Guía de Referencia Rápida de Darwin Core
Este documento está pensado como una guía de fácil lectura de los términos actualmente recomendados (al 2023-09-18) que se mantienen como parte del Estándar Darwin Core, y es mantenido por el Darwin Core Maintenance Group.
¿Necesitas ayuda? Lee más sobre cómo usar Darwin Core en el sitio de Preguntas & Respuestas del Darwin Core. ¿Aún tienes preguntas? Envía una nueva consulta (pregunta o problema) a la página de dwc-qa issues en GitHub, o utiliza el formulario correspondiente. Consulta al final de este documento para saber cómo citar Darwin Core.
¿Quieres contribuir? Para obtener información sobre cómo contribuir al estándar Darwin Core, incluyendo cómo proponer cambios, consulta los Lineamientos para contribuir.
Esta página no forma parte del estándar, pero combina los nombres y definiciones de los términos normativos con los comentarios y ejemplos no normativos que están destinados a ayudar a las personas a utilizar los términos de forma coherente. Las definiciones, comentarios y ejemplos pueden incluir abreviaciones de espacios de nombres (e.g., “dwc:”). Estas se incluyen para indicar que el significado de la palabra a la que están asociadas corresponde específicamente con la definición del término en ese espacio de nombres. Por lo tanto, dwc:Event significa Event tal como está definido por Darwin Core en https://dwc.tdwg.org/terms/#event. Los términos capitalizados que siguen a una abreviación de espacio de nombres, como dwc:Occurrence, son términos de clase de Darwin Core, los cuales constituyen una categoría especial de términos usados para agrupar conjuntos de términos de propiedad (términos que comienzan con minúscula y siguen la abreviación del espacio de nombres, por ejemplo, dwc:eventID) por conveniencia. Los metadatos completos de los términos actuales y obsoletos en formato legible para humanos se encuentran en el documento Lista de términos Darwin Core.
Archivos adicionales con solo los nombres de los términos actuales, así como un archivo con el historial completo de términos, pueden encontrarse en el repositorio de Darwin Core.
Nivel-Registro
Esta categoría contiene términos genéricos que podrían aplicarse a cualquier tipo de registro en un conjunto de datos.
| modified |
| Identificador | http://purl.org/dc/terms/modified |
| Definición | Fecha en la que se modificó el recurso. |
| Comentarios | Buena práctica recomendad es usar una fecha conforme con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| language |
| Identificador | http://purl.org/dc/elements/1.1/language |
| Definición | Un idioma del recurso. |
| Comentarios | Buena práctica recomendada es usar un vocabulario controlado como RFC 5646. Este término tiene una equivalencia en el dcterms:namespace que permite solo un IRI como valor, mientras que este término permite cualquier valor de literal de string. |
| Ejemplos | en (para Inglés)es (para Español)
|
| rightsHolder |
| Identificador | http://purl.org/dc/terms/rightsHolder |
| Definición | Una persona u organización dueña o gerente de derechos sobre el recurso. |
| Comentarios | |
| Ejemplos | The Regents of the University of California |
| accessRights |
| Identificador | http://purl.org/dc/terms/accessRights |
| Definición | Información sobre quién puede acceder al recurso o una indicación de su estado de seguridad. |
| Comentarios | Derechos de Acceso puede incluir información acerca del acceso o restricciones basadas en privacidad, seguridad u otras políticas. |
| Ejemplos | |
| bibliographicCitation |
| Identificador | http://purl.org/dc/terms/bibliographicCitation |
| Definición | Una referencia bibliográfica del recurso. |
| Comentarios | Desde Dublin Core, "Práctica recomendada es incluir suficientes detalles biobliográficos para identificar el recurso evitando toda posible ambiguedad" [traducción libre]. El uso previsto de este término en Darwin Core es proveer la forma preferente para citar lo recursos en sí mismos - "cómo citar este registro". Notar que el uso previsto de dcterms:references en Darwin Core, en contraste, es para señalar la definitiva representación de la fuente del recurso - "dónde encontrar la referencia más cercana a la original", si ésta está disponible. |
| Ejemplos | |
| references |
| Identificador | http://purl.org/dc/terms/references |
| Definición | Un recurso relacionado que es referenciado, citado o señalado de alguna forma por el recurso descrito. |
| Comentarios | From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself. |
