Darwin Core Quick Reference Guide
Darwin Core Quick Reference Guide
This document is intended to be an easy-to-read reference of the currently (as of 2023-09-18) recommended terms maintained as part of the Darwin Core standard and is maintained by the Darwin Core Maintenance Group.
Need help? Read more about how to use Darwin Core in the Darwin Core Questions & Answers site. Still have questions? Submit a new issue (question/problem) to the dwc-qa issues page in GitHub, or use the form. See the bottom of this document for how to cite Darwin Core.”
Want to contribute? For information about how to contribute to the Darwin Core Standard, including how to propose changes, see the Guidelines for contributing.
This page is not part of the standard, but combines the normative term names and definitions with the non-normative comments and examples that are meant to help people to use the terms consistently. Definitions, comments, and examples may include namespace abbreviations (e.g., “dwc:”). These are included to show that the meaning for the word it is attached to very specifically means the term as defined in that namespace. Thus, dwc:Event means Event as defined by Darwin Core at https://dwc.tdwg.org/terms/#event. Capitalized terms that follow a namespace abbreviation, such as dwc:Occurrence, are Darwin Core class terms, which are a special category of terms used to group sets of property terms (terms that being with lower case names that follow the namespace abbreviation, e.g., dwc:eventID) for convenience. Comprehensive metadata for current and obsolete terms in human readable form are found in the document List of Darwin Core terms.
Additional files with just the current term names and a file with the full term history can be found in the Darwin Core repository.
record-level
This category contains terms that are generic in that they might apply to any type of record in a dataset.
| type | |
|---|---|
| Identifier | http://purl.org/dc/elements/1.1/type |
| Definition | The nature or genre of the resource. |
| Comments | Must be populated with a value from the DCMI type vocabulary (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/). |
| Examples |
|
| modified | |
|---|---|
| Identifier | http://purl.org/dc/terms/modified |
| Definition | Date on which the resource was changed. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| language | |
|---|---|
| Identifier | http://purl.org/dc/elements/1.1/language |
| Definition | A language of the resource. |
| Comments | Recommended best practice is to use a controlled vocabulary such as RFC 5646. This term has an equivalent in the dcterms: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| license | |
|---|---|
| Identifier | http://purl.org/dc/terms/license |
| Definition | A legal document giving official permission to do something with the resource. |
| Comments | |
| Examples | |
| rightsHolder | |
|---|---|
| Identifier | http://purl.org/dc/terms/rightsHolder |
| Definition | A person or organization owning or managing rights over the resource. |
| Comments | |
| Examples | The Regents of the University of California |
| accessRights | |
|---|---|
| Identifier | http://purl.org/dc/terms/accessRights |
| Definition | Information about who can access the resource or an indication of its security status. |
| Comments | Access Rights may include information regarding access or restrictions based on privacy, security, or other policies. |
| Examples |
|
| bibliographicCitation | |
|---|---|
| Identifier | http://purl.org/dc/terms/bibliographicCitation |
| Definition | A bibliographic reference for the resource. |
| Comments | From Dublin Core, "Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible." The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself - "how to cite this record". Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource - "where to find the as-close-to-original reference", if one is available. |
| Examples |
|
| references | |
|---|---|
| Identifier | http://purl.org/dc/terms/references |
| Definition | A related resource that is referenced, cited, or otherwise pointed to by the described resource. |
| Comments | From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself. |
| Examples |
|
| feedbackURL | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/feedbackURL |
| Definition | A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record. |
| Comments | Recommended best practice is to optionally include query strings that act to pre-populate web page form elements and communicate the context. |
| Examples | https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345 |
| institutionID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/institutionID |
| Definition | An identifier for an organization. |
| Comments | For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/). |
| Examples | |
| collectionID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/collectionID |
| Definition | An identifier for a collection. |
| Comments | For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/). |
| Examples | https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c |
| datasetID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/datasetID |
| Definition | An identifier for the set of data. May be a global unique identifier or an identifier specific to a collection or institution. |
| Comments | |
| Examples | b15d4952-7d20-46f1-8a3e-556a512b04c5 |
| institutionCode | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/institutionCode |
| Definition | A name (or acronym) in use by an institution having custody of a resource. |
| Comments | The institution having ownership of a resource should be given in dwc:ownerInstitutionCode. |
| Examples |
|
| collectionCode | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/collectionCode |
| Definition | A name, acronym, coden, or initialism identifying a collection. |
| Comments | |
| Examples |
|
| ownerInstitutionCode | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/ownerInstitutionCode |
| Definition | A name (or acronym) in use by an institution having ownership of a resource. |
| Comments | |
| Examples |
|
| datasetName | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/datasetName |
| Definition | A name of a source dataset. |
| Comments | |
| Examples |
|
| basisOfRecord | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/basisOfRecord |
| Definition | The specific nature of the data record. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the set of local names of the identifiers for classes in Darwin Core. |
| Examples |
|
| informationWithheld | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/informationWithheld |
| Definition | Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| dataGeneralizations | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/dataGeneralizations |
| Definition | Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | Coordinates generalized from original GPS coordinates to the nearest half degree grid cell. |
| dynamicProperties | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/dynamicProperties |
| Definition | A list of additional measurements, facts, characteristics, or assertions about the record. Meant to provide a mechanism for structured content. |
| Comments | Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON. |
| Examples |
|
Agent
| Agent Class | |
|---|---|
| Identifier | http://purl.org/dc/terms/Agent |
| Definition | A resource that acts or has the power to act. |
| Comments | A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious. |
| Examples |
|
| agentID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/agentID |
