Darwin Core Quick Reference Guide

This document is intended to be an easy-to-read reference of the currently recommended terms maintained as part of the Darwin Core standard and is maintained by the Darwin Core Maintenance Group.

Need help? Read more about how to use Darwin Core in the Darwin Core Questions & Answers site. Still have questions? Submit a new issue (question/problem) to the dwc-qa issues page in GitHub, or use the form.

Need to cite Darwin Core? See the Cite Darwin Core section at the bottom of this document.

Want to contribute? For information about how to contribute to the Darwin Core Standard, including how to propose changes, see the Guidelines for contributing.

This page is not part of the standard, but combines the normative term names and definitions with the non-normative notes and examples that are meant to help people to use the terms consistently. Definitions, notes, and examples may include namespace abbreviations (e.g., “dwc:”). These are included to show that the meaning for the word it is attached to very specifically means the term as defined in that namespace. Thus, dwc:Event means Event as defined by Darwin Core at https://dwc.tdwg.org/terms/#event. Capitalized terms that follow a namespace abbreviation, such as dwc:Occurrence, are class terms, which are a special category of terms used to group sets of property terms (terms that begin with lower case names that follow the namespace abbreviation, e.g., dwc:eventID) for convenience. Comprehensive metadata for current and obsolete terms from Darwin Core and borrowed standards are found in the document List of Darwin Core terms.

Additional resources can be found in the Darwin Core GitHub repository, including a directory of CSV header and list of terms files for Darwin Core Archive Cores and Extensions.

Record-level

This category contains terms that are generic in that they might apply to any type of record in a dataset.

type modified language basisOfRecord informationWithheld dataGeneralizations dynamicProperties feedbackURL

type
Identifier	http://purl.org/dc/elements/1.1/type
Definition	The nature or genre of the resource.
Notes	Must be populated with a value from the DCMI type vocabulary (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
Examples	`StillImage` `MovingImage` `Sound` `PhysicalObject` `Event` `Text`

modified
Identifier	http://purl.org/dc/terms/modified
Definition	Date on which the resource was changed.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

language
Identifier	http://purl.org/dc/elements/1.1/language
Definition	A language of the resource.
Notes	Recommended best practice is to use a controlled vocabulary such as RFC 5646. This term has an equivalent in the dcterms: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`en` (for English) `es` (for Spanish)

basisOfRecord
Identifier	http://rs.tdwg.org/dwc/terms/basisOfRecord
Definition	The specific nature of the data record.
Notes	Recommended best practice is to use a controlled vocabulary such as the set of local names of the identifiers for classes in Darwin Core.
Examples	`MaterialEntity` `PreservedSpecimen` `FossilSpecimen` `LivingSpecimen` `MaterialSample` `Event` `HumanObservation` `MachineObservation` `Taxon` `Occurrence` `MaterialCitation`

informationWithheld
Identifier	http://rs.tdwg.org/dwc/terms/informationWithheld
Definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`

dataGeneralizations
Identifier	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Coordinates generalized from original GPS coordinates to the nearest half degree grid cell`.

dynamicProperties
Identifier	http://rs.tdwg.org/dwc/terms/dynamicProperties
Definition	A list of additional measurements, facts, characteristics, or assertions about the record. Meant to provide a mechanism for structured content.
Notes	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples	`{"heightInMeters":1.5}` `{"targusLengthInMeters":0.014, "weightInGrams":120}` `{"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}` `{"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}` `{"aspectHeading":277, "slopeInDegrees":6}` `{"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}`

feedbackURL
Identifier	http://rs.tdwg.org/dwc/terms/feedbackURL
Definition	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Notes	Recommended best practice is to optionally include query strings that act to pre-populate web page form elements and communicate the context.
Examples	`https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345`

Agent

agentID agentType agentRoleOrder agentRemarks

Agent Class
Identifier	http://purl.org/dc/terms/Agent
Definition	A resource that acts or has the power to act.
Notes	A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
Examples	`a person` `a team of participants on an expedition` `a funding agency` `a particular bioacoustic monitoring installation` `a software instance` `a particular camera trap`

agentID
Identifier	http://rs.tdwg.org/dwc/terms/agentID
Definition	An identifier for a dcterms:Agent.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

agentType
Identifier	http://rs.tdwg.org/dwc/terms/agentType
Definition	A category that best matches the nature of a dcterms:Agent.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`person` `group` `organization` `camera`

agentRoleOrder
Identifier	http://rs.tdwg.org/dwc/terms/agentRoleOrder
Definition	A numerical position of an AgentRole in a set of AgentRoles.
Notes	One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
Examples	`1` `2`

agentRemarks
Identifier	http://rs.tdwg.org/dwc/terms/agentRemarks
Definition	Comments or notes about a dcterms:Agent.
Notes
Examples

Assertion

assertionID assertionType verbatimAssertionType assertionValue assertionUnit assertionError assertionBy assertionMadeDate assertionEffectiveDate assertionProtocols assertionReferences assertionRemarks

Assertion Class
Identifier	http://rs.tdwg.org/dwc/terms/Assertion
Definition	A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`

assertionID
Identifier	http://rs.tdwg.org/dwc/terms/assertionID
Definition	An identifier for a dwc:Assertion.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

assertionType
Identifier	http://rs.tdwg.org/dwc/terms/assertionType
Definition	A category that best matches the nature of a dwc:Assertion.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tailLength` `waterTemperature` `trapLineLength` `surveyArea` `trapType`

verbatimAssertionType
Identifier	http://rs.tdwg.org/dwc/terms/verbatimAssertionType
Definition	A string representing the type of dwc:Assertion as it appeared in an original record.
Notes	This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`

assertionValue
Identifier	http://rs.tdwg.org/dwc/terms/assertionValue
Definition	An asserted value.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`45` `20` `1` `14.5` `UV-light` `Hamon grab`

assertionUnit
Identifier	http://rs.tdwg.org/dwc/terms/assertionUnit
Definition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`m` `s` `g` `ml` `%` `individuals`

assertionError
Identifier	http://rs.tdwg.org/dwc/terms/assertionError
Definition	A description of the potential error associated with a dwc:assertionValue.
Notes
Examples	`0.01` `normal distribution with variation of 2 m`

assertionBy
Identifier	http://rs.tdwg.org/dwc/terms/assertionBy
Definition	A name for a dcterms:Agent responsible for making a dwc:Assertion.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey` `ChatGPT` `Notes From Nature` `ROV SuBastian`

assertionMadeDate
Identifier	http://rs.tdwg.org/dwc/terms/assertionMadeDate
Definition	A date on which a dwc:Assertion was created.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

assertionEffectiveDate
Identifier	http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
Definition	A date-time or time interval during which an asserted state or measurement was deemed to be in effect.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

assertionProtocols
Identifier	http://rs.tdwg.org/dwc/terms/assertionProtocols
Definition	Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
Notes
Examples

assertionReferences
Identifier	http://rs.tdwg.org/dwc/terms/assertionReferences
Definition	A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples

assertionRemarks
Identifier	http://rs.tdwg.org/dwc/terms/assertionRemarks
Definition	Comments or notes about a dwc:Assertion.
Notes
Examples	`tip of tail missing` `error determined by independently calibrated measurements` `error provided is from the manufacturer’s standard instrument specification`

BibliographicResource

referenceID bibliographicCitation bibliographicIdentifier bibliographicIdentifierType referenceType referenceRemarks

BibliographicResource Class
Identifier	http://purl.org/dc/terms/BibliographicResource
Definition	A book, article, or other documentary resource.
Notes
Examples

referenceID
Identifier	http://rs.tdwg.org/dwc/terms/referenceID
Definition	An identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

bibliographicCitation
Identifier	http://purl.org/dc/terms/bibliographicCitation
Definition	A bibliographic reference for the resource.
Notes	From Dublin Core, "Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible." The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself - "how to cite this record". Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource - "where to find the as-close-to-original reference", if one is available.
Examples	`Museum of Vertebrate Zoology, UC Berkeley. MVZ Mammal Collection (Arctos). Record ID: http://arctos.database.museum/guid/MVZ:Mamm:165861?seid=101356. Source: http://ipt.vertnet.org:8080/ipt/resource.do?r=mvz_mammal.` (Occurrence example) `https://www.gbif.org/species/2439608 Source: GBIF Taxonomic Backbone` (Taxon example) `Rand, K.M., Logerwell, E.A. The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s. Polar Biol 34, 475–488 (2011). https://doi.org/10.1007/s00300-010-0900-2` (Event example)

bibliographicIdentifier
Identifier	http://rs.tdwg.org/dwc/terms/bibliographicIdentifier
Definition	A number or symbol to uniquely identify a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a globally unique identifier issued by recognizable authority (e.g., International ISBN Agency, International DOI Foundation).
Examples	`978-0565095024` `10998406` `10.1046/j.1420-9101.1997.10010039.x`

bibliographicIdentifierType
Identifier	http://rs.tdwg.org/dwc/terms/bibliographicIdentifierType
Definition	A code that best matches the nature of an identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary of identifier issuers. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`ISBN` `DOI` `ISSN` `OCN`

referenceType
Identifier	http://rs.tdwg.org/dwc/terms/referenceType
Definition	A category that best matches the nature of a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`book`, `bookSection`, `journalArticle`, `thesis` `proceedingsPaper` `report` `poster` `fieldNotebook` `log` `oralCommunication`

referenceRemarks
Identifier	http://rs.tdwg.org/dwc/terms/referenceRemarks
Definition	Comments or notes about a dcterms:BibliographicResource.
Notes
Examples

ChronometricAge

chronometricAgeID verbatimChronometricAge chronometricAgeProtocol uncalibratedChronometricAge chronometricAgeConversionProtocol earliestChronometricAge earliestChronometricAgeReferenceSystem latestChronometricAge latestChronometricAgeReferenceSystem chronometricAgeUncertaintyInYears chronometricAgeUncertaintyMethod materialDated materialDatedID materialDatedRelationship chronometricAgeDeterminedBy chronometricAgeDeterminedDate chronometricAgeReferences chronometricAgeRemarks

ChronometricAge Class
Identifier	http://rs.tdwg.org/chrono/terms/ChronometricAge
Definition	An approximation of a temporal position (in the sense conveyed by https://www.w3.org/TR/owl-time/#time:TemporalPosition) that is supported via evidence.
Notes	The age of a specimen and how this age is known, whether by a dating assay, a relative association with dated material, or legacy collections information.
Examples	`An age range associated with a specimen derived from an AMS dating assay applied to an oyster shell in the same stratum` `An age range associated with a specimen derived from a ceramics analysis based on other materials found in the same stratum` `A maximum age associated with a specimen derived from K-Ar dating applied to a proximal volcanic tuff found stratigraphically below the specimen` `An age range of a specimen based on its biostratigraphic context` `An age of a specimen based on what is reported in legacy collections data`.

chronometricAgeID
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Definition	An identifier for the set of information associated with a chrono:ChronometricAge.
Notes	May be a global unique identifier or an identifier specific to the dataset. This can be used to link this record to another repository where more information about the dataset is shared.
Examples	`https://www.canadianarchaeology.ca/samples/70673`

verbatimChronometricAge
Identifier	http://rs.tdwg.org/chrono/terms/verbatimChronometricAge
Definition	The verbatim age for a specimen, whether reported by a dating assay, associated references, or legacy information.
Notes	For example, this could be the radiocarbon age as given in an AMS dating report. This could also be simply what is reported as the age of a specimen in legacy collections data.
Examples	`27 BC to 14 AD`, `stratigraphically pre-1104`

chronometricAgeProtocol
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeProtocol
Definition	A description of or reference to the methods used to determine the chrono:ChronometricAge.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`radiocarbon AMS` `K-Ar dates for the lower most marker tuff` `historic documentation` `ceramic seriation`

uncalibratedChronometricAge
Identifier	http://rs.tdwg.org/chrono/terms/uncalibratedChronometricAge
Definition	The output of a dating assay before it is calibrated into an age using a specific conversion protocol.
Notes
Examples	`1510 +/- 25 14C yr BP`, `16.26 Ma +/- 0.016`

chronometricAgeConversionProtocol
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeConversionProtocol
Definition	The method used for converting the chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in the chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem fields.
Notes	For example, calibration of conventional radiocarbon age or the currently accepted age range of a cultural or geological period. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`INTCAL13` `sequential 6 phase Bayesian model and IntCal13 calibration`

earliestChronometricAge
Identifier	http://rs.tdwg.org/chrono/terms/earliestChronometricAge
Definition	The maximum/earliest/oldest possible age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated chrono:earliestChronometricAgeReferenceSystem.
Examples	`100`

earliestChronometricAgeReferenceSystem
Identifier	http://rs.tdwg.org/chrono/terms/earliestChronometricAgeReferenceSystem
Definition	The reference system associated with the chrono:earliestChronometricAge.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`

latestChronometricAge
Identifier	http://rs.tdwg.org/chrono/terms/latestChronometricAge
Definition	The minimum/latest/youngest possible age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated chrono:latestChronometricAgeReferenceSystem.
Examples	`27`

latestChronometricAgeReferenceSystem
Identifier	http://rs.tdwg.org/chrono/terms/latestChronometricAgeReferenceSystem
Definition	The reference system associated with the chrono:latestChronometricAge.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`

chronometricAgeUncertaintyInYears
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyInYears
Definition	The temporal uncertainty of the chrono:earliestChronometricAge and chrono:latestChronometricAge in years.
Notes	The expected unit for this field is years. The value in this field is number of years before and after the values given in the chrono:earliestChronometricAge and chrono:latestChronometricAge fields within which the actual values are estimated to be.
Examples	`100`

chronometricAgeUncertaintyMethod
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyMethod
Definition	The method used to generate the value of chrono:chronometricAgeUncertaintyInYears.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`2-sigma calibrated range` `Half of 95% confidence interval`

materialDated
Identifier	http://rs.tdwg.org/chrono/terms/materialDated
Definition	A description of the material on which the chrono:chronometricAgeProtocol was actually performed, if known.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Double Tuff` `Charcoal found in Stratum V` `charred wood` `tooth`

materialDatedID
Identifier	http://rs.tdwg.org/chrono/terms/materialDatedID
Definition	An identifier for the dwc:MaterialEntity on which the chrono:chronometricAgeProtocol was performed, if applicable.
Notes
Examples	`dwc:materialEntityID: https://www.ebi.ac.uk/metagenomics/samples/SRS1930158`

materialDatedRelationship
Identifier	http://rs.tdwg.org/chrono/terms/materialDatedRelationship
Definition	The relationship of the chrono:materialDated to the subject of the chrono:ChronometricAge record, from which the chrono:ChronometricAge of the subject is inferred.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`sameAs` (cases where the subject material was completely destructively subsampled to get the ChronometricAge) `subsampleOf` (cases where part of the original specimen was extracted as the material used to determine the ChronometricAge) `inContextWith` (cases where the ChronometricAge is inferred from materialDated, such as sediments or cultural objects, in related temporal context) `stratigraphicallyCorrelatedWith` (cases where the ChronometricAge is inferred from materialDated in a stratigraphically correlated context)

chronometricAgeDeterminedBy
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedBy
Definition	A list (concatenated and separated) of names of people, groups, or organizations who determined the chrono:ChronometricAge.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Michelle LeFebvre \| Neill Wallis`

chronometricAgeDeterminedDate
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedDate
Definition	The date on which the chrono:ChronometricAge was determined.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-0600` (8 Mar 1963 at 2:07pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 8:40am UTC) `2018-08-29T15:19` (3:19pm local time on 29 August 2018) `1809-02-12` (some time during 12 February 1809) `1906-06` (some time in June 1906) `1971` (some time in the year 1971)

chronometricAgeReferences
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeReferences
Definition	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the chrono:ChronometricAge.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`Pluckhahn, Thomas J., Neill J. Wallis, and Victor D. Thompson. 2020 The History and Future of Migrationist Explanation in the Archaeology of the Eastern Woodlands: A Review and Case Study of the Woodland Period Gulf Coast. Journal of Archaeological Research. https://doi.org/10.1007/s10814-019-09140-x`

chronometricAgeRemarks
Identifier	http://rs.tdwg.org/chrono/terms/chronometricAgeRemarks
Definition	Notes or comments about the chrono:ChronometricAge.
Notes
Examples	`Beta Analytic number: 323913 \| One of the Crassostrea virginica right valve specimens from North Midden Feature 17 was chosen for AMS dating, but it is unclear exactly which specimen it was.`

Event

Event Class
Identifier	http://rs.tdwg.org/dwc/terms/Event
Definition	An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
Notes
Examples	`a material collecting event` `a bird observation` `a camera trap image capture` `an organism occurrence` `a biotic survey`

eventID
Identifier	http://rs.tdwg.org/dwc/terms/eventID
Definition	An identifier for the set of information associated with a dwc:Event (something that occurs at a place and time). May be a global unique identifier or an identifier specific to the data set.
Notes
Examples	`INBO:VIS:Ev:00009375`

parentEventID
Identifier	http://rs.tdwg.org/dwc/terms/parentEventID
Definition	An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`A1` (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - `A1:1`, `A1:2`).

