentaires | The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366. |
| Exemples |
|
| year | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/year |
| Définition | L'année en quatre chiffres au cours de laquelle dwc:Event s'est produit, selon le calendrier de l'ère commune. |
| Commentaires | |
| Exemples |
|
| month | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/month |
| Définition | Le mois (nombre entier) au cours duquel le dwc:Event s'est produit. |
| Commentaires | |
| Exemples |
|
| day | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/day |
| Définition | Le jour (nombre entier) du mois au cours duquel le dwc:Event s'est produit. |
| Commentaires | |
| Exemples |
|
| verbatimEventDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimEventDate |
| Définition | La représentation originale tel quel des informations de date et d'heure pour un dwc:Event. |
| Commentaires | |
| Exemples |
|
| verbatimLocality | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimLocality |
| Définition | An original textual description of a dcterms:Location. |
| Commentaires | |
| Exemples | 25 km NNE Bariloche por R. Nac. 237 |
| verbatimElevation | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimElevation |
| Définition | An original description of the elevation of a dcterms:Location. |
| Commentaires | |
| Exemples | 100-200 m |
| verbatimDepth | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimDepth |
| Définition | La description originale de la profondeur sous la surface locale. |
| Commentaires | |
| Exemples | 100-200 m |
| verbatimCoordinates | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimCoordinates |
| Définition | Verbatim original spatial coordinates of a dcterms:Location. |
| Commentaires | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Exemples |
|
| verbatimLatitude | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimLatitude |
| Définition | A verbatim original latitude of a dcterms:Location. |
| Commentaires | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Exemples | 41 05 54.03S |
| verbatimLongitude | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimLongitude |
| Définition | A verbatim original longitude of a dcterms:Location. |
| Commentaires | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Exemples | 121d 10' 34" W |
| verbatimCoordinateSystem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem |
| Définition | A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| verbatimSRS | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimSRS |
| Définition | L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel sont basées les coordonnées données dans dwc:verbatimLatitude et dwc:verbatimLongitude, ou dwc:verbatimCoordinates. |
| Commentaires | La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur not recorded (non documenté). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| georeferenceVerificationStatus | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus |
| Définition | Une description qualitative de la mesure dans laquelle le géoréférencement est considéré comme représentant la meilleure description spatiale possible pour la dcterms:Location de la dwc:Occurrence. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| habitat | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/habitat |
| Définition | Une catégorie ou description de l'habitat dans lequel le dwc:Event s'est produit. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| sampledSubstrateCategory | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory |
| Définition | A category or type of substrate sampled during a dwc:Event. |
| Commentaires | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| sampledSubstrateLayer | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer |
| Définition | A list (concatenated and separated) of substrate layers sampled during a dwc:Event. |
| Commentaires | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| fieldNotes | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/fieldNotes |
| Définition | L'un des éléments suivants : a) un indicateur de l'existence de, b) une référence à (publication, URI), ou c) les notes prises sur le terrain concernant le dwc:Event. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'une IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | Notes available in the Grinnell-Miller Library. |
| eventRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/eventRemarks |
| Définition | Commentaires ou notes sur le dwc:Event. |
| Commentaires | |
| Exemples | After the recent rains the river is nearly at flood stage. |
Location
| Location Classe | |
|---|---|
| Identifiant | http://purl.org/dc/terms/Location |
| Définition | Une région spatiale ou un lieu nommé. |
| Commentaires | |
| Exemples |
|
| locationID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/locationID |
| Définition | An identifier for a dcterms:Location. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1 |
| siteNumber | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/siteNumber |
| Définition | An identifier for a named site. |
| Commentaires | Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| higherGeographyID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/higherGeographyID |
| Définition | Un identifiant pour la région géographique dans laquelle la dcterms:Location se situe. |
| Commentaires | La pratique optimale recommandée consiste à utiliser un identifiant permanent issu d'un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. |
| Exemples | http://vocab.getty.edu/tgn/1002002 (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina). |
| higherGeography | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/higherGeography |
| Définition | Une liste (concaténée et séparée) de noms géographiques moins spécifiques que l'information saisie dans le terme dwc:locality. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs dans une liste par des barres verticales ( | ), les termes étant classés du moins précis au plus précis. |
| Exemples |
|
| continent | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/continent |
| Définition | Le nom du continent dans lequel se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux. |
| Exemples |
|
| waterBody | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/waterBody |
| Définition | Le nom du plan d'eau dans laquelle se situe la dcterms:Location. |
| Commentaires | La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. |
| Exemples |
|
| islandGroup | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/islandGroup |
| Définition | Le nom du groupement d'îles dans lequel se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. |
| Exemples |
|
| island | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/island |
| Définition | Le nom de l'île sur laquelle ou à proximité de laquelle se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée consiste à utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. |