| Definition | An identifier for a dcterms:Agent. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| agentType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/agentType |
| Definition | A category that best matches the nature of a dcterms:Agent. |
| Comments | Recommended best practice is to use a controlled vocabulary. |
| Examples |
|
| agentRoleOrder | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/agentRoleOrder |
| Definition | A numerical position of an AgentRole in a set of AgentRoles. |
| Comments | One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2. |
| Examples |
|
| agentRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/agentRemarks |
| Definition | Comments or notes about a dcterms:Agent. |
| Comments | |
| Examples | |
Assertion
| Assertion Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Assertion |
| Definition | A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Comments | Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon. |
| Examples |
|
| assertionID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionID |
| Definition | An identifier for a dwc:Assertion. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| assertionType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionType |
| Definition | A category that best matches the nature of a dwc:Assertion. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| verbatimAssertionType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimAssertionType |
| Definition | A string representing the type of dwc:Assertion as it appeared in an original record. |
| Comments | This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it. |
| Examples | |
| assertionValue | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionValue |
| Definition | An asserted value. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| assertionUnit | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionUnit |
| Definition | A unit associated with the value in dwc:assertionValue. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., g/cm^3 for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., individuals). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| assertionError | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionError |
| Definition | A description of the potential error associated with a dwc:assertionValue. |
| Comments | |
| Examples |
|
| assertionBy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionBy |
| Definition | A name for a dcterms:Agent responsible for making a dwc:Assertion. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| assertionMadeDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionMadeDate |
| Definition | A date on which a dwc:Assertion was created. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| assertionEffectiveDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionEffectiveDate |
| Definition | A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| assertionProtocols | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionProtocols |
| Definition | Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion. |
| Comments | |
| Examples | |
| assertionReferences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionReferences |
| Definition | A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples | |
| assertionRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assertionRemarks |
| Definition | Comments or notes about a dwc:Assertion. |
| Comments | |
| Examples |
|
BibliographicResource
| BibliographicResource Class | |
|---|---|
| Identifier | http://purl.org/dc/terms/BibliographicResource |
| Definition | A book, article, or other documentary resource. |
| Comments | |
| Examples | |
| referenceID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/referenceID |
| Definition | An identifier for a dcterms:BibliographicResource. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| referenceType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/referenceType |
| Definition | A category that best matches the nature of a dcterms:BibliographicResource. |
| Comments | Recommended best practice is to use a controlled vocabulary. |
| Examples |
|
| referenceRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/referenceRemarks |
| Definition | Comments or notes about a dcterms:BibliographicResource. |
| Comments | |
| Examples | |
Event
| Event Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Event |
| Definition | An action, process, or set of circumstances occurring at a dcterms:Location during a period of time. |
| Comments | |
| Examples |
|
| eventID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventID |
| Definition | An identifier for the set of information associated with a dwc:Event (something that occurs at a place and time). May be a global unique identifier or an identifier specific to the data set. |
| Comments | |
| Examples | INBO:VIS:Ev:00009375 |
| parentEventID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/parentEventID |
| Definition | An identifier for a broader dwc:Event that contains this and potentially other dwc:Events. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | A1 (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - A1:1, A1:2). |
| eventCategory | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventCategory |
| Definition | A broad category that best matches the nature of a dwc:Event. |
| Comments | Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: Event, MaterialGathering, Occurrence, OrganismInteraction, or Survey. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| eventType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventType |
| Definition | A narrow category that best matches the nature of a dwc:Event. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| fieldNumber | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/fieldNumber |
| Definition | An identifier given to a dwc:Event in the field. |
| Comments | Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | RV Sol 87-03-08 |
| eventDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventDate |
| Definition | A date-time or time interval during which a dwc:Event occurred. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context. |
| Examples |
|
| eventTime | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventTime |
| Definition | The time or interval during which a dwc:Event occurred. |
| Comments | Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019. |
| Examples |
|
| startDayOfYear | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/startDayOfYear |
| Definition | The earliest integer day of the year on which a dwc:Event occurred. |
| Comments | The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366. |
| Examples |
|
| endDayOfYear | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/endDayOfYear |
| Definition | The latest integer day of the year on which a dwc:Event occurred. |
| Comments | The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366. |
| Examples |
|
| year | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/year |
| Definition | The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar. |
| Comments | |
| Examples |
|
| month | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/month |
| Definition | The integer month in which the dwc:Event occurred. |
| Comments | |
| Examples |
|
| day | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/day |
| Definition | The integer day of the month on which the dwc:Event occurred. |
| Comments | |
| Examples |
|
| verbatimEventDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimEventDate |
| Definition | The verbatim original representation of the date and time information for a dwc:Event. |
| Comments | |
| Examples |
|
| habitat | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/habitat |
| Definition | A category or description of the habitat in which the dwc:Event occurred. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| sampledSubstrateCategory | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory |
| Definition | A category or type of substrate sampled during a dwc:Event. |
| Comments | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| sampledSubstrateLayer | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer |
| Definition | A list (concatenated and separated) of substrate layers sampled during a dwc:Event. |
| Comments | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| samplingProtocol | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/samplingProtocol |
| Definition | The names of, references to, or descriptions of the methods or protocols used during a dwc:Event. |
| Comments | Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| sampleSizeValue | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sampleSizeValue |
| Definition | A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event. |
| Comments | A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit. |
| Examples | 5 (sampleSizeValue) with metre (sampleSizeUnit) |
| sampleSizeUnit | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sampleSizeUnit |
| Definition | The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event. |
| Comments | A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., 5 for dwc:sampleSizeValue with m for dwc:sampleSizeUnit. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| samplingEffort | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/samplingEffort |
| Definition | The amount of effort expended during a dwc:Event. |
| Comments | |
| Examples |
|
| fieldNotes | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/fieldNotes |
| Definition | One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | Notes available in the Grinnell-Miller Library. |
| eventRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/eventRemarks |
| Definition | Comments or notes about the dwc:Event. |
| Comments | |
| Examples | After the recent rains the river is nearly at flood stage. |
Location
| Location Class | |
|---|---|
| Identifier | http://purl.org/dc/terms/Location |
| Definition | A spatial region or named place. |
| Comments | |
| Examples |
|
| locationID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/locationID |
| Definition | An identifier for a dcterms:Location. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1 |
| siteNumber | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/siteNumber |
| Definition | An identifier for a named site. |
| Comments | Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| higherGeographyID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/higherGeographyID |
| Definition | An identifier for the geographic region within which the dcterms:Location occurred. |
| Comments | Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names. |
| Examples | http://vocab.getty.edu/tgn/1002002 (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina). |
| higherGeography | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/higherGeography |
| Definition | A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ), with terms in order from least specific to most specific. |
| Examples |
|
| continent | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/continent |
| Definition | The name of the continent in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| waterBody | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/waterBody |
| Definition | The name of the water body in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. |
| Examples |
|
| islandGroup | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/islandGroup |
| Definition | The name of the island group in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. |
| Examples |
|
| island | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/island |
| Definition | The name of the island on or near which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. |
| Examples |
|
| country | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/country |
| Definition | The name of the country or major administrative unit in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| countryCode | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/countryCode |
| Definition | The standard code for the country in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| stateProvince | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/stateProvince |
| Definition | The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| county | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/county |
| Definition | The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the dcterms:Location occurs. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| municipality | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/municipality |
| Definition | The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location. |
| Comments | Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both. |
| Examples |
|
| locality | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/locality |
| Definition | The specific description of the place. |
| Comments | Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description. |
| Examples |
|
| verbatimLocality | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimLocality |
| Definition | An original textual description of a dcterms:Location. |
| Comments | |
| Examples | 25 km NNE Bariloche por R. Nac. 237 |
| minimumElevationInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/minimumElevationInMeters |
| Definition | The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Comments | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Examples |
|
| maximumElevationInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/maximumElevationInMeters |
| Definition | The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Comments | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Examples |
|
| verbatimElevation | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimElevation |
| Definition | An original description of the elevation of a dcterms:Location. |
| Comments | |
| Examples | 100-200 m |
| verticalDatum | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verticalDatum |
| Definition | The vertical datum used as the reference upon which the values in the elevation terms are based. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| minimumDepthInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/minimumDepthInMeters |
| Definition | The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Comments | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Examples |
|
| maximumDepthInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/maximumDepthInMeters |
| Definition | The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum. |
| Comments | See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface. |
| Examples |
|
| verbatimDepth | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimDepth |
| Definition | The original description of the depth below the local surface. |
| Comments | |
| Examples | 100-200 m |
| minimumDistanceAboveSurfaceInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters |
| Definition | The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation. |
| Comments | |
| Examples |
|
| maximumDistanceAboveSurfaceInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters |
| Definition | The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation. |
| Comments | |
| Examples |
|
| locationAccordingTo | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/locationAccordingTo |
| Definition | Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| locationRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/locationRemarks |
| Definition | Comments or notes about the dcterms:Location. |
| Comments | |
| Examples | under water since 2005 |
| preferredSpatialRepresentation | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation |
| Definition | An indication of which spatial representation best represents the dcterms:Location. |
| Comments | |
| Examples |
|
| decimalLatitude | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/decimalLatitude |
| Definition | A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location. |
| Comments | Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive. |
| Examples | -41.0983423 |
| decimalLongitude | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/decimalLongitude |
| Definition | A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location. |
| Comments | Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive. |
| Examples | -121.1761111 |
| geodeticDatum | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/geodeticDatum |
| Definition | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based. |
| Comments | Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value. |
| Examples |
|
| coordinateUncertaintyInMeters | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters |
| Definition | A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term. |
| Comments | Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term. |
| Examples |
|
| coordinatePrecision | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/coordinatePrecision |
| Definition | A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude. |
| Comments | |
| Examples |
|
| pointRadiusSpatialFit | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit |
| Definition | A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location. |
| Comments | Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). |
| Examples |
|
| verbatimCoordinates | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimCoordinates |
| Definition | Verbatim original spatial coordinates of a dcterms:Location. |
| Comments | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Examples |
|
| verbatimLatitude | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimLatitude |
| Definition | A verbatim original latitude of a dcterms:Location. |
| Comments | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Examples | 41 05 54.03S |
| verbatimLongitude | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimLongitude |
| Definition | A verbatim original longitude of a dcterms:Location. |
| Comments | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Examples | 121d 10' 34" W |
| verbatimCoordinateSystem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem |
| Definition | A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| verbatimSRS | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimSRS |
| Definition | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based. |
| Comments | Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| footprintWKT | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/footprintWKT |
| Definition | A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location. |
| Comments | A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other. |
| Examples | POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20)) (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21) |
| footprintSRS | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/footprintSRS |
| Definition | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based. |
| Comments | Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value not recorded. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| footprintSpatialFit | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/footprintSpatialFit |
| Definition | A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location. |
| Comments | Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). |
| Examples |
|
| georeferencedBy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferencedBy |
| Definition | A name for a dcterms:Agent responsible for providing a georeference. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| georeferencedDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferencedDate |
| Definition | The date on which the dcterms:Location was georeferenced. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| georeferenceProtocol | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferenceProtocol |
| Definition | A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128) |
| georeferenceSources | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferenceSources |
| Definition | A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| georeferenceRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferenceRemarks |
| Definition | Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol. |
| Comments | |
| Examples | Assumed distance by road (Hwy. 101) |
GeologicalContext
| GeologicalContext Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/GeologicalContext |
| Definition | A set of geological designations, such as stratigraphy, that qualifies a dcterms:Location or source of a dwc:MaterialEntity. |
| Comments | |
| Examples |
|
| geologicalContextID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/geologicalContextID |
| Definition | An identifier for the set of information associated with a dwc:GeologicalContext (the location within a geological context, such as stratigraphy). May be a global unique identifier or an identifier specific to the data set. |
| Comments | |
| Examples | https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9 |
| earliestEonOrLowestEonothem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem |
| Definition | The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| latestEonOrHighestEonothem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem |
| Definition | The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| earliestEraOrLowestErathem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem |
| Definition | The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| latestEraOrHighestErathem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem |
| Definition | The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| earliestPeriodOrLowestSystem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem |
| Definition | The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| latestPeriodOrHighestSystem | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem |
| Definition | The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| earliestEpochOrLowestSeries | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries |
| Definition | The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| latestEpochOrHighestSeries | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries |
| Definition | The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| earliestAgeOrLowestStage | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage |
| Definition | The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| latestAgeOrHighestStage | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage |
| Definition | The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| lowestBiostratigraphicZone | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone |
| Definition | The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples | Maastrichtian |
| highestBiostratigraphicZone | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone |
| Definition | The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples | Blancan |
| lithostratigraphicTerms | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms |
| Definition | The combination of all lithostratigraphic names for the rock from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples | Pleistocene-Weichselien |
| group | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/group |
| Definition | The full name of the lithostratigraphic group from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| formation | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/formation |
| Definition | The full name of the lithostratigraphic formation from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| member | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/member |
| Definition | The full name of the lithostratigraphic member from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples |
|
| bed | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/bed |
| Definition | The full name of the lithostratigraphic bed from which the dwc:MaterialEntity was collected. |
| Comments | |
| Examples | Harlem coal |
Identification
| Identification Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Identification |
| Definition | A classification of a resource according to a classification scheme. |
| Comments | For biology, the assignment of a scientific name or taxon concept to a dwc:Organism. |
| Examples |
|
| identificationID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationID |
| Definition | An identifier for a dwc:Identification. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | 9992 |
| identificationType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationType |
| Definition | A category that best matches the nature of a dwc:Identification. |
| Comments | The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| verbatimIdentification | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimIdentification |
| Definition | A string representing the taxonomic identification as it appeared in the original record. |
| Comments | This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it. |
| Examples |
|
| isAcceptedIdentification | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/isAcceptedIdentification |
| Definition | An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one. |
| Comments | Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/. |
| Examples |
|
| taxonFormula | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/taxonFormula |
| Definition | A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers. |
| Comments | Recommended best practice is to use a controlled vocabulary. |
| Examples |
|
| identificationQualifier | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationQualifier |
| Definition | A brief phrase or a standard term ("cf.", "aff.") to express the determiner's doubts about the dwc:Identification. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| typeStatus | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/typeStatus |
| Definition | A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| identifiedBy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identifiedBy |
| Definition | A name for a dcterms:Agent responsible for making a dwc:Identification. |
| Comments | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| identifiedByID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identifiedByID |
| Definition | An identifier for a dcterms:Agent responsible for making a dwc:Identification. |
| Comments | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| dateIdentified | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/dateIdentified |
| Definition | The date on which the subject was determined as representing the dwc:Taxon. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| identificationReferences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationReferences |
| Definition | A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification. |
| Comments | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| identificationVerificationStatus | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationVerificationStatus |
| Definition | A categorical indicator of the extent to which a taxonomic determination has been verified to be correct. |
| Comments | Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | 0 (unverified in HISPID/ABCD) |
| identificationRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/identificationRemarks |
| Definition | Comments or notes about the dwc:Identification. |
| Comments | |
| Examples | Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas. |
MaterialEntity
| MaterialEntity Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/MaterialEntity |
| Definition | An entity that can be identified, exists for some period of time, and consists in whole or in part of physical matter while it exists. |
| Comments | The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Examples |
|
| materialEntityID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/materialEntityID |
| Definition | An identifier for a particular instance of a dwc:MaterialEntity. |
| Comments | Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (the dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object. |
| Examples | 06809dc5-f143-459a-be1a-6f03e63fc083 |
| digitalSpecimenID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/digitalSpecimenID |
| Definition | An identifier for a Digital Specimen resource. |
| Comments | A Digital Specimen is defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity. |
| Examples | |
| materialEntityCategory | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/materialEntityCategory |
| Definition | A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity. |
| Comments | Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | liveOrganism, deadOrganism, partOfOrganism, nonMolecularBiologicalExtract, molecularBiologicalExtract, mineral, rock, fossil, chemical, humanArtifactWithBiologicalConstituent, humanArtifactWithoutBiologicalConstituent, and mixed |
| materialEntityType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/materialEntityType |
| Definition | A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory. |
| Comments | A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | |
| discipline | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/discipline |
| Definition | The primary branch or branches of knowledge represented by a dwc:MaterialEntity. |
| Comments | This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( | ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| typeOfType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/typeOfType |
| Definition | A category of nomenclatural type of a dwc:MaterialEntity. |
| Comments | The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| typifiedName | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/typifiedName |
| Definition | A scientific name for which a specimen or other name is the type. |
| Comments | The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName. |
| Examples | Polysiphonia amphibolis Womersley |
| catalogNumber | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/catalogNumber |
| Definition | An identifier (preferably unique) for a resource within a collection. |
| Comments | |
| Examples |
|
| otherCatalogNumbers | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/otherCatalogNumbers |