eventCategory
Identifier	http://rs.tdwg.org/dwc/terms/eventCategory
Definition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: `Event`, `MaterialGathering`, `Occurrence`, `OrganismInteraction`, or `Survey`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Event` `MaterialGathering` `Occurrence` `OrganismInteraction` `Survey`

eventType
Identifier	http://rs.tdwg.org/dwc/terms/eventType
Definition	A narrow category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`bioBlitz` `cameraTrapDeployment` `expedition` `project` `siteVisit` `trawl`

fieldNumber
Identifier	http://rs.tdwg.org/dwc/terms/fieldNumber
Definition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`RV Sol 87-03-08`

eventDurationValue
Identifier	http://rs.tdwg.org/eco/terms/eventDurationValue
Definition	The numeric value for the duration of the dwc:Event.
Notes	An eco:eventDurationValue must have a corresponding eco:eventDurationUnit.
Examples	`1` `30`

eventDurationUnit
Identifier	http://rs.tdwg.org/eco/terms/eventDurationUnit
Definition	The units associated with the eco:eventDurationValue.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minutes` `hours` `days` `months` `years`

eventDate
Identifier	http://rs.tdwg.org/dwc/terms/eventDate
Definition	A date-time or time interval during which a dwc:Event occurred.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

eventTime
Identifier	http://rs.tdwg.org/dwc/terms/eventTime
Definition	The time or interval during which a dwc:Event occurred.
Notes	Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019.
Examples	`14:07-06:00` (at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `08:40:21Z` (at or after 8:40:21am and before 8:41:22am UTC) `13:00:00Z/15:30:00Z` (at or after 1pm and before 3:30pm UTC)

startDayOfYear
Identifier	http://rs.tdwg.org/dwc/terms/startDayOfYear
Definition	The earliest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)

endDayOfYear
Identifier	http://rs.tdwg.org/dwc/terms/endDayOfYear
Definition	The latest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)

year
Identifier	http://rs.tdwg.org/dwc/terms/year
Definition	The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar.
Notes
Examples	`1160` `2008`

month
Identifier	http://rs.tdwg.org/dwc/terms/month
Definition	The integer month in which the dwc:Event occurred.
Notes
Examples	`1` (January) `10` (October)

day
Identifier	http://rs.tdwg.org/dwc/terms/day
Definition	The integer day of the month on which the dwc:Event occurred.
Notes
Examples	`9` `28`

verbatimEventDate
Identifier	http://rs.tdwg.org/dwc/terms/verbatimEventDate
Definition	The verbatim original representation of the date and time information for a dwc:Event.
Notes
Examples	`spring 1910` `Marzo 2002` `1999-03-XX` `17IV1934`

habitat
Identifier	http://rs.tdwg.org/dwc/terms/habitat
Definition	A category or description of the habitat in which the dwc:Event occurred.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`oak savanna` `pre-cordilleran steppe`

isVegetationCoverReported
Identifier	http://rs.tdwg.org/eco/terms/isVegetationCoverReported
Definition	A vegetation cover metric was reported.
Notes	Typically values or descriptions of vegetation cover would be captured under the term eco:verbatimSiteDescriptions. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

sampledSubstrateCategory
Identifier	http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
Definition	A category or type of substrate sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`vegetation` `soil` `ocean`

sampledSubstrateLayer
Identifier	http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
Definition	A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`forest floor` `herbaceous \| shrub` `understory` `canopy` `organic (O)` `surface (A)` `eluviated (E)` `subsoil (B)` `parent material (C)` `bedrock (R)` `epipelagic \| mesopelagic` `bathypelagic` `abysopelagic` `hadalpelagic`

samplingProtocol
Identifier	http://rs.tdwg.org/dwc/terms/samplingProtocol
Definition	The names of, references to, or descriptions of the methods or protocols used during an eco:Survey.
Notes	Recommended best practice is to describe an eco:Survey with no more than one sampling protocol. In the case of a summary eco:Survey with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`UV light trap` `mist net` `bottom trawl` `ad hoc observation \| point count` `Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x` `Takats et al. 2001. Guidelines for Nocturnal Owl Monitoring in North America. Beaverhill Bird Observatory and Bird Studies Canada, Edmonton, Alberta. 32 pp., http://www.bsc-eoc.org/download/Owl.pdf`

sampleSizeValue
Identifier	http://rs.tdwg.org/dwc/terms/sampleSizeValue
Definition	A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit.
Examples	`5` (sampleSizeValue) with `metre` (sampleSizeUnit)

sampleSizeUnit
Identifier	http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., `5` for dwc:sampleSizeValue with `m` for dwc:sampleSizeUnit. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minute` `hour` `day` `metre` `square metre` `cubic metre`

samplingEffort
Identifier	http://rs.tdwg.org/dwc/terms/samplingEffort
Definition	The amount of effort expended during an eco:Survey.
Notes
Examples	`40 trap-nights` `10 observer-hours` `10 km by foot` `30 km by car`

fieldNotes
Identifier	http://rs.tdwg.org/dwc/terms/fieldNotes
Definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Notes available in the Grinnell-Miller Library.`

reportedExtremeConditions
Identifier	http://rs.tdwg.org/eco/terms/reportedExtremeConditions
Definition	A description of any extreme weather or environmental conditions that may have affected the dwc:Event.
Notes
Examples	`flooding during week 3 of surveys` `rockslide at site 2`

reportedWeather
Identifier	http://rs.tdwg.org/eco/terms/reportedWeather
Definition	A list of weather or climatic conditions present during the dwc:Event.
Notes	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples	`{"minimumTemperatureInDegreesFahrenheit": 18, "maximumTemperatureInDegreesFahrenheit": 32}`

eventRemarks
Identifier	http://rs.tdwg.org/dwc/terms/eventRemarks
Definition	Comments or notes about the dwc:Event.
Notes
Examples	`After the recent rains the river is nearly at flood stage.`

GeologicalContext

GeologicalContext Class
Identifier	http://rs.tdwg.org/dwc/terms/GeologicalContext
Definition	A set of geological designations, such as stratigraphy, that qualify a dcterms:Location or source of a dwc:MaterialEntity.
Notes
Examples	`a particular lithostratigraphic layer` `a specific chronostratigraphic unit`

geologicalContextID
Identifier	http://rs.tdwg.org/dwc/terms/geologicalContextID
Definition	An identifier for a dwc:GeologicalContext.
Notes	May be a global unique identifier or an identifier specific to the data set.
Examples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`

earliestEonOrLowestEonothem
Identifier	http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Definition	The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Phanerozoic` `Proterozoic` `Precambrian`

latestEonOrHighestEonothem
Identifier	http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Definition	The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Phanerozoic` `Proterozoic` `Precambrian`

earliestEraOrLowestErathem
Identifier	http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Definition	The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Cenozoic` `Mesozoic`

latestEraOrHighestErathem
Identifier	http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Definition	The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Cenozoic` `Mesozoic`

earliestPeriodOrLowestSystem
Identifier	http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Definition	The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Neogene` `Tertiary` `Quaternary`

latestPeriodOrHighestSystem
Identifier	http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Definition	The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Neogene` `Tertiary` `Quaternary`

earliestEpochOrLowestSeries
Identifier	http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Definition	The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Holocene` `Pleistocene` `Ibexian Series`

latestEpochOrHighestSeries
Identifier	http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Definition	The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Holocene` `Pleistocene` `Ibexian Series`

earliestAgeOrLowestStage
Identifier	http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Definition	The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Atlantic` `Boreal` `Skullrockian`

latestAgeOrHighestStage
Identifier	http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Definition	The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Atlantic` `Boreal` `Skullrockian`

lowestBiostratigraphicZone
Identifier	http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Definition	The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Maastrichtian`

highestBiostratigraphicZone
Identifier	http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Definition	The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Notes
Examples	`Blancan`

lithostratigraphicTerms
Identifier	http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Definition	The combination of all lithostratigraphic names for the rock from which the dwc:MaterialEntity was collected.
Notes
Examples	`Pleistocene-Weichselien`

group
Identifier	http://rs.tdwg.org/dwc/terms/group
Definition	The full name of the lithostratigraphic group from which the dwc:MaterialEntity was collected.
Notes
Examples	`Bathurst` `Lower Wealden`

formation
Identifier	http://rs.tdwg.org/dwc/terms/formation
Definition	The full name of the lithostratigraphic formation from which the dwc:MaterialEntity was collected.
Notes
Examples	`Notch Peak Formation` `House Limestone` `Fillmore Formation`

member
Identifier	http://rs.tdwg.org/dwc/terms/member
Definition	The full name of the lithostratigraphic member from which the dwc:MaterialEntity was collected.
Notes
Examples	`Lava Dam Member` `Hellnmaria Member`

bed
Identifier	http://rs.tdwg.org/dwc/terms/bed
Definition	The full name of the lithostratigraphic bed from which the dwc:MaterialEntity was collected.
Notes
Examples	`Harlem coal`

geologicEvent
Identifier	http://rs.tdwg.org/dwc/terms/geologicEvent
Definition	A name of an identifiable event during which one or more geologic processes acted to create or modify one or more dwc:GeologicalMaterials.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Sevier orogeny` `Alleghanian orogeny` `Alpine orogeny` `Variscan orogeny` `Vredefort impact`

geologicProvince
Identifier	http://rs.tdwg.org/dwc/terms/geologicProvince
Definition	An extensive named region with similar geologic history, structural, petrographic, or physiographic features throughout in which the GeologicalContext was located.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Northwest Province` `Surprise Paleovalley` `Basin and Range` ;`Coastal Plain` `Piedmont` `Blue Ridge`

lithodemicUnit
Identifier	http://rs.tdwg.org/dwc/terms/lithodemicUnit
Definition	A geologic unit that lacks stratification, is primarily comprised of intrusive, deformed, and/or metamorphosed rock, and is characterized by irregularly mixed lithology or highly complicated structural relations.
Notes	Due to the unstructured nature of complexes, both named units and lithological descriptive terms are acceptable values.
Examples	`Catalina Core Complex` `injection complex` `New England Plutonic Suite` `Sierra Nevada batholith`

tectonicUnits
Identifier	http://rs.tdwg.org/dwc/terms/tectonicUnits
Definition	The combination of all tectonic unit names for the rock from which a dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an authoritative tectonic unit lexicon such as the Tectonic Map of Switzerland (TK500). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Upper Helvetic` `Wildhorn Nappe Complex` `Sublage Nappe`

GeologicalMaterial

geologicalMaterialNames geologicMaterialNameID geologicalMaterialNameTypes classificationCodes mineralSequence measuredChemistry measuredChemistrySource mineralogicalAnalysisProtocol chemistryRemarks

GeologicalMaterial Class
Identifier	http://rs.tdwg.org/dwc/terms/GeologicalMaterial
Definition	A dwc:MaterialEntity that is geological in nature.
Notes
Examples	`a specific mineral` `a specific rock` `a specific ore`

geologicalMaterialNames
Identifier	http://rs.tdwg.org/dwc/terms/geologicalMaterialNames
Definition	A list (concatenated and separated) of mineral or lithotaxon names for a dwc:GeologicalMaterial.
Notes	May includes both informal (e.g., variety, synonym) and formal (classification) names. The first name in the list should be considered the preferred name. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`quartz \| smoky quartz` `muscovite` `garnet group`

geologicMaterialNameID
Identifier	http://rs.tdwg.org/dwc/terms/geologicMaterialNameID
Definition	An identifier for a mineral or lithotaxon name for a dwc:GeologicalMaterial. May be a global unique identifier or an identifier specific to the data set.
Notes	Recommended best practice is to use a persistent, globally unique identifier.
Examples	`https://geospecimens.org/api/v1/catalog/resource/mineral-name/ba673bdf-7228-11f0-a057-52f8e1bb0628`

geologicalMaterialNameTypes
Identifier	http://rs.tdwg.org/dwc/terms/geologicalMaterialNameTypes
Definition	A list (concatenated and separated) of the types of names provided in dwc:geologicalMaterialNames.
Notes	If this term is populated, it should have an equal number of items in the list as for the list in dwc:geologicalMaterialNames and the types should have the same order as the names to which they refer. Recommended best practice is to use a controlled vocabulary for the values in a list (e.g., https://kos.geospecimens.org/def/geological-specimen-name-type). See Gavryliv (2023), https://doi.org/10.1180/mgm.2023.23, for a detailed breakdown of informal, alternate names.
Examples	`species \| variety` `species` `group` `synonym` `classification` `historical`

classificationCodes
Identifier	http://rs.tdwg.org/dwc/terms/classificationCodes
Definition	A list (concatenated and separated) of codes that each identifies a name from a classification system applied to a dwc:GeologicalMaterial.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`71.02.02a.01` ("muscovite" in the Dana classification system) `9.AD.25` ("garnet group" in the Nickel-Strunz classification system) `75.01.03.01 \| 4.DA.05` ("quartz" the Dana classification system and "quartz group" in the Nickel-Strunz classification system)

mineralSequence
Identifier	http://rs.tdwg.org/dwc/terms/mineralSequence
Definition	A list (concatenated and separated) of minerals in a dwc:GeologicalMaterial, ordered in a manner that illustrates the relative timing of mineral formation.
Notes	The list should only contain minerals that belong to a readily identifiable sequence of formation. Therefore, a list may contain a subset of the minerals in a specimen. Minerals that formed in-situ with one another are separated by a plus. Minerals that formed in the sequence are separated by a greater than (' > ') symbol.
Examples	`Sphalerite > Quartz > Pyrite` `Calcite > Quartz > Sphalerite > Pyrite`

measuredChemistry
Identifier	http://rs.tdwg.org/dwc/terms/measuredChemistry
Definition	A concise expression of the chemical composition of a mineral that shows the number of atoms of each element in a molecule, their spatial arrangement, and their linkage to each other.
Notes
Examples	`SiO2 (65.76)` `TiO2 (32.120)` `Al2O3 (2.21)` `(Mg0.77Fe0.23)2SiO4` `An6.4 Ab73.6 Or20`

measuredChemistrySource
Identifier	http://rs.tdwg.org/dwc/terms/measuredChemistrySource
Definition	A list (concatenated and separated) of resources associated with the reported measured chemistry described specifically enough to allow anyone in the future to use the same resources.
Notes	Recommended best practice is to use full bibliographic citations, global unique identifiers, or resolvable and persistent IRIs. See the broader concept http://rs.tdwg.org/dwc/terms/associatedReferences. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Novak, G. A., & Gibbs, G. V. (1971). The crystal chemistry of the silicate garnets. American Mineralogist: Journal of Earth and Planetary Materials, 56(5-6), 791-825.`

mineralogicalAnalysisProtocol
Identifier	http://rs.tdwg.org/dwc/terms/mineralogicalAnalysisProtocol
Definition	A technique used to determine the chemical composition or crystallography of a mineral.
Notes	Acronyms should be avoided even for widely recognized annotations. Recommended best practice is to use a controlled vocabulary such as https://vocabs.ardc.edu.au/viewById/650. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Wet Chemistry` `X-ray fluorescence` `Electron probe microanalysis` `Scanning electron microscopy with energy-dispersive X-ray spectroscopy` `X-ray diffraction`

chemistryRemarks
Identifier	http://rs.tdwg.org/dwc/terms/chemistryRemarks
Definition	General remarks about the chemical and isotopic composition of a dwc:GeologicalMaterial.
Notes
Examples

Identification

identificationID identificationType verbatimIdentification isAcceptedIdentification taxonFormula taxonSortOrder identificationQualifier typeStatus identifiedBy identifiedByID dateIdentified identificationReferences identificationVerificationStatus identificationRemarks

Identification Class
Identifier	http://rs.tdwg.org/dwc/terms/Identification
Definition	A classification of a resource according to a classification scheme.
Notes	For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
Examples	`a subspecies determination of an organism` `a nomenclatural act designating a specimen as a holotype`

identificationID
Identifier	http://rs.tdwg.org/dwc/terms/identificationID
Definition	An identifier for a dwc:Identification.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`9992`

identificationType
Identifier	http://rs.tdwg.org/dwc/terms/identificationType
Definition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`geography` `taxonomicRevision` `functionalAttributes` `nucleotideAnalysis` `karyotype` `media` `relationship` `features` `fineFeatures` `unknown`

verbatimIdentification
Identifier	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Definition	A string representing the classification as it appeared in the original record.
Notes	This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:geologicalMaterialNames or dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it.
Examples	`Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?` `Potentilla × pantotricha Soják` `Aconitum pilipes × A. variegatum` `Lepomis auritus x cyanellus`

isAcceptedIdentification
Identifier	http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
Definition	An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

taxonFormula
Identifier	http://rs.tdwg.org/dwc/terms/taxonFormula
Definition	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`A` `not A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`

taxonSortOrder
Identifier	http://rs.tdwg.org/dwc/terms/taxonSortOrder
Definition	A numerical position of a dwc:Taxon in a dwc:taxonFormula.
Notes	The number signifies which dwc:Taxon in the related dwc:taxonFormula this record refers to (e.g., `1` refs to the `A` in the dwc:taxonFormula "A x B").
Examples	`1` `2`

identificationQualifier
Identifier	http://rs.tdwg.org/dwc/terms/identificationQualifier
Definition	A brief phrase or a standard term ("cf.", "aff.") to express the determiner's doubts about the dwc:Identification.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`aff. agrifolia var. oxyadenia` (for `Quercus aff. agrifolia var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank) `cf. var. oxyadenia` (for `Quercus agrifolia cf. var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank)

typeStatus
Identifier	http://rs.tdwg.org/dwc/terms/typeStatus
Definition	A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`

identifiedBy
Identifier	http://rs.tdwg.org/dwc/terms/identifiedBy
Definition	A name for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey` `MegaDetector V5`

identifiedByID
Identifier	http://rs.tdwg.org/dwc/terms/identifiedByID
Definition	An identifier for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)

dateIdentified
Identifier	http://rs.tdwg.org/dwc/terms/dateIdentified
Definition	The date on which the dwc:Identification was made.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

identificationReferences
Identifier	http://rs.tdwg.org/dwc/terms/identificationReferences
Definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`

identificationVerificationStatus
Identifier	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Definition	A categorical indicator of the extent to which a dwc:Identification has been verified to be correct.
Notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`0` (unverified in HISPID/ABCD)

identificationRemarks
Identifier	http://rs.tdwg.org/dwc/terms/identificationRemarks
Definition	Comments or notes about the dwc:Identification.
Notes
Examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`