| Exemples |
|
| country | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/country |
| Définition | Le nom du pays ou de l'unité administrative principale dans lesquels se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux. |
| Exemples |
|
| countryCode | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/countryCode |
| Définition | Le code standardisé du pays dans lequel se trouve la dcterms:Location. |
| Commentaires | Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Exemples |
|
| stateProvince | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/stateProvince |
| Définition | Le nom de la région administrative immédiatement inférieure au pays (état, province, canton, département, région, etc.) dans laquelle se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux. |
| Exemples |
|
| county | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/county |
| Définition | Le nom complet et non abrégé de la région administrative immédiatement inférieure à stateProvince (comté, département, etc.) dans laquelle se trouve la dcterms:Location. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux. |
| Exemples |
|
| municipality | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/municipality |
| Définition | Le nom complet et non abrégé de la région administrative immédiatement inférieure au comté (ville, municipalité, etc.) dans laquelle se trouve la dcterms:Location. N'utilisez pas ce terme pour un lieu nommé à proximité qui ne contient pas la dcterms:Location elle-même. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que le Getty Thesaurus of Geographic Names. La pratique optimale recommandée est de laisser ce champ vide si la dcterms:Location recouvre plusieurs entités à ce niveau administratif ou si la dcterms:Location pourrait se trouver dans l'une ou l'autre des multiples entités possibles à ce niveau. La multiplicité et l'incertitude de l'entité géographique peuvent être renseignées soit dans le terme dwc:higherGeography, soit dans le terme dwc:locality, soit dans les deux. |
| Exemples |
|
| locality | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/locality |
| Définition | La description précise du lieu. |
| Commentaires | Des informations géographiques moins spécifiques peuvent être fournies dans d'autres termes géographiques (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). Ce terme peut contenir des informations modifiées par rapport à l'original afin de corriger des erreurs apparentes ou de normaliser la description. |
| Exemples |
|
| minimumElevationInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/minimumElevationInMeters |
| Définition | The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Commentaires | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Exemples |
|
| maximumElevationInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/maximumElevationInMeters |
| Définition | The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Commentaires | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Exemples |
|
| verticalDatum | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verticalDatum |
| Définition | Le référentiel altimétrique utilisé comme référence sur laquelle sont basées les valeurs des termes d'élévation. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| minimumDepthInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/minimumDepthInMeters |
| Définition | The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Commentaires | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Exemples |
|
| maximumDepthInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/maximumDepthInMeters |
| Définition | The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Commentaires | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Exemples |
|
| minimumDistanceAboveSurfaceInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters |
| Définition | La plus petite distance d'une plage de distances par rapport à une surface de référence dans la dimension verticale, en mètres. Utilisez des valeurs positives pour les emplacements situés au-dessus de la surface, et des valeurs négatives pour les emplacements situés en dessous. Si des mesures de profondeur sont données, la surface de référence est l'emplacement donné par la profondeur, sinon la surface de référence est l'emplacement donné par l'élévation. |
| Commentaires | |
| Exemples |
|
| maximumDistanceAboveSurfaceInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters |
| Définition | La plus grande distance d'une plage de distances par rapport à une surface de référence dans la dimension verticale, en mètres. Utilisez des valeurs positives pour les emplacements situés au-dessus de la surface, et des valeurs négatives pour les emplacements situés en dessous. Si des mesures de profondeur sont données, la surface de référence est l'emplacement donné par la profondeur, sinon la surface de référence est l'emplacement donné par l'élévation. |
| Commentaires | |
| Exemples |
|
| locationAccordingTo | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/locationAccordingTo |
| Définition | Informations sur la source des informations sur la dcterms:Location. Il peut s'agir d'une publication (gazetteer/index géographique), d'une institution ou d'un ensemble d'individus. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| locationRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/locationRemarks |
| Définition | Commentaires ou notes à propos de la dcterms:Location. |
| Commentaires | |
| Exemples | under water since 2005 |
| preferredSpatialRepresentation | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation |
| Définition | An indication of which spatial representation best represents the dcterms:Location. |
| Commentaires | |
| Exemples |
|
| decimalLatitude | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/decimalLatitude |
| Définition | A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location. |
| Commentaires | Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive. |
| Exemples | -41.0983423 |
| decimalLongitude | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/decimalLongitude |
| Définition | A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location. |
| Commentaires | Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive. |
| Exemples | -121.1761111 |
| geodeticDatum | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/geodeticDatum |
| Définition | L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel sont basées les coordonnées géographiques données dans dwc:decimalLatitude et dwc:decimalLongitude. |
| Commentaires | La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur not recorded (non documenté). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| coordinateUncertaintyInMeters | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters |
| Définition | A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term. |