| Definition | A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| recordNumber | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/recordNumber |
| Definition | An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples | OPP 7101 |
| objectQuantity | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/objectQuantity |
| Definition | A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity. |
| Comments | An dwc:objectQuantity must have a corresponding dwc:objectQuantityType. |
| Examples |
|
| objectQuantityType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/objectQuantityType |
| Definition | The type of quantification system used for the quantity of dwc:MaterialEntities. |
| Comments | An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| preparations | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/preparations |
| Definition | A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| disposition | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/disposition |
| Definition | A current state of a dwc:MaterialEntity with respect to where it can be found. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| verbatimLabel | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimLabel |
| Definition | A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity. |
| Comments | The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel. |
| Examples | |
| associatedSequences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedSequences |
| Definition | A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity. |
| Comments | |
| Examples | |
| materialEntityRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/materialEntityRemarks |
| Definition | Comments or notes about a dwc:MaterialEntity. |
| Comments | |
| Examples |
|
MaterialSample
| MaterialSample Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/MaterialSample |
| Definition | A material entity that represents an entity of interest in whole or in part. |
| Comments | |
| Examples |
|
| materialSampleID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/materialSampleID |
| Definition | An identifier for the dwc:MaterialSample (as opposed to a particular digital record of the dwc:MaterialSample). In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:materialSampleID globally unique. |
| Comments | Recommended best practice is to use a persistent, globally unique identifier. |
| Examples | 06809dc5-f143-459a-be1a-6f03e63fc083 |
Occurrence
| Occurrence Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Occurrence |
| Definition | A dwc:Event that establishes the state of a dwc:Organism at a particular place and time. |
| Comments | In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Examples |
|
| occurrenceID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/occurrenceID |
| Definition | An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence). |
| Comments | In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique. |
| Examples |
|
| recordedBy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/recordedBy |
| Definition | A name for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| recordedByID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/recordedByID |
| Definition | An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| individualCount | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/individualCount |
| Definition | The number of individuals present at the time of the dwc:Occurrence. |
| Comments | |
| Examples |
|
| organismQuantity | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismQuantity |
| Definition | A number or enumeration value for the quantity of dwc:Organisms. |
| Comments | A dwc:organismQuantity must have a corresponding dwc:organismQuantityType. |
| Examples |
|
| organismQuantityType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismQuantityType |
| Definition | The type of quantification system used for the quantity of dwc:Organisms. |
| Comments | A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| sex | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sex |
| Definition | A sex of a dwc:Organism. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| lifeStage | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/lifeStage |
| Definition | An age class or life stage of a dwc:Organism. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| reproductiveCondition | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/reproductiveCondition |
| Definition | A reproductive condition of a dwc:Organism. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| caste | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/caste |
| Definition | A social caste of a dwc:Organism. |
| Comments | Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| behavior | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/behavior |
| Definition | A behavior shown by a dwc:Organism. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| vitality | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/vitality |
| Definition | An indication of whether a dwc:Organism was alive or dead at the time of collection or observation. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| establishmentMeans | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/establishmentMeans |
| Definition | Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans. |
| Comments | Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| degreeOfEstablishment | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/degreeOfEstablishment |
| Definition | The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time. |
| Comments | Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| pathway | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/pathway |
| Definition | The process by which a dwc:Organism came to be in a given place at a given time. |
| Comments | Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| georeferenceVerificationStatus | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus |
| Definition | A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| occurrenceStatus | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/occurrenceStatus |
| Definition | A statement about the detection or non-detection of a dwc:Organism during a dwc:Event. |
| Comments | For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| associatedMedia | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedMedia |
| Definition | A list (concatenated and separated) of identifiers (publication, global unique identifier, URI) of media associated with the dwc:Occurrence. |
| Comments | |
| Examples | https://arctos.database.museum/media/10520962 | https://arctos.database.museum/media/10520964 |
| associatedOccurrences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedOccurrences |
| Definition | A list (concatenated and separated) of identifiers of other dwc:Occurrence records and their associations to this dwc:Occurrence. |
| Comments | This term can be used to provide a list of associations to other dwc:Occurrences. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| associatedReferences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedReferences |
| Definition | A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the dwc:Occurrence. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Note also that the intended usage of the term dcterms:references in Darwin Core when applied to a dwc:Occurrence is to point to the definitive source representation of that dwc:Occurrence if one is available. Note also that the intended usage of dcterms:bibliographicCitation in Darwin Core when applied to a dwc:Occurrence is to provide the preferred way to cite the dwc:Occurrence itself. |