Location

locationID siteNumber higherGeographyID higherGeography continent waterBody islandGroup island country countryCode stateProvince county municipality locality verbatimLocality namedPlace minimumElevationInMeters maximumElevationInMeters verbatimElevation verticalDatum minimumDepthInMeters maximumDepthInMeters verbatimDepth minimumDistanceAboveSurfaceInMeters maximumDistanceAboveSurfaceInMeters locationAccordingTo locationRemarks preferredSpatialRepresentation decimalLatitude decimalLongitude geodeticDatum coordinateUncertaintyInMeters coordinatePrecision pointRadiusSpatialFit verbatimCoordinates verbatimLatitude verbatimLongitude verbatimCoordinateSystem verbatimSRS footprintWKT footprintSRS footprintSpatialFit georeferencedBy georeferencedDate georeferenceProtocol georeferenceSources georeferenceRemarks

Location Class
Identifier	http://purl.org/dc/terms/Location
Definition	A spatial region or named place.
Notes
Examples	`the municipality of San Carlos de Bariloche, Río Negro, Argentina` `the place defined by a georeference`

locationID
Identifier	http://rs.tdwg.org/dwc/terms/locationID
Definition	An identifier for a dcterms:Location.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1`

siteNumber
Identifier	http://rs.tdwg.org/dwc/terms/siteNumber
Definition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`USGS CENO LOC 21387` `UCM 2025001`

higherGeographyID
Identifier	http://rs.tdwg.org/dwc/terms/higherGeographyID
Definition	An identifier for the geographic region within which the dcterms:Location occurred.
Notes	Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`http://vocab.getty.edu/tgn/1002002` (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).

higherGeography
Identifier	http://rs.tdwg.org/dwc/terms/higherGeography
Definition	A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from least specific to most specific.
Examples	`North Atlantic Ocean` `South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos` with accompanying values `South America` (continent) `Argentina` (country), `Neuquén` (first order division), and `Los Lagos` (second order division)

continent
Identifier	http://rs.tdwg.org/dwc/terms/continent
Definition	The name of the continent in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Africa` `Antarctica` `Asia` `Europe` `North America` `Oceania` `South America`

waterBody
Identifier	http://rs.tdwg.org/dwc/terms/waterBody
Definition	The name of the water body in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Indian Ocean` `Baltic Sea` `Hudson River` `Lago Nahuel Huapi`

islandGroup
Identifier	http://rs.tdwg.org/dwc/terms/islandGroup
Definition	The name of the island group in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Alexander Archipelago` `Archipiélago Diego Ramírez` `Seychelles`

island
Identifier	http://rs.tdwg.org/dwc/terms/island
Definition	The name of the island on or near which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Nosy Be` `Bikini Atoll` `Vancouver` `Viti Levu` `Zanzibar`

country
Identifier	http://rs.tdwg.org/dwc/terms/country
Definition	The name of the country or major administrative unit in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Denmark` `Colombia` `España`

countryCode
Identifier	http://rs.tdwg.org/dwc/terms/countryCode
Definition	The standard code for the country in which the dcterms:Location occurs.
Notes	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`AR` `SV` `XZ` `ZZ`

stateProvince
Identifier	http://rs.tdwg.org/dwc/terms/stateProvince
Definition	The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Montana` `Minas Gerais` `Córdoba`

county
Identifier	http://rs.tdwg.org/dwc/terms/county
Definition	The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Missoula` `Los Lagos` `Mataró`

municipality
Identifier	http://rs.tdwg.org/dwc/terms/municipality
Definition	The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Holzminden` `Araçatuba` `Ga-Segonyana`

locality
Identifier	http://rs.tdwg.org/dwc/terms/locality
Definition	The specific description of the place.
Notes	Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description.
Examples	`Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)` `Queets Rainforest, Olympic National Park`

verbatimLocality
Identifier	http://rs.tdwg.org/dwc/terms/verbatimLocality
Definition	An original textual description of a dcterms:Location.
Notes
Examples	`25 km NNE Bariloche por R. Nac. 237`

namedPlace
Identifier	http://rs.tdwg.org/dwc/terms/namedPlace
Definition	The full, unabbreviated name of a geographic location not otherwise categorized by a dcterms:Location property that is naturally occurring or anthropogenic in origin within a historical, administrative, or cultural context in which a dcterms:Location occurs.
Notes	Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities or may be in multiple possible entities that meet the term definition. For named places represented as URIs or global unique identifiers, please use dwc:locationID.
Examples	`11th Level, Bergwerksglücker Lode, Wiemannsbucht Mine` `Craigleith Quarry` `Red Cloud Mine` `NEON Niwot Ridge Mountain Research Station (NIWO)` `Hagerman Fossil Beds` `Mauna Kea`

minimumElevationInMeters
Identifier	http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Definition	The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`-100` `802`

maximumElevationInMeters
Identifier	http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Definition	The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`-205` `1236`

verbatimElevation
Identifier	http://rs.tdwg.org/dwc/terms/verbatimElevation
Definition	An original description of the elevation of a dcterms:Location.
Notes
Examples	`100-200 m`

verticalDatum
Identifier	http://rs.tdwg.org/dwc/terms/verticalDatum
Definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EGM84` `EGM96` `EGM2008` `PGM2000A` `PGM2004` `PGM2006` `PGM2007` `EPSG:7030` `not recorded`

minimumDepthInMeters
Identifier	http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Definition	The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`0` `100`

maximumDepthInMeters
Identifier	http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Definition	The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`0` `200`

verbatimDepth
Identifier	http://rs.tdwg.org/dwc/terms/verbatimDepth
Definition	The original description of the depth below the local surface.
Notes
Examples	`100-200 m`

minimumDistanceAboveSurfaceInMeters
Identifier	http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Definition	The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Notes
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.

maximumDistanceAboveSurfaceInMeters
Identifier	http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Definition	The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Notes
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.

locationAccordingTo
Identifier	http://rs.tdwg.org/dwc/terms/locationAccordingTo
Definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Getty Thesaurus of Geographic Names` `GADM`

locationRemarks
Identifier	http://rs.tdwg.org/dwc/terms/locationRemarks
Definition	Comments or notes about the dcterms:Location.
Notes
Examples	`under water since 2005`

preferredSpatialRepresentation
Identifier	http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
Definition	An indication of which spatial representation best represents the dcterms:Location.
Notes
Examples	`point-radius` `footprint`

decimalLatitude
Identifier	http://rs.tdwg.org/dwc/terms/decimalLatitude
Definition	A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
Examples	`-41.0983423`

decimalLongitude
Identifier	http://rs.tdwg.org/dwc/terms/decimalLongitude
Definition	A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
Examples	`-121.1761111`

geodeticDatum
Identifier	http://rs.tdwg.org/dwc/terms/geodeticDatum
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value.
Examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`

coordinateUncertaintyInMeters
Identifier	http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Definition	A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term.
Notes	Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Examples	`30` (reasonable lower limit on or after 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `100` (reasonable lower limit before 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `71` (uncertainty for a UTM coordinate having 100 meter precision and a known spatial reference system)

coordinatePrecision
Identifier	http://rs.tdwg.org/dwc/terms/coordinatePrecision
Definition	A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude.
Notes
Examples	`0.00001` (normal GPS limit for decimal degrees) `0.000278` (nearest second) `0.01667` (nearest minute) `1.0` (nearest degree)

pointRadiusSpatialFit
Identifier	http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Definition	A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples	`0` `1` `1.5708`

verbatimCoordinates
Identifier	http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Definition	Verbatim original spatial coordinates of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`41 05 54S 121 05 34W` `17T 630000 4833400`

verbatimLatitude
Identifier	http://rs.tdwg.org/dwc/terms/verbatimLatitude
Definition	A verbatim original latitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`41 05 54.03S`

verbatimLongitude
Identifier	http://rs.tdwg.org/dwc/terms/verbatimLongitude
Definition	A verbatim original longitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`121d 10' 34" W`

verbatimCoordinateSystem
Identifier	http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`decimal degrees` `degrees decimal minutes` `degrees minutes seconds` `UTM`

verbatimSRS
Identifier	http://rs.tdwg.org/dwc/terms/verbatimSRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`

footprintWKT
Identifier	http://rs.tdwg.org/dwc/terms/footprintWKT
Definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Notes	A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Examples	`POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))` (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21)

footprintSRS
Identifier	http://rs.tdwg.org/dwc/terms/footprintSRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EPSG:4326` `GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]]` (WKT for the standard WGS84 Spatial Reference System EPSG:4326) `not recorded`

footprintSpatialFit
Identifier	http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Definition	A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples	`0` `1` `1.5708`

georeferencedBy
Identifier	http://rs.tdwg.org/dwc/terms/georeferencedBy
Definition	A name for a dcterms:Agent responsible for providing a georeference.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Brad Millen (ROM)` `Kristina Yamamoto \| Janet Fang`

georeferencedDate
Identifier	http://rs.tdwg.org/dwc/terms/georeferencedDate
Definition	The date on which the dcterms:Location was georeferenced.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

georeferenceProtocol
Identifier	http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)`

georeferenceSources
Identifier	http://rs.tdwg.org/dwc/terms/georeferenceSources
Definition	A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`GeoLocate` `GeoPick` `https://www.geonames.org/` `USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth`

georeferenceRemarks
Identifier	http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Definition	Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
Notes
Examples	`Assumed distance by road (Hwy. 101)`

MaterialEntity

MaterialEntity Class
Identifier	http://rs.tdwg.org/dwc/terms/MaterialEntity
Definition	An entity that can be identified, exists for some period of time, and consists in whole or in part of physical matter while it exists.
Notes	The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`the entire contents of a trawl` `a subset of the contents of a trawl` `the body of a fish` `the stomach contents of a fish` `a rock containing fossils` `a fossil within a rock` `an herbarium sheet with its attached plant specimen` `a flower on a plant specimen` `a pollen grain` `a specific water sample` `an isolated molecule of DNA`

materialEntityID
Identifier	http://rs.tdwg.org/dwc/terms/materialEntityID
Definition	An identifier for a particular instance of a dwc:MaterialEntity.
Notes	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (the dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Examples	`06809dc5-f143-459a-be1a-6f03e63fc083`

digitalSpecimenID
Identifier	http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Definition	An identifier for a Digital Specimen resource.
Notes	A Digital Specimen is defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity.
Examples	`https://doi.org/10.3535/M42-Z4P-DRD` `https://doi.org/10.3535/M42-Z4P-DRD?urlappend=/1` `https://doi.org/10.3535/M42-Z4P-DRD?locatt=/1` `doi:10.3535/M42-Z4P-DRD`

isPartOfMaterialEntityID
Identifier	http://rs.tdwg.org/dwc/terms/isPartOfMaterialEntityID
Definition	An identifier for a dwc:MaterialEntity of which this dwc:MaterialEntity is a part.
Notes	A dwc:MaterialEntity was not taken from (derived from) a dwc:MaterialEntity of which it is a part. Recommended best practice is to use a globally unique identifier. The hierarchical relationship supported by this term allows for the atomization of individual parts of a dwc:MaterialEntity, such as a specimen composed of two minerals (Pyrite and Quartz), each with its own characteristics and potential dwc:Assertions.
Examples

materialRole
Identifier	http://rs.tdwg.org/dwc/terms/materialRole
Definition	A category that best matches the nature of the relationship between a dwc:MaterialEntity and another dwc:MaterialEntity of which it is a part.
Notes	Roles depend on both the part and the parent object. For instance, a rock (material category) within the parent specimen serves as a clast and depends on both the specimen part and the parent specimen for its existence. Recommended best practice is to use a controlled vocabulary such as IUGS CGI Compound Material Consituent Part, http://resource.geosciml.org/classifier/cgi/compoundmaterialconstituentpartrole. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`matrix` `groundmass` `phenocryst` `xenolith` `vein`

materialProportion
Identifier	http://rs.tdwg.org/dwc/terms/materialProportion
Definition	The qualitative or quantitative abundance of a dwc:MaterialEntity with respect to another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as http://resource.geosciml.org/classifier/cgi/proportionterm. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`20%` `minor` `dominant`

materialEntityCategory
Identifier	http://rs.tdwg.org/dwc/terms/materialEntityCategory
Definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`liveOrganism`, `deadOrganism`, `partOfOrganism`, `nonMolecularBiologicalExtract`, `molecularBiologicalExtract`, `mineral`, `rock`, `fossil`, `chemical`, `humanArtifactWithBiologicalConstituent`, `humanArtifactWithoutBiologicalConstituent`, and `mixed`

materialEntityType
Identifier	http://rs.tdwg.org/dwc/terms/materialEntityType
Definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialEntityCategory.
Notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Macro-object` `Micro-object` `Oversized object` `Cut/polished gemstone` `Compound Specimen` `Core` `Mixed Materials` `Environmental sample` `Microscope slide` `Spore print` `Macrofossil` `Mesofossil` `Microfossil` `Pinned object/specimen` `Taxidermy mount` `Blood sampling cards` `Oversized fossil` `Anthropogenic Artifact`

discipline
Identifier	http://rs.tdwg.org/dwc/terms/discipline
Definition	The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( `\|` ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Botany` `Botany \| Virology \| Taxonomy`

sampledFeatureType
Identifier	http://rs.tdwg.org/dwc/terms/sampledFeatureType
Definition	The type of naturally occurring or anthropogenic physical feature from which a dwc:MaterialEntity was sampled.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`float` `mine dump` `mine/quarry pit` `outcrop` `erratic boulder`

institutionID
Identifier	http://rs.tdwg.org/dwc/terms/institutionID
Definition	An identifier for an organization.
Notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://www.gbif.org/grscicoll/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`

collectionID
Identifier	http://rs.tdwg.org/dwc/terms/collectionID
Definition	An identifier for a collection.
Notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`

institutionCode
Identifier	http://rs.tdwg.org/dwc/terms/institutionCode
Definition	A name (or acronym) in use by an institution having custody of a resource.
Notes	The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
Examples	`MVZ` `FMNH` `CLO` `UCMP` `National Museum of Kenya` `Kew Gardens`

collectionCode
Identifier	http://rs.tdwg.org/dwc/terms/collectionCode
Definition	A name, acronym, coden, or initialism identifying a collection.
Notes
Examples	`Mammals` `Hildebrandt` `EBIRD` `VP`

ownerInstitutionCode
Identifier	http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Definition	A name (or acronym) in use by an institution having ownership of a resource.
Notes
Examples	`NPS` `APN` `InBio`

typeOfType
Identifier	http://rs.tdwg.org/dwc/terms/typeOfType
Definition	A category of nomenclatural type of a dwc:MaterialEntity.
Notes	The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype` `isotype`

typifiedName
Identifier	http://rs.tdwg.org/dwc/terms/typifiedName
Definition	A scientific name for which a specimen or other name is the type.
Notes	The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
Examples	`Polysiphonia amphibolis Womersley`

catalogNumber
Identifier	http://rs.tdwg.org/dwc/terms/catalogNumber
Definition	An identifier (preferably unique) for a resource within a collection.
Notes
Examples	`145732` `145732a` `2008.1334` `R-4313`

otherCatalogNumbers
Identifier	http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Definition	A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`FMNH:Mammal:1234` `NPS YELLO6778 \| MBG 33424`

objectQuantity
Identifier	http://rs.tdwg.org/dwc/terms/objectQuantity
Definition	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Notes	A dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)

objectQuantityType
Identifier	http://rs.tdwg.org/dwc/terms/objectQuantityType
Definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	A dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)

preparations
Identifier	http://rs.tdwg.org/dwc/terms/preparations
Definition	A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`fossil` `cast` `photograph` `DNA extract` `skin \| skull \| skeleton` `whole animal (EtOH) \| tissue (EDTA)`

disposition
Identifier	http://rs.tdwg.org/dwc/terms/disposition
Definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`in collection` `missing` `on loan` `used up` `destroyed` `deaccessioned`

measuredMassInGrams
Identifier	http://rs.tdwg.org/dwc/terms/measuredMassInGrams
Definition	Mass of a dwc:MaterialEntity, measured in grams.
Notes
Examples	`0.03` `2.34` `56.6`

verbatimMass
Identifier	http://rs.tdwg.org/dwc/terms/verbatimMass
Definition	The verbatim original representation of the mass of a dwc:MaterialEntity, including original units of measurement.
Notes
Examples	`11.01 Lbs` `105.07 g` `2.45 kg`

verbatimLabel
Identifier	http://rs.tdwg.org/dwc/terms/verbatimLabel
Definition	A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
Notes	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
Examples

associatedSequences
Identifier	http://rs.tdwg.org/dwc/terms/associatedSequences
Definition	A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity.
Notes
Examples	`http://www.ncbi.nlm.nih.gov/nuccore/U34853.1` `http://www.ncbi.nlm.nih.gov/nuccore/GU328060 \| http://www.ncbi.nlm.nih.gov/nuccore/AF326093`

treatments
Identifier	http://rs.tdwg.org/dwc/terms/treatments
Definition	Description of any processes or curatorial actions taken specifically to mitigate damage to a dwc:MaterialEntity.
Notes	Includes both proactive and reactive actions.
Examples

handlingRequirements
Identifier	http://rs.tdwg.org/dwc/terms/handlingRequirements
Definition	A description of the procedures required to preserve and protect a dwc:MaterialEntity during handling.
Notes
Examples	`handle with gloves` `not to be taken out of storage medium` `avoid contact with direct sunlight`

hazardType
Identifier	http://rs.tdwg.org/dwc/terms/hazardType
Definition	A term that belongs to a hazard classification scheme based on a set of unique characteristics and negative health outcomes.
Notes	Recommended best practice is to use a controlled vocabulary such as https://kos.geospecimens.org/vocab/hazard-type. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`carcinogen` `skin irritant` `radioactive` `toxic`

hazardRemarks
Identifier	http://rs.tdwg.org/dwc/terms/hazardRemarks
Definition	Comments or notes about the type of hazards associated with a dwc:MaterialEntity.
Notes
Examples	`asbestos` `slightly radioactive` `requires skin protection`

damageRemarks
Identifier	http://rs.tdwg.org/dwc/terms/damageRemarks
Definition	A general description of any physical changes to a dwc:MaterialEntity that have negatively affected its value.
Notes	See Royce, K., Baars, C., & Viles, H. (2021). Defining Damage and Susceptibility, with Implications for Mineral Specimens and Objects: Introducing the Mineral Susceptibility Database. Studies in Conservation, 68(3), 298-317. https://doi.org/10.1080/00393630.2021.2015947
Examples	`Due to oxidation and hydration of the pyrite in the coal, the sample has largely decayed to a coal powder with some larger coal pieces \| Some terminations broken off \| Attached label not legible (or torn, or covered)`

materialDescription
Identifier	http://rs.tdwg.org/dwc/terms/materialDescription
Definition	Remarks on the physical characteristics of a dwc:MaterialEntity, particularly those that distinguish it from otherwise similar dwc:MaterialEntities.
Notes
Examples	`Showpiece` `Historically valuable` `Extraordinary composition` `Two generations of quartz`

materialEntityRemarks
Identifier	http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Definition	Comments or notes about a dwc:MaterialEntity.
Notes
Examples	`found in association with charred remains` `some original fragments missing`