| Commentaires | Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term. |
| Exemples |
|
| coordinatePrecision | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/coordinatePrecision |
| Définition | Une représentation décimale de la précision des coordonnées données dans dwc:decimalLatitude et dwc:decimalLongitude. |
| Commentaires | |
| Exemples |
|
| pointRadiusSpatialFit | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit |
| Définition | A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location. |
| Commentaires | Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). |
| Exemples |
|
| footprintWKT | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/footprintWKT |
| Définition | A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location. |
| Commentaires | A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other. |
| Exemples | POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20)) (la délimitation d'un degré avec des coins opposés à longitude=10, latitude=20 et longitude=11, latitude=21) |
| footprintSRS | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/footprintSRS |
| Définition | L'ellipsoïde, le système de référence géodésique ou le système de référence spatiale (SRS) sur lequel la géométrie donnée dans dwc:footprintWKT est basée. |
| Commentaires | La pratique optimale recommandée est d'utiliser le code EPSG du SRS, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code du système de référence géodésique, s'il est connu. Sinon, utilisez un vocabulaire contrôlé pour le nom ou le code de l'ellipsoïde, s'il est connu. Si aucun de ces éléments n'est connu, utiliser la valeur not recorded (non documenté). Il est également permis de fournir le SRS en Well-Known-Text, en particulier si aucun code EPSG ne fournit les valeurs nécessaires pour les attributs du SRS. N'utilisez pas ce terme pour décrire le SRS de dwc:decimalLatitude et de dwc:decimalLongitude, ni de coordonnées verbatim - utilisez plutôt dwc:geodeticDatum et dwc:verbatimSRS respectivement. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| footprintSpatialFit | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/footprintSpatialFit |
| Définition | A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location. |
| Commentaires | Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). |
| Exemples |
|
| georeferencedBy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferencedBy |
| Définition | A name for a dcterms:Agent responsible for providing a georeference. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| georeferencedDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferencedDate |
| Définition | Date à laquelle la dcterms:Location a été géoréférencée. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| georeferenceProtocol | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferenceProtocol |
| Définition | A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128) |
| georeferenceSources | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferenceSources |
| Définition | A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| georeferenceRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/georeferenceRemarks |
| Définition | Des commentaires ou des notes sur la définition de la description spatiale, expliquant les hypothèses formulées en plus ou en contradiction avec celles formalisées dans la méthode mentionnée dans dwc:georeferenceProtocol. |
| Commentaires | |
| Exemples | Assumed distance by road (Hwy. 101) |
GeologicalContext
| GeologicalContext Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/GeologicalContext |
| Définition | A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity. |
| Commentaires | |
| Exemples |
|
| geologicalContextID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/geologicalContextID |
| Définition | Un identifiant pour l'ensemble des informations associées à un dwc:GeologicalContext (l'emplacement dans un contexte géologique, tel que la stratigraphie). Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données. |
| Commentaires | |
| Exemples | https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9 |
| earliestEonOrLowestEonothem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem |
| Définition | The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Commentaires | |
| Exemples |
|
| latestEonOrHighestEonothem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem |
| Définition | The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Commentaires | |
| Exemples |
|
| earliestEraOrLowestErathem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem |
| Définition | Le nom complet de l'ère géochronologique potentielle la plus ancienne ou de l'érythème chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| latestEraOrHighestErathem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem |
| Définition | Le nom complet de l'ère géochronologique la plus récente possible ou de l'érathème chronostratigraphique la plus haute attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| earliestPeriodOrLowestSystem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem |
| Définition | Le nom complet de la période géochronologique la plus ancienne possible ou du système chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| latestPeriodOrHighestSystem | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem |
| Définition | Le nom complet de la dernière période géochronologique possible ou du système chronostratigraphique le plus élevé attribuable à l'horizon stratigraphique à partir duquel la dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| earliestEpochOrLowestSeries | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries |
| Définition | Le nom complet de l'époque géochronologique la plus ancienne possible ou de la série chronostratigraphique la plus basse attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| latestEpochOrHighestSeries | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries |
| Définition | Le nom complet de l'époque géochronologique la plus récente possible ou de la série chronostratigraphique la plus haute attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| earliestAgeOrLowestStage | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage |
| Définition | Le nom complet de l'âge géochronologique le plus ancien possible ou de l'étage chronostratigraphique le plus bas attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| latestAgeOrHighestStage | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage |
| Définition | Le nom complet de l'âge géochronologique le plus récent possible ou de l'étage chronostratigraphique le plus haut attribuable à l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| lowestBiostratigraphicZone | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone |
| Définition | Le nom complet de la zone géologique biostratigraphique la plus basse possible de l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples | Maastrichtian |
| highestBiostratigraphicZone | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone |
| Définition | Le nom complet de la zone géologique biostratigraphique la plus élevée possible de l'horizon stratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples | Blancan |
| lithostratigraphicTerms | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms |
| Définition | La combinaison de tous les noms lithostratigraphiques de la roche à partir de laquelle la dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples | Pleistocene-Weichselien |
| group | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/group |
| Définition | Le nom complet du groupe lithostratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| formation | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/formation |
| Définition | Le nom complet de la formation lithostratigraphique à partir de laquelle la dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| member | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/member |
| Définition | Le nom complet du membre lithostratigraphique à partir duquel l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples |
|
| bed | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/bed |
| Définition | Le nom complet du lit lithostratigraphique à partir de laquelle l'entité dwc:MaterialEntity a été collectée. |
| Commentaires | |
| Exemples | Harlem coal |
Identification
| Identification Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Identification |
| Définition | A classification of a resource according to a classification scheme. |
| Commentaires | For biology, the assignment of a scientific name or taxon concept to a dwc:Organism. |
| Exemples |
|
| identificationID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationID |
| Définition | An identifier for a dwc:Identification. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | 9992 |
| identificationType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationType |
| Définition | A category that best matches the nature of a dwc:Identification. |
| Commentaires | The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| verbatimIdentification | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimIdentification |
| Définition | Une chaîne de caractères représentant l'identification taxonomique telle qu'elle apparaît dans l'enregistrement original. |
| Commentaires | Ce terme est destiné à permettre la saisie d'une identification/détermination originale non modifiée, y compris les qualificatifs d'identification, les formules hybrides, les incertitudes, etc. Ce terme doit être utilisé en complément de dwc:scientificName (et de dwc:identificationQualifier, etc.), et non en remplacement de ce dernier. |
| Exemples |
|
| isAcceptedIdentification | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/isAcceptedIdentification |
| Définition | An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one. |
| Commentaires | Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/. |
| Exemples |
|
| taxonFormula | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/taxonFormula |
| Définition | A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. |
| Exemples |
|
| identificationQualifier | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationQualifier |
| Définition | Une phrase courte ou une abréviation standardisée ("cf.", "aff.") pour exprimer les doutes liés à l'identification. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'une IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| typeStatus | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/typeStatus |
| Définition | Une liste (concaténée et séparée) des dimensions liées à la typification (statut de type, nom scientifique typifié, publication) appliquées au sujet. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| identifiedBy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identifiedBy |
| Définition | A name for a dcterms:Agent responsible for making a dwc:Identification. |
| Commentaires | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| identifiedByID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identifiedByID |
| Définition | An identifier for a dcterms:Agent responsible for making a dwc:Identification. |
| Commentaires | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples |
|
| dateIdentified | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/dateIdentified |
| Définition | Date à laquelle le sujet a été identifié comme appartenant au dwc:Taxon. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| identificationReferences | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationReferences |
| Définition | A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification. |
| Commentaires | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples |
|
| identificationVerificationStatus | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationVerificationStatus |
| Définition | A categorical indicator of the extent to which a taxonomic determination has been verified to be correct. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé tel que celui utilisé dans HISPID et ABCD. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | 0 (unverified in HISPID/ABCD) |
| identificationRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/identificationRemarks |
| Définition | Commentaires ou notes sur la dwc:Identification. |
| Commentaires | |
| Exemples | Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas. |
MaterialEntity
| MaterialEntity Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/MaterialEntity |
| Définition | Une entité qui peut être identifiée, qui existe pendant un certain temps et qui est constituée en tout ou en partie de matière physique pendant son existence. |
| Commentaires | The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Exemples |
|
| materialEntityID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/materialEntityID |
| Définition | Identifiant d'une instance particulière d'une dwc:MaterialEntity. |
| Commentaires | Les valeurs de dwc:materialEntityID sont destinées à identifier de manière unique et permanente une dwc:MaterialEntity particulière dans un certain contexte. Les exemples de contexte comprennent une collection d'échantillons donnée, une organisation donnée ou l'échelle globale. La pratique optimale recommandée est d'utiliser un identifiant permanent et unique au niveau mondial. L'identifiant est lié à un objet physique (la dwc:MaterialEntity) par opposition à un enregistrement numérique particulier (représentation) de cet objet physique. |
| Exemples | 06809dc5-f143-459a-be1a-6f03e63fc083 |
| digitalSpecimenID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/digitalSpecimenID |
| Définition | An identifier for a Digital Specimen resource. |