| Examples |
|
| associatedTaxa | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedTaxa |
| Definition | A list (concatenated and separated) of identifiers or names of dwc:Taxon records and the associations of this dwc:Occurrence to each of them. |
| Comments | This term can be used to provide a list of associations to dwc:Taxon records other than the one defined in the dwc:Occurrence. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. This term is not apt for establishing relationships between dwc:Taxon records, only between specific dwc:Occurrences of a dwc:Organism with other dwc:Taxon records. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| occurrenceRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/occurrenceRemarks |
| Definition | Comments or notes about the dwc:Occurrence. |
| Comments | |
| Examples | found dead on road |
Organism
| Organism Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Organism |
| Definition | A particular organism or defined group of organisms considered to be taxonomically homogeneous. |
| Comments | Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Examples |
|
| organismID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismID |
| Definition | An identifier for the dwc:Organism instance (as opposed to a particular digital record of the dwc:Organism). May be a globally unique identifier or an identifier specific to the data set. |
| Comments | |
| Examples | http://arctos.database.museum/guid/WNMU:Mamm:1249 |
| organismScope | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismScope |
| Definition | A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. To describe the kind of dwc:Organism using a URI object in RDF, use rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type) instead. |
| Examples |
|
| organismName | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismName |
| Definition | A textual name or label assigned to a dwc:Organism instance. |
| Comments | |
| Examples |
|
| causeOfDeath | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/causeOfDeath |
| Definition | An indication of the known or suspected cause of death of a dwc:Organism. |
| Comments | The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events). |
| Examples |
|
| associatedOrganisms | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/associatedOrganisms |
| Definition | A list (concatenated and separated) of identifiers of other dwc:Organisms and the associations of this dwc:Organism to each of them. |
| Comments | This term can be used to provide a list of associations to other dwc:Organisms. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| previousIdentifications | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/previousIdentifications |
| Definition | A list (concatenated and separated) of previous assignments of names to the dwc:Organism. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| organismRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismRemarks |
| Definition | Comments or notes about the dwc:Organism instance. |
| Comments | |
| Examples | One of a litter of six |
OrganismInteraction
| OrganismInteraction Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/OrganismInteraction |
| Definition | An interaction between two dwc:Organisms during a dwc:Event. |
| Comments | Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences. |
| Examples |
|
| organismInteractionID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismInteractionID |
| Definition | An identifier for a dwc:OrganismInteraction. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| organismInteractionDescription | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismInteractionDescription |
| Definition | A verbatim description of a dwc:OrganismInteraction. |
| Comments | |
| Examples | Mallophora ruficauda captured an Apis mellifera worker in flight. |
| organismInteractionType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/organismInteractionType |
| Definition | A category that best matches the nature of a dwc:OrganismInteraction. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
MeasurementOrFact
| MeasurementOrFact Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/MeasurementOrFact |
| Definition | A measurement of or fact about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Comments | Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon. |
| Examples |
|
| measurementID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementID |
| Definition | An identifier for the dwc:MeasurementOrFact (information pertaining to measurements, facts, characteristics, or assertions). May be a global unique identifier or an identifier specific to the data set. |
| Comments | |
| Examples | 9c752d22-b09a-11e8-96f8-529269fb1459 |
| parentMeasurementID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/parentMeasurementID |
| Definition | An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts. |
| Comments | May be a globally unique identifier or an identifier specific to the data set. |
| Examples |
|
| measurementType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementType |
| Definition | The nature of the measurement, fact, characteristic, or assertion. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| verbatimMeasurementType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/verbatimMeasurementType |
| Definition | A string representing the type of measurement or fact as it appeared in the original record. |
| Comments | This term is meant to allow the capture of an unaltered original name for a measurement or fact type. This term is meant to be used in addition to dwc:measurementType, not instead of it. |
| Examples |
|
| measurementValue | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementValue |
| Definition | The value of the measurement, fact, characteristic, or assertion. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| measurementAccuracy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementAccuracy |
| Definition | The description of the potential error associated with the dwc:measurementValue. |
| Comments | |
| Examples |
|
| measurementUnit | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementUnit |
| Definition | The units associated with the dwc:measurementValue. |
| Comments | Recommended best practice is to use the International System of Units (SI). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| measurementDeterminedBy | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementDeterminedBy |
| Definition | A list (concatenated and separated) of names of people, groups, or organizations who determined the value of the dwc:MeasurementOrFact. |
| Comments | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| measurementDeterminedDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementDeterminedDate |
| Definition | The date on which the dwc:MeasurementOrFact was made. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| measurementMethod | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementMethod |
| Definition | A description of or reference to (publication, URI) the method or protocol used to determine the measurement, fact, characteristic, or assertion. |
| Comments | This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| measurementRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/measurementRemarks |
| Definition | Comments or notes accompanying the dwc:MeasurementOrFact. |
| Comments | |
| Examples | tip of tail missing |
Media
| Media Class | |
|---|---|
| Identifier | http://rs.tdwg.org/ac/terms/Media |
| Definition | A digital or physical media resource. |