Occurrence

Occurrence Class
Identifier	http://rs.tdwg.org/dwc/terms/Occurrence
Definition	A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
Notes	In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`a wolf pack on the shore of Kluane Lake in 1988` `a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23` `a fungus in Central Park in the summer of 1929` `a male lance-tailed manakin in a courtship display on Isla Boca Brava`

occurrenceID
Identifier	http://rs.tdwg.org/dwc/terms/occurrenceID
Definition	An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
Notes	In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Examples	`https://arctos.database.museum/guid/MSB:Mamm:231731?seid=966527` `3854b337a-da0b-483f-a1c7-107403bdbb40` `http://n2t.net/ark:/65665/3854b337a-da0b-483f-a1c7-107403bdbb40`

recordedBy
Identifier	http://rs.tdwg.org/dwc/terms/recordedBy
Definition	A name for a dcterms:Agent responsible for recording a dwc:Event.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `Megatherium Club` `The Natural History Society of Northumbria` `ROV SuBastian`

recordedByID
Identifier	http://rs.tdwg.org/dwc/terms/recordedByID
Definition	An identifier for a dcterms:Agent responsible for recording a dwc:Event.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)

recordNumber
Identifier	http://rs.tdwg.org/dwc/terms/recordNumber
Definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:MaterialEntity record, such as a specimen collector's number.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`OPP 7101`

individualCount
Identifier	http://rs.tdwg.org/dwc/terms/individualCount
Definition	The number of individuals present at the time of the dwc:Occurrence.
Notes
Examples	`0` `1` `25`

organismQuantity
Identifier	http://rs.tdwg.org/dwc/terms/organismQuantity
Definition	A number or enumeration value for the quantity of dwc:Organisms.
Notes	A dwc:organismQuantity must have a corresponding dwc:organismQuantityType.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)

organismQuantityType
Identifier	http://rs.tdwg.org/dwc/terms/organismQuantityType
Definition	The type of quantification system used for the quantity of dwc:Organisms.
Notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)

sex
Identifier	http://rs.tdwg.org/dwc/terms/sex
Definition	A sex of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`female` `male` `hermaphrodite`

lifeStage
Identifier	http://rs.tdwg.org/dwc/terms/lifeStage
Definition	An age class or life stage of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`zygote` `larva` `juvenile` `adult` `seedling` `flowering` `fruiting`

reproductiveCondition
Identifier	http://rs.tdwg.org/dwc/terms/reproductiveCondition
Definition	A reproductive condition of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`non-reproductive` `pregnant` `in bloom` `fruit-bearing`

caste
Identifier	http://rs.tdwg.org/dwc/terms/caste
Definition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`queen` `male alate` `intercaste` `minor worker` `soldier` `ergatoid`

behavior
Identifier	http://rs.tdwg.org/dwc/terms/behavior
Definition	A behavior shown by a dwc:Organism.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`roosting` `foraging` `running`

vitality
Identifier	http://rs.tdwg.org/dwc/terms/vitality
Definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`alive` `dead` `mixedLot` `uncertain` `notAssessed`

establishmentMeans
Identifier	http://rs.tdwg.org/dwc/terms/establishmentMeans
Definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `nativeEndemic` `nativeReintroduced` `introduced` `introducedAssistedColonisation` `vagrant` `uncertain`

degreeOfEstablishment
Identifier	http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `captive` `cultivated` `released` `failing` `casual` `reproducing` `established` `colonising` `invasive` `widespreadInvasive`

pathway
Identifier	http://rs.tdwg.org/dwc/terms/pathway
Definition	The process by which a dwc:Organism came to be in a given place at a given time.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`releasedForUse` `otherEscape` `transportContaminant` `transportStowaway` `corridor` `unaided`

substrate
Identifier	http://rs.tdwg.org/dwc/terms/substrate
Definition	A type of biotic or abiotic material to which a dwc:Organism was attached during a dwc:Occurrence.
Notes	No inference can be made from this term that a dwc:Organism interacted in any other way than being connected to some (not a particular) material resource of the substrate type (such as during parasitization or decomposition). A host-parasite relationship is better expressed as a dwc:OrganismInteraction. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`stone` `wall` `decaying wood` `wooden board fence` `animal bones`

georeferenceVerificationStatus
Identifier	http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`unable to georeference` `requires georeference` `requires verification` `verified by data custodian` `verified by contributor`

occurrenceStatus
Identifier	http://rs.tdwg.org/dwc/terms/occurrenceStatus
Definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`detected` `notDetected`

associatedMedia
Identifier	http://rs.tdwg.org/dwc/terms/associatedMedia
Definition	A list (concatenated and separated) of associated ac:Media resources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`https://arctos.database.museum/media/10520962 \| https://arctos.database.museum/media/10520964` `https://inaturalist-open-data.s3.amazonaws.com/photos/606894376/original.jpg`

associatedOccurrences
Identifier	http://rs.tdwg.org/dwc/terms/associatedOccurrences
Definition	A list (concatenated and separated) of identifiers of other dwc:Occurrence records and their associations to this dwc:Occurrence.
Notes	This term can be used to provide a list of associations to other dwc:Occurrences. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"parasite collected from":"https://arctos.database.museum/guid/MSB:Mamm:215895?seid=950760"` `"encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3175067" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177393" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177394" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177392" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3609139"`

associatedReferences
Identifier	http://rs.tdwg.org/dwc/terms/associatedReferences
Definition	A list (concatenated and separated) of associated dcterms:BibliographicResources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). Note that the intended usage of the term dcterms:references in Darwin Core is to point to the definitive source representation of the resource, if one is available. Note also that the intended usage of dcterms:bibliographicCitation in Darwin Core is to provide the preferred way to cite the resource itself.
Examples	`Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.` `https://doi.org/10.3897/BDJ.14.e177525`

associatedTaxa
Identifier	http://rs.tdwg.org/dwc/terms/associatedTaxa
Definition	A list (concatenated and separated) of identifiers or names of dwc:Taxon records and the associations of this dwc:Occurrence to each of them.
Notes	This term can be used to provide a list of associations to dwc:Taxon records other than the one defined in the dwc:Occurrence. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. This term is not apt for establishing relationships between dwc:Taxon records, only between specific dwc:Occurrences of a dwc:Organism with other dwc:Taxon records. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"host":"Quercus alba"` `"host":"gbif.org/species/2879737"` `"parasitoid of":"Cyclocephala signaticollis" \| "predator of":"Apis mellifera"`

occurrenceRemarks
Identifier	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Definition	Comments or notes about the dwc:Occurrence.
Notes
Examples	`found dead on road`

Organism

organismID organismScope organismName causeOfDeath organismPart associatedOrganisms previousIdentifications organismRemarks

Organism Class
Identifier	http://rs.tdwg.org/dwc/terms/Organism
Definition	A particular organism or defined group of organisms considered to be taxonomically homogeneous.
Notes	Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`a specific bird` `a specific wolf pack` `a specific instance of a bacterial culture` `a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection`

organismID
Identifier	http://rs.tdwg.org/dwc/terms/organismID
Definition	An identifier for the dwc:Organism instance (as opposed to a particular digital record of the dwc:Organism). May be a globally unique identifier or an identifier specific to the data set.
Notes
Examples	`http://arctos.database.museum/guid/WNMU:Mamm:1249`

organismScope
Identifier	http://rs.tdwg.org/dwc/terms/organismScope
Definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`multicellular organism` `virus` `clone` `pack` `colony`

organismName
Identifier	http://rs.tdwg.org/dwc/terms/organismName
Definition	A textual name or label assigned to a dwc:Organism instance.
Notes
Examples	`Huberta` `Boab Prison Tree` `J pod`

causeOfDeath
Identifier	http://rs.tdwg.org/dwc/terms/causeOfDeath
Definition	An indication of the known or suspected cause of death of a dwc:Organism.
Notes	The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events).
Examples	`trap` `poison` `starvation` `drowning` `shooting` `old age` `vehicle collision` `disease` `herbicide` `burning` `infanticide`

organismPart
Identifier	http://rs.tdwg.org/dwc/terms/organismPart
Definition	An anatomical part of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary such as the controlled vocabulary for ac:subjectPart (http://rs.tdwg.org/ac/doc/part/). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`leaf` `stomach` `stamen` `leg`

associatedOrganisms
Identifier	http://rs.tdwg.org/dwc/terms/associatedOrganisms
Definition	A list (concatenated and separated) of identifiers of other dwc:Organisms and the associations of this dwc:Organism to each of them.
Notes	This term can be used to provide a list of associations to other dwc:Organisms. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"sibling of":"http://arctos.database.museum/guid/DMNS:Mamm:14171"` `"parent of":"http://arctos.database.museum/guid/MSB:Mamm:196208" \| "parent of":"http://arctos.database.museum/guid/MSB:Mamm:196523" \| "sibling of":"http://arctos.database.museum/guid/MSB:Mamm:142638"`

previousIdentifications
Identifier	http://rs.tdwg.org/dwc/terms/previousIdentifications
Definition	A list (concatenated and separated) of previous assignments of names to the dwc:Organism.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Chalepidae` `Pinus abies` `Anthus sp., field ID by G. Iglesias \| Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology`

organismRemarks
Identifier	http://rs.tdwg.org/dwc/terms/organismRemarks
Definition	Comments or notes about the dwc:Organism instance.
Notes
Examples	`One of a litter of six`

OrganismInteraction

organismInteractionID organismInteractionDescription organismInteractionType

OrganismInteraction Class
Identifier	http://rs.tdwg.org/dwc/terms/OrganismInteraction
Definition	An interaction between two dwc:Organisms during a dwc:Event.
Notes	Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
Examples	`a bee visiting a flower` `a Mallophora ruficauda hunting an Apis mellifera in flight` `a viral infection in a plant` `a female spider mating with a male spider` `a lion cub nursing from its mother` `a mosquito sucking blood from a chimpanzee's arm` `a slug eating a fungus growing on decomposing stump (2 interactions)`

organismInteractionID
Identifier	http://rs.tdwg.org/dwc/terms/organismInteractionID
Definition	An identifier for a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

organismInteractionDescription
Identifier	http://rs.tdwg.org/dwc/terms/organismInteractionDescription
Definition	A verbatim description of a dwc:OrganismInteraction.
Notes
Examples	`Mallophora ruficauda captured an Apis mellifera worker in flight.`

organismInteractionType
Identifier	http://rs.tdwg.org/dwc/terms/organismInteractionType
Definition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`visitedFlowerOf` `parasitized` `matedWith` `wasAttachedTo`

MeasurementOrFact

measurementID parentMeasurementID measurementType verbatimMeasurementType measurementValue measurementAccuracy measurementUnit measurementDeterminedBy measurementDeterminedDate measurementMethod measurementRemarks

MeasurementOrFact Class
Identifier	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Definition	A measurement of or fact about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`

measurementID
Identifier	http://rs.tdwg.org/dwc/terms/measurementID
Definition	An identifier for the dwc:MeasurementOrFact (information pertaining to measurements, facts, characteristics, or assertions). May be a global unique identifier or an identifier specific to the data set.
Notes
Examples	`9c752d22-b09a-11e8-96f8-529269fb1459`

parentMeasurementID
Identifier	http://rs.tdwg.org/dwc/terms/parentMeasurementID
Definition	An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts.
Notes	May be a globally unique identifier or an identifier specific to the data set.
Examples	`9c752d22-b09a-11e8-96f8-529269fb1459` `E1_E1_O1_M1`

measurementType
Identifier	http://rs.tdwg.org/dwc/terms/measurementType
Definition	The nature of the measurement, fact, characteristic, or assertion.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tail length` `temperature` `trap line length` `survey area` `trap type`

verbatimMeasurementType
Identifier	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Definition	A string representing the type of measurement or fact as it appeared in the original record.
Notes	This term is meant to allow the capture of an unaltered original name for a measurement or fact type. This term is meant to be used in addition to dwc:measurementType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`

measurementValue
Identifier	http://rs.tdwg.org/dwc/terms/measurementValue
Definition	The value of the measurement, fact, characteristic, or assertion.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`45` `20` `1` `14.5` `UV-light`

measurementAccuracy
Identifier	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definition	The description of the potential error associated with the dwc:measurementValue.
Notes
Examples	`0.01` `normal distribution with variation of 2 m`

measurementUnit
Identifier	http://rs.tdwg.org/dwc/terms/measurementUnit
Definition	The units associated with the dwc:measurementValue.
Notes	Recommended best practice is to use the International System of Units (SI). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`m` `g` `l` `°C` `mm` `km²` `%` `hh:mm:ss`

measurementDeterminedBy
Identifier	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Definition	A list (concatenated and separated) of names of people, groups, or organizations who determined the value of the dwc:MeasurementOrFact.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey`

measurementDeterminedDate
Identifier	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definition	The date on which the dwc:MeasurementOrFact was made.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

measurementMethod
Identifier	http://rs.tdwg.org/dwc/terms/measurementMethod
Definition	A description of or reference to (publication, URI) the method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minimum convex polygon around burrow entrances` (for a home range area) `barometric altimeter` (for an elevation)

measurementRemarks
Identifier	http://rs.tdwg.org/dwc/terms/measurementRemarks
Definition	Comments or notes accompanying the dwc:MeasurementOrFact.
Notes
Examples	`tip of tail missing`

Media

Media Class
Identifier	http://rs.tdwg.org/ac/terms/Media
Definition	A digital or physical media resource.
Notes	An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
Examples	`dcmi:Sound` `dcmi:StillImage` `dcmi:MovingImage` `dcmi:InteractiveResource` `ac:Digital3DResource`

MolecularProtocol

molecularProtocolID assayType

MolecularProtocol Class
Identifier	http://rs.tdwg.org/dwc/terms/MolecularProtocol
Definition	A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
Notes
Examples	`a standard DNA barcoding workflow using Sanger sequencing` `a shotgun metagenomics pipeline for microbial community profiling` `a high-throughput amplicon sequencing protocol targeting 16S rRNA`

molecularProtocolID
Identifier	http://rs.tdwg.org/dwc/terms/molecularProtocolID
Definition	An identifier for a dwc:MolecularProtocol.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

assayType
Identifier	http://rs.tdwg.org/dwc/terms/assayType
Definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`targeted` `metabarcoding` `other`

NucleotideAnalysis

readCount processedTotalReadCount rawTotalReadCount

NucleotideAnalysis Class
Identifier	http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
Definition	A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
Notes
Examples

readCount
Identifier	http://rs.tdwg.org/dwc/terms/readCount
Definition	The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Notes
Examples	`325` `73591` `8302`

processedTotalReadCount
Identifier	http://rs.tdwg.org/dwc/terms/processedTotalReadCount
Definition	The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Notes
Examples	`50638` `345987` `764032`

rawTotalReadCount
Identifier	http://rs.tdwg.org/dwc/terms/rawTotalReadCount
Definition	A total number of raw, unprocessed reads from a dwc:NucleotideAnalysis.
Notes
Examples	`70463` `150456` `586031`

NucleotideSequence

sequence nucleotideSequenceRemarks

NucleotideSequence Class
Identifier	http://rs.tdwg.org/dwc/terms/NucleotideSequence
Definition	A digital representation of a nucleotide sequence.
Notes
Examples

sequence
Identifier	http://rs.tdwg.org/dwc/terms/sequence
Definition	A string representing nucleotide base pairs.
Notes	Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
Examples	`TCTATCCTCAATTATAGGTCATAATTCACCATCAG`

nucleotideSequenceRemarks
Identifier	http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
Definition	Comments or notes about a dwc:NucleotideSequence.
Notes
Examples

Protocol

protocolID protocolType protocolDescription protocolReferences protocolRemarks

Protocol Class
Identifier	http://rs.tdwg.org/dwc/terms/Protocol
Definition	A method used during an action.
Notes
Examples	`a pitfall trap method for sampling ground-dwelling arthropods` `a point-radius georeferencing method` `a linear regression model to estimate body mass from skeletal measurements` `a Bayesian phylogenetic inference method`

protocolID
Identifier	http://rs.tdwg.org/dwc/terms/protocolID
Definition	An identifier for a dwc:Protocol.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

protocolType
Identifier	http://rs.tdwg.org/dwc/terms/protocolType
Definition	A category that best matches the nature of a dwc:Protocol.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`measurement` `georeference` `chronometricAge` `chronometricAgeConversion` `samplingEffort`

protocolDescription
Identifier	http://rs.tdwg.org/dwc/terms/protocolDescription
Definition	A detailed description of a dwc:Protocol.
Notes
Examples	`Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.`

protocolReferences
Identifier	http://rs.tdwg.org/dwc/terms/protocolReferences
Definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
Examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`

protocolRemarks
Identifier	http://rs.tdwg.org/dwc/terms/protocolRemarks
Definition	Comments or notes about a dwc:Protocol.
Notes
Examples

Provenance

provenanceID projectTitle projectID datasetName datasetID fundingAttribution fundingAttributionID references