| Commentaires | Un Spécimen Numérique est défini à l'adresse https://doi.org/10.3897/rio.7.e67379. Un dwc:digitalSpecimenID est destiné à identifier de manière unique et permanente un spécimen numérique. La pratique optimale recommandée est d'utiliser un DOI avec des métadonnées interprétables par une machine dans l'enregistrement DOI qui utilise un profil de métadonnées convenu par la communauté (également connu sous le nom de profil FDO) pour un spécimen numérique. Pour un exemple, voir : https://doi.org/10.3535/N75-CR4-0SM?noredirect. L'identifiant est celui d'un artefact d'information numérique (le Spécimen Numérique) et non celui d'une instance spécifique d'une dwc:MaterialEntity. |
| Exemples | |
| materialEntityCategory | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/materialEntityCategory |
| Définition | A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity. |
| Commentaires | Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples | liveOrganism, deadOrganism, partOfOrganism, nonMolecularBiologicalExtract, molecularBiologicalExtract, mineral, rock, fossil, chemical, humanArtifactWithBiologicalConstituent, humanArtifactWithoutBiologicalConstituent, and mixed |
| materialEntityType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/materialEntityType |
| Définition | A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory. |
| Commentaires | Classification plus générique d'une dwc:MaterialEntity que dwc:preparations. La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | |
| discipline | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/discipline |
| Définition | The primary branch or branches of knowledge represented by a dwc:MaterialEntity. |
| Commentaires | This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( | ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| typeOfType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/typeOfType |
| Définition | A category of nomenclatural type of a dwc:MaterialEntity. |
| Commentaires | The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| typifiedName | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/typifiedName |
| Définition | A scientific name for which a specimen or other name is the type. |
| Commentaires | The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName. |
| Exemples | Polysiphonia amphibolis Womersley |
| catalogNumber | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/catalogNumber |
| Définition | An identifier (preferably unique) for a resource within a collection. |
| Commentaires | |
| Exemples |
|
| otherCatalogNumbers | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/otherCatalogNumbers |
| Définition | A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection. |
| Commentaires | La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| recordNumber | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/recordNumber |
| Définition | Un identifiant donné à la dwc:Occurrence au moment où elle a été enregistrée. Il sert souvent de lien entre les notes de terrain et l'enregistrement d'une dwc:Occurrence, comme le numéro de terrain d'un spécimen. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples | OPP 7101 |
| objectQuantity | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/objectQuantity |
| Définition | A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity. |
| Commentaires | An dwc:objectQuantity must have a corresponding dwc:objectQuantityType. |
| Exemples |
|
| objectQuantityType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/objectQuantityType |
| Définition | The type of quantification system used for the quantity of dwc:MaterialEntities. |
| Commentaires | An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| preparations | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/preparations |
| Définition | Une liste (concaténée et séparée) de procédés de préparation et de conservation pour une dwc:MaterialEntity. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| disposition | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/disposition |
| Définition | A current state of a dwc:MaterialEntity with respect to where it can be found. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| verbatimLabel | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimLabel |
| Définition | A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity. |
| Commentaires | The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel. |
| Exemples | |
| associatedSequences | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedSequences |
| Définition | A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity. |
| Commentaires | |
| Exemples | |
| materialEntityRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/materialEntityRemarks |
| Définition | Comments or notes about a dwc:MaterialEntity. |
| Commentaires | |
| Exemples |
|
MaterialSample
| MaterialSample Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/MaterialSample |
| Définition | Une entité matérielle qui représente une entité d'intérêt en totalité ou en partie. |
| Commentaires | |
| Exemples |
|
| materialSampleID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/materialSampleID |
| Définition | Un identifiant pour le dwc:MaterialSample (par opposition à un enregistrement numérique particulier du dwc:MaterialSample). En l'absence d'un identifiant unique global permanent, en construire un à partir d'une combinaison d'identifiants dans l'enregistrement qui rendra le dwc:materialSampleID le plus unique possible à l'échelle globale. |
| Commentaires | La pratique optimale recommandée est d'utiliser un identifiant permanent et unique au niveau mondial (GUI). |
| Exemples | 06809dc5-f143-459a-be1a-6f03e63fc083 |
Occurrence
| Occurrence Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Occurrence |
| Définition | A dwc:Event that establishes the state of a dwc:Organism at a particular place and time. |
| Commentaires | In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Exemples |
|
| occurrenceID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/occurrenceID |
| Définition | An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence). |
| Commentaires | In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique. |
| Exemples |
|
| recordedBy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/recordedBy |
| Définition | A name for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| recordedByID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/recordedByID |
| Définition | An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Commentaires | La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| individualCount | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/individualCount |
| Définition | Le nombre d'individus présents au moment de la dwc:Occurrence. |
| Commentaires | |
| Exemples |
|
| organismQuantity | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismQuantity |
| Définition | Un nombre ou une valeur numérique pour la quantité de dwc:Organisms. |