| Comments | An instance of digital textual media may be better represented as a dcterms:BibliographicResource. |
| Examples |
|
MolecularProtocol
| MolecularProtocol Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/MolecularProtocol |
| Definition | A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity. |
| Comments | |
| Examples |
|
| molecularProtocolID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/molecularProtocolID |
| Definition | An identifier for a dwc:MolecularProtocol. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| assayType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/assayType |
| Definition | A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
NucleotideAnalysis
| NucleotideAnalysis Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/NucleotideAnalysis |
| Definition | A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol. |
| Comments | |
| Examples | |
| readCount | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/readCount |
| Definition | The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis. |
| Comments | |
| Examples |
|
| processedTotalReadCount | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/processedTotalReadCount |
| Definition | The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis. |
| Comments | |
| Examples | 50638, 345987, 764032 |
NucleotideSequence
| NucleotideSequence Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/NucleotideSequence |
| Definition | A digital representation of a nucleotide sequence. |
| Comments | |
| Examples | |
| sequence | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/sequence |
| Definition | A string representing nucleotide base pairs. |
| Comments | Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction. |
| Examples | TCTATCCTCAATTATAGGTCATAATTCACCATCAG |
| nucleotideSequenceRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks |
| Definition | Comments or notes about a dwc:NucleotideSequence. |
| Comments | |
| Examples | |
Protocol
| Protocol Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Protocol |
| Definition | A method used during an action. |
| Comments | |
| Examples |
|
| protocolID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/protocolID |
| Definition | An identifier for a dwc:Protocol. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| protocolType | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/protocolType |
| Definition | A category that best matches the nature of a dwc:Protocol. |
| Comments | Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Examples |
|
| protocolDescription | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/protocolDescription |
| Definition | A detailed description of a dwc:Protocol. |
| Comments | |
| Examples | Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties. |
| protocolReferences | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/protocolReferences |
| Definition | A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol. |
| Comments | Recommended best practice is to separate multiple values in a list with space vertical bar space ( | ). |
| Examples | Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x |
| protocolRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/protocolRemarks |
| Definition | Comments or notes about a dwc:Protocol. |
| Comments | |
| Examples | |
Provenance
| Provenance Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Provenance |
| Definition | Information about an entity’s origins. |
| Comments | This is a convenience class to group related properties. |
| Examples | |
| projectTitle | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/projectTitle |
| Definition | A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event. |
| Comments | Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| projectID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/projectID |
| Definition | A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event. |
| Comments | A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| fundingAttribution | |
|---|---|
| Identifier | http://rs.tdwg.org/ac/terms/fundingAttribution |
| Definition | Text description of organizations or individuals who funded the creation of the resource. |
| Comments | Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples |
|
| fundingAttributionID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/fundingAttributionID |
| Definition | An identifier for a dcterms:Agent that financially supported a project. |
| Comments | Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Examples | |
ResourceRelationship
| ResourceRelationship Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/ResourceRelationship |
| Definition | A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another. |
| Comments | Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon. |
| Examples |
|
| resourceRelationshipID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/resourceRelationshipID |
| Definition | An identifier for a dwc:ResourceRelationship. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | |
| resourceID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/resourceID |
| Definition | An identifier for the resource that is the subject of the relationship. |
| Comments | |
| Examples | f809b9e0-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResourceID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relationshipOfResourceID |
| Definition | An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID. |
| Comments | Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology. |
| Examples |
|
| relatedResourceID | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relatedResourceID |
| Definition | An identifier for the related resource (the object) of a dwc:ResourceRelationship. |
| Comments | Recommended best practice is to use a globally unique identifier. |
| Examples | dc609808-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResource | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relationshipOfResource |
| Definition | The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID). |
| Comments | Recommended best practice is to use a controlled vocabulary. |
| Examples |
|
| relationshipAccordingTo | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relationshipAccordingTo |
| Definition | The source (person, organization, publication, reference) establishing the relationship between the two resources. |
| Comments | |
| Examples | Julie Woodruff |
| relationshipEstablishedDate | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate |
| Definition | The date-time on which the relationship between the two resources was established. |
| Comments | Recommended best practice is to use a date that conforms to ISO 8601-1:2019. |
| Examples |
|
| relationshipRemarks | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/relationshipRemarks |
| Definition | Comments or notes about the relationship between the two resources. |
| Comments | |
| Examples |
|
Taxon
| Taxon Class | |
|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/Taxon |
| Definition | A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026) considered by taxonomists to form a homogeneous unit. |
| Comments | |
| Examples | the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820 |
| taxonID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Identifier | http://rs.tdwg.org/dwc/terms/taxonID | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Definition | An identifier for a dwc:Taxon. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comments | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Examples |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||