Provenance Class
Identifier	http://rs.tdwg.org/dwc/terms/Provenance
Definition	Information about an entity’s origins.
Notes	This is a convenience class to group related properties.
Examples

provenanceID
Identifier	http://rs.tdwg.org/dwc/terms/provenanceID
Definition	An identifier for a dwc:Provenance.
Notes
Examples

projectTitle
Identifier	http://rs.tdwg.org/dwc/terms/projectTitle
Definition	A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
Notes	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Arctic Deep` `Scalidophora i Noreg` `The Nansen Legacy` `Underwater Oases of the Mar del Plata Canyon: Talud Continental IV`

projectID
Identifier	http://rs.tdwg.org/dwc/terms/projectID
Definition	A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
Notes	A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://arvenetternansen.com/` `https://doi.org/10.26259/3b15eca7` `https://doi.org/10.3030/101180559` `OC202405` `RCN276730` `RCN276730 \| Artsproject_7-24`

datasetName
Identifier	http://rs.tdwg.org/dwc/terms/datasetName
Definition	A name of a source dataset.
Notes
Examples	`Grinnell Resurvey Mammals` `Lacey Ctenomys Recaptures`

datasetID
Identifier	http://rs.tdwg.org/dwc/terms/datasetID
Definition	An identifier for the set of data. May be a global unique identifier or an identifier specific to a collection or institution.
Notes
Examples	`b15d4952-7d20-46f1-8a3e-556a512b04c5`

fundingAttribution
Identifier	http://rs.tdwg.org/ac/terms/fundingAttribution
Definition	Text description of organizations or individuals who funded the creation of the resource.
Notes	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Artsdatabanken` `National Science Foundation` `Norges forskningsråd` `Ocean Census \| Nippon Foundation`

fundingAttributionID
Identifier	http://rs.tdwg.org/dwc/terms/fundingAttributionID
Definition	An identifier for a dcterms:Agent that financially supported a project.
Notes	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`

references
Identifier	http://purl.org/dc/terms/references
Definition	A related resource that is referenced, cited, or otherwise pointed to by the described resource.
Notes	From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
Examples	`http://arctos.database.museum/guid/MVZ:Mamm:165861` (MaterialEntity example) `https://www.catalogueoflife.org/data/taxon/32664 (Taxon example)`

ResourceRelationship

resourceRelationshipID resourceID relationshipOfResourceID relatedResourceID relationshipOfResource relationshipAccordingTo relationshipEstablishedDate relationshipRemarks

ResourceRelationship Class
Identifier	http://rs.tdwg.org/dwc/terms/ResourceRelationship
Definition	A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another.
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`an instance of a dwc:Organism is the mother of another instance of a dwc:Organism` `a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence` `a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity`

resourceRelationshipID
Identifier	http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Definition	An identifier for a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

resourceID
Identifier	http://rs.tdwg.org/dwc/terms/resourceID
Definition	An identifier for the subject of a dwc:ResourceRelationship.
Notes
Examples	`f809b9e0-b09b-11e8-96f8-529269fb1459`

relationshipOfResourceID
Identifier	http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
Definition	An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID.
Notes	Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology.
Examples	`http://purl.obolibrary.org/obo/RO_0002456` (for the relation `pollinated by`) `http://purl.obolibrary.org/obo/RO_0002455` (for the relation `pollinates`) `https://www.inaturalist.org/observation_fields/879` (for the relation `eaten by`)

relatedResourceID
Identifier	http://rs.tdwg.org/dwc/terms/relatedResourceID
Definition	An identifier for the related resource (the object) of a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`dc609808-b09b-11e8-96f8-529269fb1459`

relationshipOfResource
Identifier	http://rs.tdwg.org/dwc/terms/relationshipOfResource
Definition	The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID).
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`same as` `duplicate of` `mother of` `offspring of` `sibling of` `parasite of` `host of` `valid synonym of` `located within` `pollinator of members of taxon` `pollinated specific plant` `pollinated by members of taxon` `on slab with`

relationshipAccordingTo
Identifier	http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Definition	The source (person, organization, publication, reference) establishing the relationship between the two resources.
Notes
Examples	`Julie Woodruff`

relationshipEstablishedDate
Identifier	http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Definition	A date-time or time interval during which a dwc:ResourceRelationship was established.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)

relationshipRemarks
Identifier	http://rs.tdwg.org/dwc/terms/relationshipRemarks
Definition	Comments or notes about a dwc:ResourceRelationship.
Notes
Examples	`mother and offspring collected from the same nest` `pollinator captured in the act`

Survey

surveyID surveySiteType siteCount siteNestingDescription verbatimSiteDescriptions verbatimSiteNames geospatialScopeAreaValue geospatialScopeAreaUnit totalAreaSampledValue totalAreaSampledUnit targetHabitatScope excludedHabitatScope targetTaxonomicScope excludedTaxonomicScope taxonCompletenessReported taxonCompletenessProtocols isTaxonomicScopeFullyReported isAbsenceReported absentTaxa hasNonTargetTaxa nonTargetTaxa areNonTargetTaxaFullyReported targetLifeStageScope excludedLifeStageScope isLifeStageScopeFullyReported targetDegreeOfEstablishmentScope excludedDegreeOfEstablishmentScope isDegreeOfEstablishmentScopeFullyReported targetGrowthFormScope excludedGrowthFormScope isGrowthFormScopeFullyReported hasNonTargetOrganisms verbatimTargetScope compilationTypes compilationSourceTypes inventoryTypes protocolNames protocolDescriptions protocolReferences isAbundanceReported isAbundanceCapReported isLeastSpecificTargetCategoryQuantityInclusive hasVouchers voucherInstitutions hasMaterialSamples materialSampleTypes samplingPerformedBy samplingPerformedByID isSamplingEffortReported samplingEffortValue samplingEffortUnit samplingEffortProtocol

Survey Class
Identifier	http://rs.tdwg.org/eco/terms/Survey
Definition	A dwc:Event intentionally designed to characterize a defined biotic target or domain in such a way that the resulting dwc:Occurrences can be interpreted collectively to support ecological and monitoring inference (such as detectability, abundance, species co-occurence, spatial distribution, or temporal trends), rather than merely documenting individual observations or gathered material.
Notes	Many terms from the Humboldt Extension for Ecological Inventories (eco: namespace) are organized in this class, particularly those that help describe and document the sampling process.
Examples	`a botanical survey of a protected area to assess native and invasive plant species` `a wetland vegetation mapping` `a camera trap deployment in a rainforest to monitor large mammals` `a frog call survey in wetlands across breeding seasons` `a coverboard survey for reptiles in forested environments` `a pollinator survey in an agricultural landscape` `a macroinvertebrate sampling in a freshwater stream to assess water quality` `a habitat- or ecosystem-level survey (e.g., coral reef health assessment, forest biodiversity assessment)` `an environmental impact assessment (e.g., pre-construction biological baseline survey for a wind farm project)`

surveyID
Identifier	http://rs.tdwg.org/eco/terms/surveyID
Definition	An identifier for an eco:Survey.
Notes	Recommended best practice is to use a globally unique identifier.
Examples

surveySiteType
Identifier	http://rs.tdwg.org/eco/terms/surveySiteType
Definition	A spatial category of a sampling location for an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`horizontalTransect` `verticalTransect` `arealPlot` `observationPoint`

siteCount
Identifier	http://rs.tdwg.org/eco/terms/siteCount
Definition	Total number of individual sites surveyed during an eco:Survey.
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`1` `15`

siteNestingDescription
Identifier	http://rs.tdwg.org/eco/terms/siteNestingDescription
Definition	Textual description of the hierarchical sampling design.
Notes	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`5 sampling sites of 3-5 plots each`

verbatimSiteDescriptions
Identifier	http://rs.tdwg.org/eco/terms/verbatimSiteDescriptions
Definition	Original textual description of the site(s).
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Wet flatwoods \| Wet depression surrounded by mesic longleaf pine flatwoods \| Ground cover of thick Andropogon spp., Sporobolus floridanus, Vaccinium spp, Rhynchospora spp., Centella erecta, Panicum rigidulum.`

verbatimSiteNames
Identifier	http://rs.tdwg.org/eco/terms/verbatimSiteNames
Definition	A list (concatenated and separated) of original site names.
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`East Coastal Fringe \| St. Marks Wildlife Management Area` `S1 \| S2 \| C1 \| C2 \| R14 \| R22 \| W1`

geospatialScopeAreaValue
Identifier	http://rs.tdwg.org/eco/terms/geospatialScopeAreaValue
Definition	The numeric value for the total area of the geospatial scope of an eco:Survey.
Notes	Geospatial scope refers to the place described by a dcterms:Location. This area is always greater than or equal to the eco:totalAreaSampledValue because it reflects the targeted location for which an inventory is intended and informs the sampling design. An eco:geospatialScopeAreaValue must have a corresponding eco:geospatialScopeAreaUnit.
Examples	`25`

geospatialScopeAreaUnit
Identifier	http://rs.tdwg.org/eco/terms/geospatialScopeAreaUnit
Definition	The units associated with eco:geospatialScopeAreaValue.
Notes	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`

totalAreaSampledValue
Identifier	http://rs.tdwg.org/eco/terms/totalAreaSampledValue
Definition	A numeric value for the total area, volume or distance surveyed during the eco:Survey.
Notes	This value is always less than or equal to the eco:geospatialScopeAreaValue because it reflects the portion of the geospatialScope that was actually sampled. An eco:totalAreaSampledValue must have a corresponding eco:totalAreaSampledUnit.
Examples	`0.8`

totalAreaSampledUnit
Identifier	http://rs.tdwg.org/eco/terms/totalAreaSampledUnit
Definition	The units associated with eco:totalAreaSampledValue
Notes	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`

targetHabitatScope
Identifier	http://rs.tdwg.org/eco/terms/targetHabitatScope
Definition	The habitats targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`dunes` `pineForest` `riparian` `scrub \| grassland`

excludedHabitatScope
Identifier	http://rs.tdwg.org/eco/terms/excludedHabitatScope
Definition	The habitats explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`wetFlatwoods` `swamp \| estuary`

targetTaxonomicScope
Identifier	http://rs.tdwg.org/eco/terms/targetTaxonomicScope
Definition	The taxonomic group(s) targeted for sampling during an eco:Survey.
Notes	An eco:Survey to which the eco:targetTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all taxonomic groups surveyed in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Aves` `Aves \| Mammalia` `Procellariformes`

excludedTaxonomicScope
Identifier	http://rs.tdwg.org/eco/terms/excludedTaxonomicScope
Definition	The taxonomic group(s) explicitly excluded from sampling during an eco:Survey.
Notes	An eco:Survey to which the eco:excludedTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the taxonomic groups explicitly excluded from the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Aves` `Quercus \| Acer`

taxonCompletenessReported
Identifier	http://rs.tdwg.org/eco/terms/taxonCompletenessReported
Definition	Statement about whether the taxonomic completeness of an eco:Survey was assessed.
Notes	This term is meant to alert users that the inventory was conducted in such a way that all of the target taxa (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) should have been detectable if they were present during an eco:Survey. This term can provide data users with a qualitative measure of how comprehensively an area has been surveyed, which assists in interpreting species populations, areas of occupancy, inferring species absences, etc. This term is only relevant if an eco:Survey used restricted search or open search methods. If taxonomic completeness was assessed, the methods used or an explanation of the basis of the completeness should be stated in eco:taxonCompletenessProtocols. Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/tcr/. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`notReported` `reportedComplete` `reportedIncomplete`

taxonCompletenessProtocols
Identifier	http://rs.tdwg.org/eco/terms/taxonCompletenessProtocols
Definition	A description of or reference (publication, URL) to the methods used to determine eco:taxonCompletenessReported.
Notes	This term allows users to determine how comprehensively an area has been sampled. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`census \| based on sampling effort` `based on species accumulation curves`

isTaxonomicScopeFullyReported
Identifier	http://rs.tdwg.org/eco/terms/isTaxonomicScopeFullyReported
Definition	Every dwc:Occurrence that was included within the taxonomic scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the taxonomic scope and detected during an eco:Survey were reported, the value should be 'true'. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

isAbsenceReported
Identifier	http://rs.tdwg.org/eco/terms/isAbsenceReported
Definition	Taxonomic absences were reported.
Notes	Absences can be reported at any taxonomic level. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

absentTaxa
Identifier	http://rs.tdwg.org/eco/terms/absentTaxa
Definition	A list (concatenated and separated) of taxa reported absent during an eco:Survey.
Notes	Absences can be reported at any taxonomic level. This term refers to the list of taxa within an eco:targetTaxonomicScope that were not detected in an eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`

hasNonTargetTaxa
Identifier	http://rs.tdwg.org/eco/terms/hasNonTargetTaxa
Definition	One or more dwc:Occurrences of taxa outside the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) were detected and reported for an eco:Survey.
Notes	This term is meant to alert users to the presence of non-target taxa (in some disciplines called “bycatch”) reported in an eco:Survey. This term is relevant only if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Examination of the taxonomic scope is needed in order to identify the non-target taxa. It should be possible to confirm the expectations by investigating the dwc:Occurrences in an eco:Survey and in its child eco:Surveys (if available) or by exploring eco:nonTargetTaxa for an eco:Survey (if populated). The value of this term should be 'true' if dwc:Occurrences of taxa outside the taxonomic scope as defined at the time of an eco:Survey are reported, otherwise the value of this term should be 'false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

nonTargetTaxa
Identifier	http://rs.tdwg.org/eco/terms/nonTargetTaxa
Definition	A list (concatenated and separated) of taxa reported during an eco:Survey that are outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope).
Notes	This term is meant to allow the full list of taxa that are considered outside of the taxonomic scope and yet were reported in an eco:Survey. This term is relevant only if a target taxonomic scope is declared and eco:hasNonTargetTaxa is ‘true’. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Non-target taxa (in some disciplines called “bycatch”) can be reported at any taxonomic level. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`

areNonTargetTaxaFullyReported
Identifier	http://rs.tdwg.org/eco/terms/areNonTargetTaxaFullyReported
Definition	Every dwc:Occurrence that was outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) and detected during an eco:Survey, and that was detectable using the given protocol (given in eco:protocolDescriptions and dwc:samplingProtocol), was reported.
Notes	This term is meant to inform a user of the data whether there were non-target taxa that were detected, but left unreported. This term is only relevant if an eco:Survey used restricted search or open search methods and if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Within eco:Surveys that used either a restricted search or an open search method and declared a taxonomic scope, if all dwc:Occurrences that are not included within the target taxonomic scope and that were detected during an eco:Survey were reported, the value of this term should be 'true', otherwise the value of this term should be ‘false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

targetLifeStageScope
Identifier	http://rs.tdwg.org/eco/terms/targetLifeStageScope
Definition	The age classes or life stages of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	This term is defined based on dwc:lifeStage. Recommended best practice is to use the same controlled vocabulary as for dwc:lifeStage and to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`larva` `adult \| juvenile`

excludedLifeStageScope
Identifier	http://rs.tdwg.org/eco/terms/excludedLifeStageScope
Definition	The age classes or life stages of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	This term is defined based on dwc:lifeStage (http://rs.tdwg.org/dwc/terms/lifeStage). Recommended best practice is to use the same controlled vocabulary as for dwc:lifeStage and to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`seedling` `nestling \| fledgling`

isLifeStageScopeFullyReported
Identifier	http://rs.tdwg.org/eco/terms/isLifeStageScopeFullyReported
Definition	Every dwc:Occurrence that was included within the life stage scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the life stage scope and detected during an eco:Survey were reported, the value should be 'true'. Life stage scope is based on the combination of eco:targetLifeStageScope and eco:excludedLifeStageScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

targetDegreeOfEstablishmentScope
Identifier	http://rs.tdwg.org/eco/terms/targetDegreeOfEstablishmentScope
Definition	The degrees of establishment of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary (http://rs.tdwg.org/dwcdoe/) for dwc:degreeOfEstablishment. For details, refer to https://doi.org/10.3897/biss.3.38084. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `invasive \| widespreadInvasive`

excludedDegreeOfEstablishmentScope
Identifier	http://rs.tdwg.org/eco/terms/excludedDegreeOfEstablishmentScope
Definition	The degrees of establishment of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary (http://rs.tdwg.org/dwcdoe/) for dwc:degreeOfEstablishment. For details, refer to https://doi.org/10.3897/biss.3.38084. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `invasive \| widespreadInvasive`

isDegreeOfEstablishmentScopeFullyReported
Identifier	http://rs.tdwg.org/eco/terms/isDegreeOfEstablishmentScopeFullyReported
Definition	Every dwc:Occurrence that was included within the degree of establishment scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the degree of establishment scope and detected during an eco:Survey were reported, the value should be 'true'. Degree of establishment scope is based on the combination of eco:targetDegreeOfEstablishmentScope and eco:excludedDegreeOfEstablishmentScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

targetGrowthFormScope
Identifier	http://rs.tdwg.org/eco/terms/targetGrowthFormScope
Definition	The growth forms or habits of the dwc:Organisms targeted for sampling during the eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tree` `shrub \| subShrub`

excludedGrowthFormScope
Identifier	http://rs.tdwg.org/eco/terms/excludedGrowthFormScope
Definition	The growth forms or habits of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tree` `shrub \| subShrub`

isGrowthFormScopeFullyReported
Identifier	http://rs.tdwg.org/eco/terms/isGrowthFormScopeFullyReported
Definition	Every dwc:Occurrence that was included within the growth form scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the growth form scope and detected during an eco:Survey were reported, the value should be 'true'. Growth form scope is based on the combination of eco:targetGrowthFormScope and eco:excludedGrowthFormScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

hasNonTargetOrganisms
Identifier	http://rs.tdwg.org/eco/terms/hasNonTargetOrganisms
Definition	One or more dwc:Occurrences outside the target organismal scopes (eco:targetDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:targetLifeStageScope) were detected and reported for an eco:Survey.
Notes	This term is meant to alert users to the presence of non-target organisms (in some disciplines called “bycatch”) reported in an eco:Survey. This term is relevant only if a target organismal scope is declared. Organismal scope is based on the combination of all of the following terms: eco:targetLifeStageScope, eco:excludedLifeStageScope, eco:targetDegreeOfEstablishmentScope, eco:excludedDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:excludedGrowthFormScope. Examination of the organismal scope is needed in order to identify the non-target dwc:Occurrences. It should be possible to confirm the expectations by investigating dwc:Occurrences in an eco:Survey and in its child eco:Surveys (if available). The value of this term should be 'true' if dwc:Occurrences outside the organismal scope(s) as defined at the time of an eco:Survey are reported, otherwise the value of this term should be 'false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