| Commentaires | Une dwc:organismQuantity doit avoir un dwc:organismQuantityType correspondant. |
| Exemples |
|
| organismQuantityType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismQuantityType |
| Définition | Le type de système de mesure utilisé pour la quantification des dwc:Organisms. |
| Commentaires | Un dwc:organismQuantityType doit avoir un dwc:organismQuantity correspondant. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| sex | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/sex |
| Définition | A sex of a dwc:Organism. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| lifeStage | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/lifeStage |
| Définition | An age class or life stage of a dwc:Organism. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| reproductiveCondition | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/reproductiveCondition |
| Définition | A reproductive condition of a dwc:Organism. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| caste | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/caste |
| Définition | A social caste of a dwc:Organism. |
| Commentaires | Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| behavior | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/behavior |
| Définition | A behavior shown by a dwc:Organism. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| vitality | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/vitality |
| Définition | Une indication sur le fait qu'un dwc:Organism était vivant ou mort au moment de la collecte ou de l'observation. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| establishmentMeans | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/establishmentMeans |
| Définition | Indication selon laquelle un dwc:Organism a été introduit en un lieu et à un moment donnés par l'activité directe ou indirecte de l'humain moderne. |
| Commentaires | La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/em/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| degreeOfEstablishment | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/degreeOfEstablishment |
| Définition | Le degré de survie, de reproduction et d'expansion de l'aire de répartition d'un dwc:Organism à un endroit et à un moment donnés. |
| Commentaires | La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/doe/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| pathway | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/pathway |
| Définition | Le processus par lequel un dwc:Organism s'est retrouvé à un endroit donné à un moment donné. |
| Commentaires | La pratique optimale recommandée est d'utiliser les valeurs permises par le vocabulaire contrôlé dédié à ce terme, dont la liste figure à l'adresse http://rs.tdwg.org/dwc/doc/pw/. Pour plus de détails, voir https://doi.org/10.3897/biss.3.38084. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| occurrenceStatus | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/occurrenceStatus |
| Définition | A statement about the detection or non-detection of a dwc:Organism during a dwc:Event. |
| Commentaires | For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Exemples |
|
| associatedOccurrences | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedOccurrences |
| Définition | Une liste (concaténée et séparée) d'identifiants d'autres enregistrements de dwc:Occurrence et de leurs associations à cette dwc:Occurrence. |
| Commentaires | Ce terme peut être utilisé pour fournir une liste d'associations avec d'autres dwc:Occurrences. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| associatedTaxa | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedTaxa |
| Définition | Une liste (concaténée et séparée) d'identifiants ou des noms des enregistrements de dwc:Taxon et les associations de cette dwc:Occurrence à chacun d'entre eux. |
| Commentaires | Ce terme peut être utilisé pour fournir une liste d'associations à des enregistrements de dwc:Taxon autres que celles définies dans dwc:Occurrence. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. Ce terme ne convient pas pour établir des relations entre des enregistrements de dwc:Taxon, mais seulement entre des dwc:Occurrences spécifiques d'un dwc:Organisme et d'autres enregistrements de dwc:Taxon. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| occurrenceRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/occurrenceRemarks |
| Définition | Commentaires ou notes sur le dwc:Occurence. |
| Commentaires | |
| Exemples | found dead on road |
Organism
| Organism Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Organism |
| Définition | Un organisme particulier ou groupe défini d'organismes considérés comme homogènes sur le plan taxonomique. |
| Commentaires | Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Exemples |
|
| organismID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismID |
| Définition | Un identifiant de l'instance de dwc:Organism (par opposition à un enregistrement numérique particulier du dwc:Organism). Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données. |
| Commentaires | |
| Exemples | http://arctos.database.museum/guid/WNMU:Mamm:1249 |
| organismScope | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismScope |
| Définition | Une description du type d'instance de dwc:Organism. Peut être utilisée pour indiquer si l'instance de dwc:Organism représente un organisme isolé ou si elle représente un type particulier d'agrégat ou de regroupement. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme n'est pas destiné à être utilisé pour spécifier un type de dwc:Taxon. Pour décrire le type de dwc:Organism à l'aide d'un objet URI en RDF, utilisez plutôt rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type). |
| Exemples |
|
| organismName | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismName |
| Définition | Nom littéral ou étiquette attribuée à une instance de dwc:Organism. |
| Commentaires | |
| Exemples |
|
| causeOfDeath | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/causeOfDeath |
| Définition | Une indication de la cause connue ou supposée de la mort d'un dwc:Organism. |
| Commentaires | La cause peut être naturelle (par exemple, maladie, prédation), liée à des activités humaines (par exemple, animaux tués sur la route, pollution) ou à d'autres facteurs environnementaux (par exemple, phénomènes météorologiques extrêmes). |
| Exemples |
|
| associatedOrganisms | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/associatedOrganisms |
| Définition | Une liste (concaténée et séparée) d'identifiants d'autres dwc:Organisms et les associations de cet dwc:Organism à chacun d'entre eux. |
| Commentaires | Ce terme peut être utilisé pour fournir une liste d'associations avec d'autres dwc:Organisms. Notez que la classe dwc:ResourceRelationship est un autre moyen de représenter les associations, avec plus de détails. La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| previousIdentifications | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/previousIdentifications |