verbatimTargetScope
Identifier	http://rs.tdwg.org/eco/terms/verbatimTargetScope
Definition	The verbatim original description of an eco:Survey scope.
Notes	Recommended best practice is first to populate explicit scope terms to the fullest extent possible (e.g., eco:targetTaxonomicScope). It is not recommended to use this term in assessing absence or completeness.
Examples	`small mammals` `freshwater macroinvertebrates` `dead animals`, `ground-living insects`

compilationTypes
Identifier	http://rs.tdwg.org/eco/terms/compilationTypes
Definition	A statement specifying whether data reported are derived from sampling events, ancillary data compiled from other sources, or a combination of both.
Notes	This term is only relevant if an eco:Survey is an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`samplingEvents` `compilationOfExistingSourcesAndSamplingEvents` `compilationOfExistingSources` `compilationOfExistingSourcesAndSamplingEvents \| compilationOfExistingSources`

compilationSourceTypes
Identifier	http://rs.tdwg.org/eco/terms/compilationSourceTypes
Definition	The types of data sources contributing to the compilation reported.
Notes	This term is only relevant if an eco:Survey is a compilation in which one or more types of data sources were used. Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`museumSpecimens` `literature` `expertKnowledge \| localKnowledge`

inventoryTypes
Identifier	http://rs.tdwg.org/eco/terms/inventoryTypes
Definition	The types of search processes used to conduct an eco:Survey.
Notes	This term is only relevant if an eco:Survey represents an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`restrictedSearch` `openSearch` `compilation` `openSearch \| opportunisticSearch`

protocolNames
Identifier	http://rs.tdwg.org/eco/terms/protocolNames
Definition	Categorical descriptive names for the methods used during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`boxTrapping` `floraInventory` `boxTrapping \| funnelTrapping`

protocolDescriptions
Identifier	http://rs.tdwg.org/eco/terms/protocolDescriptions
Definition	A detailed description of the methods used during an eco:Survey.
Notes	This description should be associated with protocols provided in eco:protocolNames. The description may include deviations from a protocol referred to in eco:protocolReferences. Recommended good practice is to provide information about instruments used, calibration, etc. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Three conventional harp traps (3.2m ht x 2.2m w) were established in flight path zones for a period of 4 hrs at dawn and dusk for a total of 10 trap nights. Traps were visited on an hourly basis during each deployment period and the trap catch recorded for species, size, weight, sex, age and maternal status.`

protocolReferences
Identifier	http://rs.tdwg.org/eco/terms/protocolReferences
Definition	The references to the methods used during an eco:Survey.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`

isAbundanceReported
Identifier	http://rs.tdwg.org/eco/terms/isAbundanceReported
Definition	The number of dwc:Organisms collected or observed was reported.
Notes	Typically the abundance values would be reported in the dwc:organismQuantity and dwc:organismQuantityType terms for the child dwc:Occurrence records for an eco:Survey. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

isAbundanceCapReported
Identifier	http://rs.tdwg.org/eco/terms/isAbundanceCapReported
Definition	A maximum number of dwc:Organisms was reported, as specified or restricted by the protocol used.
Notes	Values of abundance cap should be captured under the term eco:abundanceCap. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

isLeastSpecificTargetCategoryQuantityInclusive
Identifier	http://rs.tdwg.org/eco/terms/isLeastSpecificTargetCategoryQuantityInclusive
Definition	The total detected quantity for a dwc:Taxon (including subcategories thereof) in an eco:Survey is given explicitly in a single record (dwc:organismQuantity value) for that dwc:Taxon.
Notes	This term is only relevant if dwc:organismQuantity is a number. For a detailed explanation, see http://rs.tdwg.org/dwc/doc/inclusive/. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

hasVouchers
Identifier	http://rs.tdwg.org/eco/terms/hasVouchers
Definition	One or more specimen vouchers were collected during an eco:Survey.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

voucherInstitutions
Identifier	http://rs.tdwg.org/eco/terms/voucherInstitutions
Definition	A list (concatenated and separated) of the names or acronyms of the institutions where vouchers collected during an eco:Survey were deposited.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`FMNH` `AMNH \| MVZ` `Nairobi National Museum`

hasMaterialSamples
Identifier	http://rs.tdwg.org/eco/terms/hasMaterialSamples
Definition	One or more dwc:MaterialEntities were collected during an eco:Survey.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

materialSampleTypes
Identifier	http://rs.tdwg.org/eco/terms/materialSampleTypes
Definition	A list (concatenated and separated) of material sample types collected during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`wholeOrganism` `skeleton` `tissue \| blood \| fecal \| stomachContent`

samplingPerformedBy
Identifier	http://rs.tdwg.org/eco/terms/samplingPerformedBy
Definition	A person, group, or organization responsible for recording an eco:Survey.
Notes	An eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`North American Butterfly Association` `KK Wall`

samplingPerformedByID
Identifier	http://rs.tdwg.org/eco/terms/samplingPerformedByID
Definition	An identifier for a dcterms:Agent responsible for sampling.
Notes	The sampling eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0003-0243-2379` `http://orcid.org/0000-0002-0786-4069 \| http://orcid.org/0000-0003-4639-823X`

isSamplingEffortReported
Identifier	http://rs.tdwg.org/eco/terms/isSamplingEffortReported
Definition	The sampling effort associated with an eco:Survey was reported.
Notes	Typically values of effort would be captured under the terms eco:samplingEffortValue and eco:samplingEffortUnit. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`

samplingEffortValue
Identifier	http://rs.tdwg.org/eco/terms/samplingEffortValue
Definition	The numeric value for the sampling effort expended during an eco:Survey.
Notes	This term is meant to capture the total sampling effort value. To express details of how the effort was determined use eco:samplingEffortProtocol. For compilations it is recommend not to infer effort. An eco:samplingEffortValue must have a corresponding eco:samplingEffortUnit.
Examples	`1900` `40` `5.5`

samplingEffortUnit
Identifier	http://rs.tdwg.org/eco/terms/samplingEffortUnit
Definition	The units associated with an eco:samplingEffortValue.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`trapHours` `personHours` `trapDays`

samplingEffortProtocol
Identifier	http://rs.tdwg.org/eco/terms/samplingEffortProtocol
Definition	A description of or reference (publication or URL) to the methods used to determine the sampling effort.
Notes	This description should be associated with the values reported in eco:samplingEffortValue and eco:samplingEffortUnit. This is a specialization of eco:protocolDescriptions focused on effort, distinct from the survey method. The effort relates to the intensity of sampling and therefore can assist in interpreting estimates of completeness. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`40 box traps deployed at even spacings along 4 parallel 100m transects placed 50m apart and visited at 6 hourly intervals over a 48 hour period` `2 people occupying a bird hide for a period of 8 hours and undertaking a 30 minute count of species within the 150 degree field of view every 2 hours` `A single baited camera trap station with motion sensor trigger, deployed for a period of 10 days and configured for detecting large fauna moving through a known traffic way`

SurveyTarget

surveyTargetID surveyTargetType surveyTargetValue surveyTargetUnit surveyTargetDescription isSurveyTargetFullyReported abundanceCap includeOrExclude surveyTargetRemarks

SurveyTarget Class
Identifier	http://rs.tdwg.org/eco/terms/SurveyTarget
Definition	One or more scopes that describe a target for dwc:Occurrences in an eco:Survey.
Notes
Examples	`all bird species` `all bird species except Larus gulls, fulmars and kittiwakes` `reproductive female Ctenomys sociabilis (only)` `Oncorhynchus mykiss and Oncorhynchus clarkii (only)`, `all total lengths except < 12 inches`

surveyTargetID
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetID
Definition	An identifier for an eco:SurveyTarget.
Notes	Recommended best practice is to use a globally unique identifier. Note: values of this term are not meant to be unique within an eco:SurveyTarget. A full eco:SurveyTarget is composed of all records that share the same eco:surveyTargetID.
Examples

surveyTargetType
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetType
Definition	A category that best matches the nature of a scope in an eco:SurveyTarget.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`taxon` `habitat` `establishmentMeans` `growthForm` `sex` `lifeStage` `minimum length`

surveyTargetValue
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetValue
Definition	A value to include or exclude in a scope categorized by eco:surveyTargetType.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`Aves` `oak savannah` `native` `tree` `female` `adult` `height` `weight`

surveyTargetUnit
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetUnit
Definition	Unit associated with a value in eco:surveyTargetValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`m` `g` `years`

surveyTargetDescription
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetDescription
Definition	A verbatim description of an eco:SurveyTarget.
Notes
Examples	`all passerine birds` `all flowering Rosaceae`

isSurveyTargetFullyReported
Identifier	http://rs.tdwg.org/eco/terms/isSurveyTargetFullyReported
Definition	Whether an eco:SurveyTarget can be used to infer absence of detection because all counts of detected dwc:Occurrences matching an eco:SurveyTarget were fully reported.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/. If True (the survey target is fully reported - nothing was left unreported), then this enables inference of absence of detection for everything in that eco:SurveyTarget that is included but that does not appear in the counts (absent counts signify absence of detection).
Examples	`true` `false`

abundanceCap
Identifier	http://rs.tdwg.org/eco/terms/abundanceCap
Definition	The reported maximum number of dwc:Occurrences matching an eco:SurveyTarget.
Notes
Examples	`300` `700`

includeOrExclude
Identifier	http://rs.tdwg.org/eco/terms/includeOrExclude
Definition	Whether to include or exclude eco:surveyTargetValue in a scope categorized by eco:surveyTargetType.
Notes	Combinations of eco:SurveyTarget records of inclusions and exclusions can define complex scopes such as all flying adult Aves except Passeriformes. Recommended best practice is to use a controlled vocabulary consisting of 'include' and 'exclude' only.
Examples	`include` `exclude`

surveyTargetRemarks
Identifier	http://rs.tdwg.org/eco/terms/surveyTargetRemarks
Definition	Comments or notes about an eco:SurveyTarget.
Notes
Examples	`Survey target scopes reflect post-facto filtering, not original survey design.`

Taxon

taxonID scientificNameID acceptedNameUsageID parentNameUsageID originalNameUsageID nameAccordingToID namePublishedInID taxonConceptID scientificName acceptedNameUsage parentNameUsage originalNameUsage nameAccordingTo namePublishedIn namePublishedInYear higherClassification classificationSystem kingdom phylum class order superfamily family subfamily tribe subtribe genus genericName subgenus infragenericEpithet specificEpithet infraspecificEpithet cultivarEpithet taxonRank verbatimTaxonRank scientificNameAuthorship vernacularName nomenclaturalCode taxonomicStatus nomenclaturalStatus taxonRemarks

Taxon Class
Identifier	http://rs.tdwg.org/dwc/terms/Taxon
Definition	A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026) considered by taxonomists to form a homogeneous unit.
Notes
Examples	`the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820`

taxonID
Identifier	http://rs.tdwg.org/dwc/terms/taxonID
Definition	An identifier for a dwc:Taxon.
Notes
Examples	`8fa58e08-08de-4ac1-b69c-1235340b7001` `32567` `https://www.gbif.org/species/212`

scientificNameID
Identifier	http://rs.tdwg.org/dwc/terms/scientificNameID
Definition	An identifier for the nomenclatural (not taxonomic) details of a scientific name.
Notes
Examples	`urn:lsid:ipni.org:names:37829-1:1.3`

acceptedNameUsageID
Identifier	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Definition	An identifier for the name usage (documented meaning of the name according to a source) of the currently valid (zoological) or accepted (botanical) taxon.
Notes	This term should be used for synonyms or misapplied names to refer to the dwc:taxonID of a dwc:Taxon record that represents the accepted (botanical) or valid (zoological) name. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)

parentNameUsageID
Identifier	http://rs.tdwg.org/dwc/terms/parentNameUsageID
Definition	An identifier for the name usage (documented meaning of the name according to a source) of the direct, most proximate higher-rank parent taxon (in a classification) of the most specific element of the dwc:scientificName.
Notes	This term should be used for accepted names to refer to the dwc:taxonID of a dwc:Taxon record that represents the next higher taxon rank in the same taxonomic classification. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41074` (ITIS) `urn:lsid:ipni.org:names:30001404-2` (IPNI) `2704173` (GBIF) `6T8N` (COL)

originalNameUsageID
Identifier	http://rs.tdwg.org/dwc/terms/originalNameUsageID
Definition	An identifier for the name usage (documented meaning of the name according to a source) in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	This term should be used to refer to the dwc:taxonID of a dwc:Taxon record that represents the usage of the terminal element of the dwc:scientificName as originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would establish the relationship between a record representing a subsequent combination and the record for its corresponding basionym. Unlike basionyms, however, this term can apply to scientific names at all ranks. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)

nameAccordingToID
Identifier	http://rs.tdwg.org/dwc/terms/nameAccordingToID
Definition	An identifier for the source in which the specific taxon concept circumscription is defined or implied. See dwc:nameAccordingTo.
Notes
Examples	`https://doi.org/10.1016/S0269-915X(97)80026-2`

namePublishedInID
Identifier	http://rs.tdwg.org/dwc/terms/namePublishedInID
Definition	An identifier for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedInID should be empty.
Examples

taxonConceptID
Identifier	http://rs.tdwg.org/dwc/terms/taxonConceptID
Definition	An identifier for the taxonomic concept to which the record refers - not for the nomenclatural details of a dwc:Taxon.
Notes
Examples	`8fa58e08-08de-4ac1-b69c-1235340b7001`

scientificName
Identifier	http://rs.tdwg.org/dwc/terms/scientificName
Definition	The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
Notes	This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign `×` (Unicode `U+00D7`, HTML `×`) to identify a hybrid, not `x` or `X`, if possible.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship) `×Agropogon littoralis (Sm.) C. E. Hubb.` `Mentha ×smithiana R. A. Graham` `Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.`

acceptedNameUsage
Identifier	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Definition	The full name, with authorship and date information if known, of the currently valid (zoological) or accepted (botanical) dwc:Taxon.
Notes	The full scientific name, with authorship and date information if known, of the accepted (botanical) or valid (zoological) name in cases where the provided dwc:scientificName is considered by the reference indicated in the dwc:nameAccordingTo property, or of the content provider, to be a synonym or misapplied name. When applied to a dwc:Organism or dwc:Occurrence, this term should be used in cases where a content provider regards the provided dwc:scientificName to be inconsistent with the taxonomic perspective of the content provider. For example, there are many discrepancies within specimen collections and observation datasets between the recorded name (e.g., the most recent identification from an expert who examined a specimen, or a field identification for an observed dwc:Organism), and the name asserted by the content provider to be taxonomically accepted.
Examples	`Tamias minimus` (valid name for `Eutamias minimus`)

parentNameUsage
Identifier	http://rs.tdwg.org/dwc/terms/parentNameUsage
Definition	The full name, with authorship and date information if known, of the direct, most proximate higher-rank parent dwc:Taxon (in a classification) of the most specific element of the dwc:scientificName.
Notes
Examples	`Rubiaceae` `Gruiformes` `Testudinae`

originalNameUsage
Identifier	http://rs.tdwg.org/dwc/terms/originalNameUsage
Definition	The taxon name, with authorship and date information if known, as it originally appeared when first established under the rules of the associated dwc:nomenclaturalCode. The basionym (botany) or basonym (bacteriology) of the dwc:scientificName or the senior/earlier homonym for replaced names.
Notes	The full scientific name, with authorship and date information if known, of the name usage in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would indicate the basionym of a record representing a subsequent combination. Unlike basionyms, however, this term can apply to scientific names at all ranks.
Examples	`Pinus abies` `Gasterosteus saltatrix Linnaeus 1768`

nameAccordingTo
Identifier	http://rs.tdwg.org/dwc/terms/nameAccordingTo
Definition	The reference to the source in which the specific taxon concept circumscription is defined or implied - traditionally signified by the Latin "sensu" or "sec." (from secundum, meaning "according to"). For taxa that result from identifications, a reference to the keys, monographs, experts and other sources should be given.
Notes	This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by `sensu` or `sec.`, it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
Examples	`Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236.` (as the full citation of the Franz & Cardona-Duque (2013) in Perelleschus splendida sec. Franz & Cardona-Duque (2013))

namePublishedIn
Identifier	http://rs.tdwg.org/dwc/terms/namePublishedIn
Definition	A reference for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedIn should be empty.
Examples	`Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886`

namePublishedInYear
Identifier	http://rs.tdwg.org/dwc/terms/namePublishedInYear
Definition	The four-digit year in which the dwc:scientificName was published.
Notes
Examples	`1915` `2008`

higherClassification
Identifier	http://rs.tdwg.org/dwc/terms/higherClassification
Definition	A list (concatenated and separated) of taxa names terminating at the rank immediately superior to the referenced dwc:Taxon.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from the highest taxonomic rank to the lowest.
Examples	`Plantae \| Tracheophyta \| Magnoliopsida \| Ranunculales \| Ranunculaceae \| Ranunculus` `Animalia` `Animalia \| Chordata \| Vertebrata \| Mammalia \| Theria \| Eutheria \| Rodentia \| Hystricognatha \| Hystricognathi \| Ctenomyidae \| Ctenomyini \| Ctenomys`