| Définition | Une liste (concaténée et séparée) des attributions précédentes de noms au dwc:Organism. |
| Commentaires | La pratique optimale recommandée consiste à séparer les valeurs d'une liste par une barre verticale ( | ). |
| Exemples |
|
| organismRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismRemarks |
| Définition | Commentaires ou notes sur l'instance de dwc:Organism. |
| Commentaires | |
| Exemples | One of a litter of six |
OrganismInteraction
| OrganismInteraction Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/OrganismInteraction |
| Définition | An interaction between two dwc:Organisms during a dwc:Event. |
| Commentaires | Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences. |
| Exemples |
|
| organismInteractionID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismInteractionID |
| Définition | An identifier for a dwc:OrganismInteraction. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| organismInteractionDescription | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismInteractionDescription |
| Définition | A verbatim description of a dwc:OrganismInteraction. |
| Commentaires | |
| Exemples | Mallophora ruficauda captured an Apis mellifera worker in flight. |
| organismInteractionType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/organismInteractionType |
| Définition | A category that best matches the nature of a dwc:OrganismInteraction. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
MeasurementOrFact
| MeasurementOrFact Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/MeasurementOrFact |
| Définition | Une mesure ou un fait concernant une rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Commentaires | Les ressources peuvent être considérées comme des enregistrements identifiables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc : GeologicalContext, dwc:Identification, ou dwc:Taxon. |
| Exemples |
|
| measurementID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementID |
| Définition | Un identifiant pour le dwc:MeasurementOrFact (informations relatives aux mesures, aux faits, aux caractéristiques ou aux affirmations). Il peut s'agir d'un identifiant unique global ou d'un identifiant spécifique à un jeu de données. |
| Commentaires | |
| Exemples | 9c752d22-b09a-11e8-96f8-529269fb1459 |
| parentMeasurementID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/parentMeasurementID |
| Définition | Un identifiant pour un dwc:MeasurementOrFact plus large qui comprend ce dwc:MeasurementOrFact et potentiellement d'autres dwc:MeasurementOrFacts. |
| Commentaires | Il peut s'agir d'un identifiant unique global (GUI) ou d'un identifiant spécifique à un jeu de données. |
| Exemples |
|
| measurementType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementType |
| Définition | La nature de la mesure, du fait, de la caractéristique ou de l'affirmation. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| verbatimMeasurementType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/verbatimMeasurementType |
| Définition | Une chaîne de caractères représentant le type de mesure ou de fait tel qu'il apparaît dans l'enregistrement original. |
| Commentaires | Ce terme est destiné à permettre la saisie d'un nom original non modifié pour un type de mesure ou de fait. Ce terme est destiné à être utilisé en complément de dwc:measurementType, et non à sa place. |
| Exemples |
|
| measurementValue | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementValue |
| Définition | La valeur de la mesure, du fait, de l'affirmation ou de la caractéristique. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| measurementAccuracy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementAccuracy |
| Définition | La description de l'erreur ou marge d'erreur potentielle associée à la dwc:measurementValue. |
| Commentaires | |
| Exemples |
|
| measurementUnit | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementUnit |
| Définition | Les unités associées à la dwc:measurementValue. |
| Commentaires | La pratique optimale recommandée est d'utiliser est d'utiliser les unités du système international (SI). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| measurementDeterminedBy | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementDeterminedBy |
| Définition | Une liste (concaténée et séparée) de noms de personnes, de groupes ou d'organisations qui ont déterminé la valeur du dwc:MeasurementOrFact. |
| Commentaires | La pratique optimale recommandée est de séparer les valeurs d'une liste par une barre verticale ( | ). Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| measurementDeterminedDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementDeterminedDate |
| Définition | La date à laquelle la dwc:MeasurementOrFact a été effectuée. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| measurementMethod | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementMethod |
| Définition | Une description ou référence (publication, URI) de la méthode ou du protocole utilisé pour déterminer la mesure, le fait, la caractéristique ou l'affirmation. |
| Commentaires | Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| measurementRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/measurementRemarks |
| Définition | Commentaires ou notes accompagnant la dwc:MeasurementOrFact. |
| Commentaires | |
| Exemples | tip of tail missing |
Media
| Media Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/ac/terms/Media |
| Définition | A digital or physical media resource. |
| Commentaires | An instance of digital textual media may be better represented as a dcterms:BibliographicResource. |
| Exemples |
|
MolecularProtocol
| MolecularProtocol Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/MolecularProtocol |
| Définition | A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity. |
| Commentaires | |
| Exemples |
|
| molecularProtocolID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/molecularProtocolID |
| Définition | An identifier for a dwc:MolecularProtocol. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| assayType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/assayType |
| Définition | A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
NucleotideAnalysis
| NucleotideAnalysis Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/NucleotideAnalysis |
| Définition | A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol. |
| Commentaires | |
| Exemples | |
| readCount | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/readCount |
| Définition | The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis. |
| Commentaires | |
| Exemples |
|
| processedTotalReadCount | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/processedTotalReadCount |