classificationSystem
Identifier	http://rs.tdwg.org/dwc/terms/classificationSystem
Definition	A reference to the classification system in which an authoritative name or formal classification belongs.
Notes	Recommended best practice is to provide a formal citation or IRI. This term should not be confused with dwc:namePublishedIn as a classification system is not equivalent to a publication in which a taxon is first described. This term should not be confused with dwc:nameAccordingTo as a classification system is not equivalent to a publication or other source in which a specific taxon concept circumscription is defined or implied. This term should not be confused with dwc:nomenclaturalCode as a classification system is not equivalent to code of nomenclature, which states the rules for naming rather than an organized source of names. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Strunz, H., Nickel, E.H. (2001): Strunz Mineralogical Tables. Chemical-Structural Mineral Classification System. 9th edition. E. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart, ix + 870 p. (ISBN 3-510-65188-X)` `Gaines, R.V., Skinner, H.C.W., Foord, E.E., Mason, B., Rosenzweig, A. (1997): Dana's New Mineralogy: The System of Mineralogy of James Dwight Dana and Edward Salisbury Dana. 8th edition. John Wiley & Sons, New York, xlv + 1819 p. (ISBN 0-471-19310-0).` `https://kos.geospecimens.org/vocab/meteorite-classification` `Mammal Diversity Database. (2026). Mammal Diversity Database (Version 2.5) [Data set]. [Zenodo](https://zenodo.org/records/10595931). https://doi.org/10.5281/zenodo.17033774` `Index Fungorum. (2026). Index Fungorum electronic database. Royal Botanic Gardens, Kew. Retrieved August 17, 2026, from indexfungorum.org.`

kingdom
Identifier	http://rs.tdwg.org/dwc/terms/kingdom
Definition	The full scientific name of the kingdom in which the dwc:Taxon is classified.
Notes
Examples	`Animalia` `Archaea` `Bacteria` `Chromista` `Fungi` `Plantae` `Protozoa` `Viruses`

phylum
Identifier	http://rs.tdwg.org/dwc/terms/phylum
Definition	The full scientific name of the phylum or division in which the dwc:Taxon is classified.
Notes
Examples	`Chordata` (phylum) `Bryophyta` (division)

class
Identifier	http://rs.tdwg.org/dwc/terms/class
Definition	The full scientific name of the class in which the dwc:Taxon is classified.
Notes
Examples	`Mammalia` `Hepaticopsida`

order
Identifier	http://rs.tdwg.org/dwc/terms/order
Definition	The full scientific name of the order in which the dwc:Taxon is classified.
Notes
Examples	`Carnivora` `Monocleales`

superfamily
Identifier	http://rs.tdwg.org/dwc/terms/superfamily
Definition	The full scientific name of the superfamily in which the dwc:Taxon is classified.
Notes	A taxonomic category subordinate to an order and superior to a family. According to ICZN article 29.2, the suffix `-oidea` is used for a superfamily name.
Examples	`Achatinoidea` `Cerithioidea` `Helicoidea` `Hypsibioidea` `Valvatoidea` `Zonitoidea`

family
Identifier	http://rs.tdwg.org/dwc/terms/family
Definition	The full scientific name of the family in which the dwc:Taxon is classified.
Notes
Examples	`Felidae` `Monocleaceae`

subfamily
Identifier	http://rs.tdwg.org/dwc/terms/subfamily
Definition	The full scientific name of the subfamily in which the dwc:Taxon is classified.
Notes
Examples	`Periptyctinae` `Orchidoideae` `Sphindociinae`

tribe
Identifier	http://rs.tdwg.org/dwc/terms/tribe
Definition	The full scientific name of the tribe in which the dwc:Taxon is classified.
Notes
Examples	`Ortaliini` `Arethuseae`

subtribe
Identifier	http://rs.tdwg.org/dwc/terms/subtribe
Definition	The full scientific name of the subtribe in which the dwc:Taxon is classified.
Notes
Examples	`Plotinini` `Typhaeini`

genus
Identifier	http://rs.tdwg.org/dwc/terms/genus
Definition	The full scientific name of the genus in which the dwc:Taxon is classified.
Notes
Examples	`Puma` `Monoclea`

genericName
Identifier	http://rs.tdwg.org/dwc/terms/genericName
Definition	The genus part of the dwc:scientificName without authorship.
Notes	For synonyms the accepted genus and the genus part of the name may be different. The term dwc:genericName should be used together with dwc:specificEpithet to form a binomial and with dwc:infraspecificEpithet to form a trinomial. The term dwc:genericName should only be used for combinations. Uninomials of generic rank do not have a dwc:genericName.
Examples	`Felis` (for scientificName `Felis concolor`, with accompanying values of `Puma concolor` in acceptedNameUsage and `Puma` in genus)

subgenus
Identifier	http://rs.tdwg.org/dwc/terms/subgenus
Definition	The full scientific name of the subgenus in which the dwc:Taxon is classified.
Notes	A value for this term should be a complete subgenus name as required by the appropriate nomenclatural code.
Examples	`Abacetus (Parastygis)` `Dicranum subgen. Orthodicranum`

infragenericEpithet
Identifier	http://rs.tdwg.org/dwc/terms/infragenericEpithet
Definition	The infrageneric part of a binomial name at ranks above species but below genus.
Notes	The term dwc:infragenericEpithet should be used in conjunction with dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank and dwc:scientificNameAuthorship to represent the individual elements of the complete dwc:scientificName. It can be used to indicate the subgenus placement of a species, which in zoology is often given in parentheses. Can also be used to share infrageneric names such as botanical sections (e.g., `Vicia sect. Cracca`).
Examples	`Abacetillus` (for scientificName `Abacetus (Abacetillus) ambiguus`) `Cracca` (for scientificName `Vicia sect. Cracca`)

specificEpithet
Identifier	http://rs.tdwg.org/dwc/terms/specificEpithet
Definition	The name of the first or species epithet of the dwc:scientificName.
Notes
Examples	`concolor` `gottschei`

infraspecificEpithet
Identifier	http://rs.tdwg.org/dwc/terms/infraspecificEpithet
Definition	The name of the lowest or terminal infraspecific of the dwc:scientificName.
Notes	In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string `Indigofera charlieriana subsp. sessilis var. scaberrima` is `scaberrima` and the dwc:scientificName is `Indigofera charlieriana var. scaberrima`. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
Examples	`concolor` (for scientificName `Puma concolor concolor`) `oxyadenia` (for scientificName `Quercus agrifolia var. oxyadenia`) `laxa` (for scientificName `Cheilanthes hirta f. laxa`) `scaberrima` (for scientificName `Indigofera charlieriana var. scaberrima`)

cultivarEpithet
Identifier	http://rs.tdwg.org/dwc/terms/cultivarEpithet
Definition	Part of the name of a cultivar, cultivar group or grex that follows the dwc:scientificName.
Notes	According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
Examples	`King Edward` (for scientificName `Solanum tuberosum 'King Edward'` and taxonRank `cultivar`) `Mishmiense` (for scientificName `Rhododendron boothii Mishmiense Group` and taxonRank `cultivar group`) `Atlantis` (for scientificName `Paphiopedilum Atlantis grex` and taxonRank `grex`)

taxonRank
Identifier	http://rs.tdwg.org/dwc/terms/taxonRank
Definition	The taxonomic rank of the most specific name in the dwc:scientificName.
Notes	Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
Examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`

verbatimTaxonRank
Identifier	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Definition	The taxonomic rank of the most specific name in the dwc:scientificName as it appears in the original record.
Notes
Examples	`Agamospecies` `sub-lesus` `prole` `apomict` `nothogrex` `sp.` `subsp.` `var.`

scientificNameAuthorship
Identifier	http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
Definition	The authorship information for the dwc:scientificName formatted according to the conventions of the applicable dwc:nomenclaturalCode.
Notes
Examples	`(Torr.) J.T. Howell` `(Martinovský) Tzvelev` `(Györfi, 1952)`

vernacularName
Identifier	http://rs.tdwg.org/dwc/terms/vernacularName
Definition	A common or vernacular name.
Notes
Examples	`cóndor andino` `death cap` `rainbow trout` `Gänsegeier` `smoky quartz`

nomenclaturalCode
Identifier	http://rs.tdwg.org/dwc/terms/nomenclaturalCode
Definition	The nomenclatural code (or codes in the case of an ambiregnal name) under which the dwc:scientificName is constructed.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`ICN` `ICZN` `BC` `ICNCP` `BioCode`

taxonomicStatus
Identifier	http://rs.tdwg.org/dwc/terms/taxonomicStatus
Definition	The status of the use of the dwc:scientificName as a label for a taxon. Requires taxonomic opinion to define the scope of a dwc:Taxon. Rules of priority then are used to define the taxonomic status of the nomenclature contained in that scope, combined with the experts opinion. It must be linked to a specific taxonomic reference that defines the concept.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`invalid` `misapplied` `homotypic synonym` `accepted`

nomenclaturalStatus
Identifier	http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
Definition	The status related to the original publication of the name and its conformance to the relevant rules of nomenclature. It is based essentially on an algorithm according to the business rules of the code. It requires no taxonomic opinion.
Notes
Examples	`nom. ambig.` `nom. illeg.` `nom. subnud.`

taxonRemarks
Identifier	http://rs.tdwg.org/dwc/terms/taxonRemarks
Definition	Comments or notes about the taxon or name.
Notes
Examples	`this name is a misspelling in common use`

UsagePolicy

usagePolicyID rightsHolder accessRights license

UsagePolicy Class
Identifier	http://rs.tdwg.org/dwc/terms/UsagePolicy
Definition	Information about rights, usage, and attribution statements applicable to an entity.
Notes	This is a convenience class to group related properties.
Examples

usagePolicyID
Identifier	http://rs.tdwg.org/dwc/terms/usagePolicyID
Definition	An identifier for a dwc:UsagePolicy.
Notes
Examples	`https://localcontextshub.org/projects/54be05d7-aa5c-4886-abd9-dc45b2fa8df4/`

rightsHolder
Identifier	http://purl.org/dc/terms/rightsHolder
Definition	A person or organization owning or managing rights over the resource.
Notes
Examples	`The Regents of the University of California`

accessRights
Identifier	http://purl.org/dc/terms/accessRights
Definition	Information about who can access the resource or an indication of its security status.
Notes	Access Rights may include information regarding access or restrictions based on privacy, security, or other policies.
Examples	`not-for-profit use only` (string literal example) `https://www.fieldmuseum.org/field-museum-natural-history-conditions-and-suggested-norms-use-collections-data-and-images` (URI example)

license
Identifier	http://purl.org/dc/terms/license
Definition	A legal document giving official permission to do something with the resource.
Notes
Examples	`http://creativecommons.org/publicdomain/zero/1.0/legalcode` `http://creativecommons.org/licenses/by/4.0/legalcode`

LivingSpecimen

LivingSpecimen Class
Identifier	http://rs.tdwg.org/dwc/terms/LivingSpecimen
Definition	A specimen that is alive.
Notes
Examples	`a living plant in a botanical garden` `a living animal in a zoo`

PreservedSpecimen

PreservedSpecimen Class
Identifier	http://rs.tdwg.org/dwc/terms/PreservedSpecimen
Definition	A specimen that has been preserved.
Notes
Examples	`a plant on an herbarium sheet` `a cataloged lot of fish in a jar`

FossilSpecimen

FossilSpecimen Class
Identifier	http://rs.tdwg.org/dwc/terms/FossilSpecimen
Definition	A preserved specimen that is a fossil.
Notes
Examples	`a body fossil` `a coprolite` `a gastrolith` `an ichnofossil` `a piece of a petrified tree`

MaterialCitation

MaterialCitation Class
Identifier	http://rs.tdwg.org/dwc/terms/MaterialCitation
Definition	A reference to or citation of one, a part of, or multiple specimens in scholarly publications.
Notes	This class constitutes a new value for the controlled vocabulary in the recommendations for basisOfRecord. When importing Darwin Core Archives of literature-based datasets to GBIF, the basisOfRecord should be changed from "Occurrence", "PreservedSpecimen" or "Literature" to "MaterialCitation".
Examples	`a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication` `a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication`

HumanObservation

HumanObservation Class
Identifier	http://rs.tdwg.org/dwc/terms/HumanObservation
Definition	An output of a human observation process.
Notes
Examples	`evidence of a dwc:Occurrence taken from field notes or literature` `a record of a dwc:Occurrence without physical evidence or evidence captured with a machine`

MachineObservation

absentTaxa

MachineObservation Class
Identifier	http://rs.tdwg.org/dwc/terms/MachineObservation
Definition	An output of a machine observation process.
Notes
Examples	`a photograph` `a video` `an audio recording` `a remote sensing image` `a dwc:Occurrence record based on telemetry`

absentTaxa
Identifier	http://rs.tdwg.org/eco/iri/absentTaxa
Definition	A taxon reported absent during an eco:Survey.
Notes	Absences can be reported at any taxonomic level. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

UseWithIRI

For more information on UseWithIRI, see Section 2.5 of the RDF Guide.

assayType assertionBy assertionType assertionUnit assertionValue behavior bibliographicIdentifierType caste chronometricAgeConversionProtocol chronometricAgeDeterminedBy chronometricAgeProtocol chronometricAgeUncertaintyMethod classificationSystem compilationSourceTypes compilationTypes dataGeneralizations degreeOfEstablishment discipline disposition earliestChronometricAgeReferenceSystem earliestGeochronologicalEra establishmentMeans eventCategory eventDurationUnit eventType excludedDegreeOfEstablishmentScope excludedGrowthFormScope excludedHabitatScope excludedLifeStageScope excludedTaxonomicScope fieldNotes fieldNumber footprintSRS footprintWKT fromLithostratigraphicUnit fundingAttribution geodeticDatum geologicEvent geologicProvince georeferencedBy georeferenceProtocol georeferenceSources georeferenceVerificationStatus geospatialScopeAreaUnit habitat hazardType identificationQualifier identificationType identificationVerificationStatus identifiedBy inCollection inDataset inDescribedPlace informationWithheld inventoryTypes language latestChronometricAgeReferenceSystem latestGeochronologicalEra lifeStage locationAccordingTo materialDated materialEntityCategory materialEntityType materialProportion materialRole materialSampleTypes measuredChemistrySource measurementDeterminedBy measurementMethod measurementType measurementUnit measurementValue mineralogicalAnalysisProtocol nonTargetTaxa objectQuantityType occurrenceStatus organismInteractionType organismPart organismQuantityType organismScope pathway preferredSpatialRepresentation preparations protocolNames protocolType recordedBy recordNumber reproductiveCondition sampledFeatureType sampledSubstrateCategory sampledSubstrateLayer sampleSizeUnit samplingEffortProtocol samplingEffortUnit samplingPerformedBy samplingProtocol sex siteNumber substrate surveySiteType surveyTargetType surveyTargetUnit surveyTargetValue targetDegreeOfEstablishmentScope targetGrowthFormScope targetHabitatScope targetLifeStageScope targetTaxonomicScope taxonCompletenessProtocols taxonCompletenessReported taxonFormula totalAreaSampledUnit toDigitalSpecimen toTaxon typeStatus verbatimCoordinateSystem verbatimSRS verticalDatum vitality

assayType
Identifier	http://rs.tdwg.org/dwc/iri/assayType
Definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

assertionBy
Identifier	http://rs.tdwg.org/dwc/iri/assertionBy
Definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

assertionType
Identifier	http://rs.tdwg.org/dwc/iri/assertionType
Definition	A category that best matches the nature of a dwc:Assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

assertionUnit
Identifier	http://rs.tdwg.org/dwc/iri/assertionUnit
Definition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://www.ontology-of-units-of-measure.org/resource/om-2/metre` `http://www.ontology-of-units-of-measure.org/resource/om-2/second-Time`

assertionValue
Identifier	http://rs.tdwg.org/dwc/iri/assertionValue
Definition	An asserted value.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`

behavior
Identifier	http://rs.tdwg.org/dwc/iri/behavior
Definition	A behavior shown by a dwc:Organism.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

bibliographicIdentifierType
Identifier	http://rs.tdwg.org/dwc/iri/bibliographicIdentifierType
Definition	A code that best matches the nature of an identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary of identifier issuers. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

caste
Identifier	http://rs.tdwg.org/dwc/iri/caste
Definition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

chronometricAgeConversionProtocol
Identifier	http://rs.tdwg.org/chrono/iri/chronometricAgeConversionProtocol
Definition	The method used to convert the chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

chronometricAgeDeterminedBy
Identifier	http://rs.tdwg.org/chrono/iri/chronometricAgeDeterminedBy
Definition	A person, group, or organization that determined the chrono:ChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

chronometricAgeProtocol
Identifier	http://rs.tdwg.org/chrono/iri/chronometricAgeProtocol
Definition	A method used to determine the chrono:ChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

chronometricAgeUncertaintyMethod
Identifier	http://rs.tdwg.org/chrono/iri/chronometricAgeUncertaintyMethod
Definition	The method used to generate the value of chrono:chronometricAgeUncertaintyInYears.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

classificationSystem
Identifier	http://rs.tdwg.org/dwc/iri/classificationSystem
Definition	A reference to the classification system in which an authoritative name or formal classification belongs.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

compilationSourceTypes
Identifier	http://rs.tdwg.org/eco/iri/compilationSourceTypes
Definition	The type of data source contributing to the compilation reported.
Notes	This term is only relevant if the eco:Survey is a compilation in which one or more types of data sources were used. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

compilationTypes
Identifier	http://rs.tdwg.org/eco/iri/compilationTypes
Definition	A statement specifying whether data reported are derived from sampling events, ancillary data compiled from other sources, or a combination of both.
Notes	This term is only relevant if the eco:Survey is an inventory. Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

dataGeneralizations
Identifier	http://rs.tdwg.org/dwc/iri/dataGeneralizations
Definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

degreeOfEstablishment
Identifier	http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
Definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcdoe/values/d003` `http://rs.tdwg.org/dwcdoe/values/d005`

discipline
Identifier	http://rs.tdwg.org/dwc/iri/discipline
Definition	The primary branch or branches of knowledge represented by the record.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
Examples

disposition
Identifier	http://rs.tdwg.org/dwc/iri/disposition
Definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

earliestChronometricAgeReferenceSystem
Identifier	http://rs.tdwg.org/chrono/iri/earliestChronometricAgeReferenceSystem
Definition	The reference system associated with the chrono:earliestChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