| Définition | The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis. |
| Commentaires | |
| Exemples | 50638, 345987, 764032 |
NucleotideSequence
| NucleotideSequence Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/NucleotideSequence |
| Définition | A digital representation of a nucleotide sequence. |
| Commentaires | |
| Exemples | |
| sequence | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/sequence |
| Définition | A string representing nucleotide base pairs. |
| Commentaires | Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction. |
| Exemples | TCTATCCTCAATTATAGGTCATAATTCACCATCAG |
| nucleotideSequenceRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks |
| Définition | Comments or notes about a dwc:NucleotideSequence. |
| Commentaires | |
| Exemples | |
Protocol
| Protocol Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Protocol |
| Définition | A method used during an action. |
| Commentaires | |
| Exemples |
|
| protocolID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/protocolID |
| Définition | An identifier for a dwc:Protocol. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| protocolType | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/protocolType |
| Définition | A category that best matches the nature of a dwc:Protocol. |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. Ce terme a un équivalent dans le dwciri: namespace qui n'autorise qu'un IRI comme valeur, alors que ce terme autorise n'importe quelle valeur sous forme de chaîne de caractères. |
| Exemples |
|
| protocolDescription | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/protocolDescription |
| Définition | A detailed description of a dwc:Protocol. |
| Commentaires | |
| Exemples | Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties. |
| protocolRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/protocolRemarks |
| Définition | Comments or notes about a dwc:Protocol. |
| Commentaires | |
| Exemples | |
Provenance
| Provenance Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Provenance |
| Définition | Information about an entity’s origins. |
| Commentaires | This is a convenience class to group related properties. |
| Exemples | |
| projectTitle | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/projectTitle |
| Définition | Une liste (concaténée et séparée) de titres ou de noms de projets qui ont contribué à un dwc:Event. |
| Commentaires | Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples |
|
| projectID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/projectID |
| Définition | Une liste (concaténée et séparée) d'identifiants pour les projets qui ont contribué à un dwc:Event. |
| Commentaires | A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples |
|
| fundingAttribution | |
|---|---|
| Identifiant | http://rs.tdwg.org/ac/terms/fundingAttribution |
| Définition | Description textuelle des organisations ou des personnes qui ont financé la création de la ressource. |
| Commentaires | Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples |
|
| fundingAttributionID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/fundingAttributionID |
| Définition | An identifier for a dcterms:Agent that financially supported a project. |
| Commentaires | Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Exemples | |
ResourceRelationship
| ResourceRelationship Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/ResourceRelationship |
| Définition | Une relation entre une rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) et une autre. |
| Commentaires | Les ressources peuvent être considérées comme des enregistrements reconnaissables ou des instances de classes et peuvent inclure, sans s'y limiter, des instances de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, ou dwc:Taxon. |
| Exemples |
|
| resourceRelationshipID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/resourceRelationshipID |
| Définition | An identifier for a dwc:ResourceRelationship. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | |
| resourceID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/resourceID |
| Définition | Un identifiant de la ressource qui prend part à la relation en tant que sujet. |
| Commentaires | |
| Exemples | f809b9e0-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResourceID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relationshipOfResourceID |
| Définition | Un identifiant pour le type de relation (prédicat) qui relie le sujet identifié par dwc:resourceID à son objet identifié par dwc:relatedResourceID. |
| Commentaires | La pratique optimale recommandée est d'utiliser les identifiants des termes d'un vocabulaire contrôlé, tel que l'ontologie des relations de l'OBO. |
| Exemples |
|
| relatedResourceID | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relatedResourceID |
| Définition | An identifier for the related resource (the object) of a dwc:ResourceRelationship. |
| Commentaires | Recommended best practice is to use a globally unique identifier. |
| Exemples | dc609808-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResource | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relationshipOfResource |
| Définition | La relation entre le sujet (identifié par dwc:resourceID) et l'objet (identifié par dwc:relatedResourceID). |
| Commentaires | La pratique optimale recommandée est d'utiliser un vocabulaire contrôlé. |
| Exemples |
|
| relationshipAccordingTo | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relationshipAccordingTo |
| Définition | La source (personne, organisation, publication, référence) établissant la relation entre les deux ressources. |
| Commentaires | |
| Exemples | Julie Woodruff |
| relationshipEstablishedDate | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate |
| Définition | Date à laquelle la relation entre les deux ressources a été établie. |
| Commentaires | La pratique optimale recommandée est d'utiliser une date conforme à la norme ISO 8601-1:2019. |
| Exemples |
|
| relationshipRemarks | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/relationshipRemarks |
| Définition | Commentaires ou notes sur la relation entre les deux ressources. |
| Commentaires | |
| Exemples |
|
Taxon
| Taxon Classe | |
|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/Taxon |
| Définition | Groupe d'organismes (sensu http://purl.obolibrary.org/obo/OBI_0100026) considérés par les taxonomistes comme formant une unité homogène. |
| Commentaires | |
| Exemples | the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820 |
| taxonID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Identifiant | http://rs.tdwg.org/dwc/terms/taxonID | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Définition | An identifier for a dwc:Taxon. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Commentaires | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Exemples |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||