earliestGeochronologicalEra
Identifier	http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
Definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
Examples

establishmentMeans
Identifier	http://rs.tdwg.org/dwc/iri/establishmentMeans
Definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`

eventCategory
Identifier	http://rs.tdwg.org/dwc/iri/eventCategory
Definition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

eventDurationUnit
Identifier	http://rs.tdwg.org/eco/iri/eventDurationUnit
Definition	The units associated with the eco:eventDurationValue.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary of SI units, derived units, or other non-SI units accepted for use within the SI.
Examples

eventType
Identifier	http://rs.tdwg.org/dwc/iri/eventType
Definition	A narrow category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

excludedDegreeOfEstablishmentScope
Identifier	http://rs.tdwg.org/eco/iri/excludedDegreeOfEstablishmentScope
Definition	The degree of establishment of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`

excludedGrowthFormScope
Identifier	http://rs.tdwg.org/eco/iri/excludedGrowthFormScope
Definition	The growth form or habit of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

excludedHabitatScope
Identifier	http://rs.tdwg.org/eco/iri/excludedHabitatScope
Definition	The habitat explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

excludedLifeStageScope
Identifier	http://rs.tdwg.org/eco/iri/excludedLifeStageScope
Definition	The age class or life stage of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	This term is defined based on dwciri:lifeStage (http://rs.tdwg.org/dwc/terms/iri/lifeStage). Recommended best practice is to use an IRI from the same controlled vocabulary as for dwciri:lifeStage. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

excludedTaxonomicScope
Identifier	http://rs.tdwg.org/eco/iri/excludedTaxonomicScope
Definition	The taxonomic group explicitly excluded from sampling during an eco:Survey.
Notes	The eco:Survey to which the ecoiri:excludedTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the taxonomic groups explicitly excluded from the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

fieldNotes
Identifier	http://rs.tdwg.org/dwc/iri/fieldNotes
Definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes	The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
Examples

fieldNumber
Identifier	http://rs.tdwg.org/dwc/iri/fieldNumber
Definition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

footprintSRS
Identifier	http://rs.tdwg.org/dwc/iri/footprintSRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
Examples

footprintWKT
Identifier	http://rs.tdwg.org/dwc/iri/footprintWKT
Definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

fromLithostratigraphicUnit
Identifier	http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
Definition	Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
Examples

fundingAttribution
Identifier	http://rs.tdwg.org/dwc/iri/fundingAttribution
Definition	An organization or agency that provided funding for a project.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

geodeticDatum
Identifier	http://rs.tdwg.org/dwc/iri/geodeticDatum
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value `not recorded`.
Examples

geologicEvent
Identifier	http://rs.tdwg.org/dwc/iri/geologicEvent
Definition	A name of an identifiable event during which one or more geologic processes acted to create or modify one or more dwc:GeologicalMaterials.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

geologicProvince
Identifier	http://rs.tdwg.org/dwc/iri/geologicProvince
Definition	An extensive named region with similar geologic history, structural, petrographic, or physiographic features throughout in which the GeologicalContext was located.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

georeferencedBy
Identifier	http://rs.tdwg.org/dwc/iri/georeferencedBy
Definition	An IRI identifying a dcterms:Agent responsible for providing a georeference.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

georeferenceProtocol
Identifier	http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

georeferenceSources
Identifier	http://rs.tdwg.org/dwc/iri/georeferenceSources
Definition	An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
Notes	Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

georeferenceVerificationStatus
Identifier	http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
Definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

geospatialScopeAreaUnit
Identifier	http://rs.tdwg.org/eco/iri/geospatialScopeAreaUnit
Definition	The units associated with eco:geospatialScopeAreaValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

habitat
Identifier	http://rs.tdwg.org/dwc/iri/habitat
Definition	A category or description of the habitat in which the dwc:Event occurred.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

hazardType
Identifier	http://rs.tdwg.org/dwc/iri/hazardType
Definition	A term that belongs to a hazard classification scheme based on a set of unique characteristics and negative health outcomes.
Notes	Recommended best practice is to use a controlled vocabulary such as https://kos.geospecimens.org/vocab/hazard-type. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

identificationQualifier
Identifier	http://rs.tdwg.org/dwc/iri/identificationQualifier
Definition	A controlled value to express the determiner's doubts about the dwc:Identification.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

identificationType
Identifier	http://rs.tdwg.org/dwc/iri/identificationType
Definition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

identificationVerificationStatus
Identifier	http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
Definition	A categorical indicator of the extent to which a dwc:Identification has been verified to be correct.
Notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

identifiedBy
Identifier	http://rs.tdwg.org/dwc/iri/identifiedBy
Definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

inCollection
Identifier	http://rs.tdwg.org/dwc/iri/inCollection
Definition	Use to link any subject resource that is part of a collection to the collection containing the resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
Examples

inDataset
Identifier	http://rs.tdwg.org/dwc/iri/inDataset
Definition	Use to link a subject dataset record to the dataset which contains it.
Notes	A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
Examples

inDescribedPlace
Identifier	http://rs.tdwg.org/dwc/iri/inDescribedPlace
Definition	Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
Examples	`http://vocab.getty.edu/tgn/1019987`

informationWithheld
Identifier	http://rs.tdwg.org/dwc/iri/informationWithheld
Definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

inventoryTypes
Identifier	http://rs.tdwg.org/eco/iri/inventoryTypes
Definition	The type of search process used to conduct an eco:Survey.
Notes	This term is only relevant if the eco:Survey represents an inventory. Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

language
Identifier	http://purl.org/dc/terms/language
Definition	A language of the resource.
Notes	Recommended best practice is to use an IRI from the Library of Congress ISO 639-2 scheme http://id.loc.gov/vocabulary/iso639-2
Examples

latestChronometricAgeReferenceSystem
Identifier	http://rs.tdwg.org/chrono/iri/latestChronometricAgeReferenceSystem
Definition	The reference system associated with the chrono:latestChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

latestGeochronologicalEra
Identifier	http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
Definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
Examples

lifeStage
Identifier	http://rs.tdwg.org/dwc/iri/lifeStage
Definition	An age class or life stage of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

locationAccordingTo
Identifier	http://rs.tdwg.org/dwc/iri/locationAccordingTo
Definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialDated
Identifier	http://rs.tdwg.org/chrono/iri/materialDated
Definition	The material on which the chrono:chronometricAgeProtocol was actually performed.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialEntityCategory
Identifier	http://rs.tdwg.org/dwc/iri/materialEntityCategory
Definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialEntityType
Identifier	http://rs.tdwg.org/dwc/iri/materialEntityType
Definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialEntityCategory.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialProportion
Identifier	http://rs.tdwg.org/dwc/iri/materialProportion
Definition	The qualitative or quantitative abundance of a dwc:MaterialEntity with respect to another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as http://resource.geosciml.org/classifier/cgi/proportionterm. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialRole
Identifier	http://rs.tdwg.org/dwc/iri/materialRole
Definition	A category that best matches the nature of the relationship between a dwc:MaterialEntity and another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as IUGS CGI Compound Material Consituent Part, http://resource.geosciml.org/classifier/cgi/compoundmaterialconstituentpartrole. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

materialSampleTypes
Identifier	http://rs.tdwg.org/eco/iri/materialSampleTypes
Definition	A material sample type collected during the eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

measuredChemistrySource
Identifier	http://rs.tdwg.org/dwc/iri/measuredChemistrySource
Definition	A list (concatenated and separated) of resources associated with the reported measured chemistry described specifically enough to allow anyone in the future to use the same resources.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

measurementDeterminedBy
Identifier	http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
Definition	A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

measurementMethod
Identifier	http://rs.tdwg.org/dwc/iri/measurementMethod
Definition	The method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

measurementType
Identifier	http://rs.tdwg.org/dwc/iri/measurementType
Definition	The nature of the measurement, fact, characteristic, or assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

measurementUnit
Identifier	http://rs.tdwg.org/dwc/iri/measurementUnit
Definition	The units associated with the dwc:measurementValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
Examples

measurementValue
Identifier	http://rs.tdwg.org/dwc/iri/measurementValue
Definition	The value of the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`

mineralogicalAnalysisProtocol
Identifier	http://rs.tdwg.org/dwc/iri/mineralogicalAnalysisProtocol
Definition	A technique used to determine the chemical composition or crystallography of a mineral.
Notes	Recommended best practice is to use a controlled vocabulary such as https://vocabs.ardc.edu.au/viewById/650. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

nonTargetTaxa
Identifier	http://rs.tdwg.org/eco/iri/nonTargetTaxa
Definition	A taxon reported during the eco:Survey that is outside of the target taxonomic scope (the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope).
Notes	This term is meant to allow a taxon that is considered outside of the taxonomic scope and yet was reported in the dataset to be shared. This term is relevant only if a target taxonomic scope is declared and eco:hasNonTargetTaxa is ‘true’. Taxonomic scope is based on the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope. Non-target taxa (in some disciplines called “bycatch”) can be reported at any taxonomic level. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

objectQuantityType
Identifier	http://rs.tdwg.org/dwc/iri/objectQuantityType
Definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

occurrenceStatus
Identifier	http://rs.tdwg.org/dwc/iri/occurrenceStatus
Definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

organismInteractionType
Identifier	http://rs.tdwg.org/dwc/iri/organismInteractionType
Definition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

organismPart
Identifier	http://rs.tdwg.org/dwc/iri/organismPart
Definition	An anatomical part of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary such as the controlled vocabulary for ac:subjectPart (http://rs.tdwg.org/ac/doc/part/). Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

organismQuantityType
Identifier	http://rs.tdwg.org/dwc/iri/organismQuantityType
Definition	The type of quantification system used for the quantity of organisms.
Notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
Examples

organismScope
Identifier	http://rs.tdwg.org/dwc/iri/organismScope
Definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

pathway
Identifier	http://rs.tdwg.org/dwc/iri/pathway
Definition	The process by which a dwc:Organism came to be in a given place at a given time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcpw/values/p002` `http://rs.tdwg.org/dwcpw/values/p046`

preferredSpatialRepresentation
Identifier	http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
Definition	An indication of which spatial representation best represents the dcterms:Location.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

preparations
Identifier	http://rs.tdwg.org/dwc/iri/preparations
Definition	A preparation or preservation method for a specimen.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

protocolNames
Identifier	http://rs.tdwg.org/eco/iri/protocolNames
Definition	An IRI identifying a categorical descriptive name for the methods used during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

protocolType
Identifier	http://rs.tdwg.org/dwc/iri/protocolType
Definition	A category that best matches the nature of a dwc:Protocol.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

recordedBy
Identifier	http://rs.tdwg.org/dwc/iri/recordedBy
Definition	An IRI identifying a dcterms:Agent responsible for recording a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

recordNumber
Identifier	http://rs.tdwg.org/dwc/iri/recordNumber
Definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:MaterialEntity record, such as a specimen collector's number.
Notes	The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
Examples

reproductiveCondition
Identifier	http://rs.tdwg.org/dwc/iri/reproductiveCondition
Definition	A reproductive condition of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

sampledFeatureType
Identifier	http://rs.tdwg.org/dwc/iri/sampledFeatureType
Definition	The type of naturally occurring or anthropogenic physical feature from which a dwc:MaterialEntity was sampled.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

sampledSubstrateCategory
Identifier	http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
Definition	A category or type of substrate sampled during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

sampledSubstrateLayer
Identifier	http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
Definition	An IRI identifying a substrate layer sampled during a dwc:Event.
Notes	Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

sampleSizeUnit
Identifier	http://rs.tdwg.org/dwc/iri/sampleSizeUnit
Definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
Examples

samplingEffortProtocol
Identifier	http://rs.tdwg.org/eco/iri/samplingEffortProtocol
Definition	A method or protocol used to determine the sampling effort, denoted by an IRI.
Notes	This protocol should be associated with the values reported in eco:samplingEffortValue and eco:samplingEffortUnit. This is a specialization of eco:protocolDescriptions focused on effort, distinct from the survey method. The effort relates to the intensity of sampling and therefore can assist in interpreting estimates of completeness. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

samplingEffortUnit
Identifier	http://rs.tdwg.org/eco/iri/samplingEffortUnit
Definition	The units associated with an eco:samplingEffortValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

samplingPerformedBy
Identifier	http://rs.tdwg.org/eco/iri/samplingPerformedBy
Definition	A person, group, or organization responsible for recording an eco:Survey.
Notes	An eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

samplingProtocol
Identifier	http://rs.tdwg.org/dwc/iri/samplingProtocol
Definition	The methods or protocols used during an eco:Survey, denoted by an IRI.
Notes	Recommended best practice is to describe an eco:Survey with no more than one sampling protocol. In the case of a summary eco:Survey in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
Examples

sex
Identifier	http://rs.tdwg.org/dwc/iri/sex
Definition	A sex of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

siteNumber
Identifier	http://rs.tdwg.org/dwc/iri/siteNumber
Definition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

substrate
Identifier	http://rs.tdwg.org/dwc/iri/substrate
Definition	A type of biotic or abiotic material to which a dwc:Organism was attached during a dwc:Occurrence.
Notes	No inference can be made from this term that a dwc:Organism interacted in any other way than being connected to some (not a particular) material resource of the substrate type (such as during parasitization or decomposition). A host-parasite relationship is better expressed as a dwc:OrganismInteraction. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

surveySiteType
Identifier	http://rs.tdwg.org/eco/iri/surveySiteType
Definition	A spatial category of a sampling location for an eco:Survey.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

surveyTargetType
Identifier	http://rs.tdwg.org/eco/iri/surveyTargetType
Definition	A category that best matches the nature of a scope in an eco:SurveyTarget.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

surveyTargetUnit
Identifier	http://rs.tdwg.org/eco/iri/surveyTargetUnit
Definition	Unit associated with a value in eco:surveyTargetValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

surveyTargetValue
Identifier	http://rs.tdwg.org/eco/iri/surveyTargetValue
Definition	A value to include or exclude in a scope categorized by eco:surveyTargetType.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

targetDegreeOfEstablishmentScope
Identifier	http://rs.tdwg.org/eco/iri/targetDegreeOfEstablishmentScope
Definition	The degree of establishment of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`

targetGrowthFormScope
Identifier	http://rs.tdwg.org/eco/iri/targetGrowthFormScope
Definition	The growth form or habit of the dwc:Organisms targeted for sampling during the eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

targetHabitatScope
Identifier	http://rs.tdwg.org/eco/iri/targetHabitatScope
Definition	The habitat targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

targetLifeStageScope
Identifier	http://rs.tdwg.org/eco/iri/targetLifeStageScope
Definition	The age class or life stage of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	This term is defined based on dwciri:lifeStage (http://rs.tdwg.org/dwc/terms/iri/lifeStage). Recommended best practice is to use an IRI from the same controlled vocabulary as for dwciri:lifeStage. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

targetTaxonomicScope
Identifier	http://rs.tdwg.org/eco/iri/targetTaxonomicScope
Definition	The taxonomic group targeted for sampling during an eco:Survey.
Notes	The eco:Survey to which the ecoiri:targetTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all taxonomic groups surveyed in the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

taxonCompletenessProtocols
Identifier	http://rs.tdwg.org/eco/iri/taxonCompletenessProtocols
Definition	A method or protocol used to determine ecoiri:taxonCompletenessReported, denoted by an IRI.
Notes	This term allows users to determine how comprehensively an area has been sampled. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples

taxonCompletenessReported
Identifier	http://rs.tdwg.org/eco/iri/taxonCompletenessReported
Definition	Statement about whether the taxonomic completeness of an eco:Survey was assessed.
Notes	This term is meant to alert users that the inventory was conducted in such a way that all of the target taxa (the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope) should have been detectable if they were present during the eco:Survey. This term can provide data users with a qualitative measure of how comprehensively an area has been surveyed, which assists in interpreting species populations, areas of occupancy, inferring species absences, etc. This term is only relevant if the eco:Survey used restricted search or open search methods. If taxonomic completeness was assessed, the methods used or an explanation of the basis of the completeness should be covered by ecoiri:taxonCompletenessProtocols. Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/tcr/. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/ecotcr/values/tcr00` `http://rs.tdwg.org/ecotcr/values/tcr01` `http://rs.tdwg.org/ecotcr/values/tcr02`

taxonFormula
Identifier	http://rs.tdwg.org/dwc/iri/taxonFormula
Definition	A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

totalAreaSampledUnit
Identifier	http://rs.tdwg.org/eco/iri/totalAreaSampledUnit
Definition	The units associated with eco:totalAreaSampledValue
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

toDigitalSpecimen
Identifier	http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
Definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
Examples

toTaxon
Identifier	http://rs.tdwg.org/dwc/iri/toTaxon
Definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
Examples

typeStatus
Identifier	http://rs.tdwg.org/dwc/iri/typeStatus
Definition	A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

verbatimCoordinateSystem
Identifier	http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
Definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

verbatimSRS
Identifier	http://rs.tdwg.org/dwc/iri/verbatimSRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
Examples

verticalDatum
Identifier	http://rs.tdwg.org/dwc/iri/verticalDatum
Definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

vitality
Identifier	http://rs.tdwg.org/dwc/iri/vitality
Definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples

Cite Darwin Core

To cite Darwin Core in general, use the peer-reviewed article on Darwin Core:

Wieczorek J, Bloom D, Guralnick R, Blum S, Döring M, et al. (2012) Darwin Core: An Evolving Community-Developed Biodiversity Data Standard. PLoS ONE 7(1): e29715. https://doi.org/10.1371/journal.pone.0029715

To cite the standard document upon which this page is built, use the following:

Darwin Core Maintenance Group. 2021. List of Darwin Core terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/

To cite this document specifically, use the following:

Darwin Core Maintenance Group. 2021. Darwin Core Quick Reference Guide. Biodiversity Information Standards (TDWG). https://dwc.tdwg.org/terms/