| Ejemplos | |
| institutionID |
| Identificador | http://rs.tdwg.org/dwc/terms/institutionID |
| Definición | An identifier for an organization. |
| Comentarios | For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/). |
| Ejemplos | |
| datasetID |
| Identificador | http://rs.tdwg.org/dwc/terms/datasetID |
| Definición | Un identificador para conjunto o sub conjunto de datos. Puede ser un identificador único global como un DOI o un identificador específico de una colección o institución. |
| Comentarios | |
| Ejemplos | b15d4952-7d20-46f1-8a3e-556a512b04c5 |
| institutionCode |
| Identificador | http://rs.tdwg.org/dwc/terms/institutionCode |
| Definición | A name (or acronym) in use by an institution having custody of a resource. |
| Comentarios | The institution having ownership of a resource should be given in dwc:ownerInstitutionCode. |
| Ejemplos | MVZFMNHCLOUCMPNational Museum of KenyaKew Gardens
|
| basisOfRecord |
| Identificador | http://rs.tdwg.org/dwc/terms/basisOfRecord |
| Definición | Denota el origen o evidencia específica de la que se deriva el registro. |
| Comentarios | Para este elemento se debe emplear el vocabulario controlado en inglés. |
| Ejemplos | MaterialEntityPreservedSpecimenFossilSpecimenLivingSpecimenMaterialSampleEventHumanObservationMachineObservationTaxonOccurrenceMaterialCitation
|
| informationWithheld |
| Identificador | http://rs.tdwg.org/dwc/terms/informationWithheld |
| Definición | Información adicional existente sobre un recurso, pero que no se comparte públicamente. Sugiere que, previa solicitud, podrían estar disponibles datos alternativos de mayor calidad. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | location information not given for endangered speciescollector identities withheld | ask about tissue samples
|
| dataGeneralizations |
| Identificador | http://rs.tdwg.org/dwc/terms/dataGeneralizations |
| Definición | Medidas adoptadas para que los datos compartidos sean menos específicos o completos. Sugiere que los datos con mayor detalle existen y pueden estar disponibles bajo petición. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | Coordinates generalized from original GPS coordinates to the nearest half degree grid cell. |
| dynamicProperties |
| Identificador | http://rs.tdwg.org/dwc/terms/dynamicProperties |
| Definición | Una lista de medidas, hechos, características o aserciones adicionales sobre el registro. Destinado a ofrecer un mecanismo para contenido estructurado. |
| Comentarios | La mejor práctica recomendada es utilizar un esquema de codificación clave:valor para un formato de intercambio de datos como JSON. |
| Ejemplos | {"heightInMeters":1.5}{"targusLengthInMeters":0.014, "weightInGrams":120}{"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}{"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}{"aspectHeading":277, "slopeInDegrees":6}{"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}
|
Agent
| Agent Class |
| Identificador | http://purl.org/dc/terms/Agent |
| Definición | A resource that acts or has the power to act. |
| Comentarios | A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious. |
| Ejemplos | a persona team of participants on an expeditiona funding agencya particular bioacoustic monitoring installationa software instancea particular camera trap
|
| agentID |
| Identificador | http://rs.tdwg.org/dwc/terms/agentID |
| Definición | An identifier for a dcterms:Agent. |
| Comentarios | Recommended best practice is to use a globally unique identifier. |
| Ejemplos | |
| agentType |
| Identificador | http://rs.tdwg.org/dwc/terms/agentType |
| Definición | A category that best matches the nature of a dcterms:Agent. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. |
| Ejemplos | persongrouporganizationcamera
|
| agentRoleOrder |
| Identificador | http://rs.tdwg.org/dwc/terms/agentRoleOrder |
| Definición | A numerical position of an AgentRole in a set of AgentRoles. |
| Comentarios | One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2. |
| Ejemplos | |
Assertion
| Assertion Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Assertion |
| Definición | A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Comentarios | Los recursos pueden considerarse registros identificables o instancias de clases y pueden incluir, entre otras, instancias de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification o dwc:Taxon. |
| Ejemplos | the weight of a dwc:Organism in gramsthe number of placental scarssurface water temperature in Celsius
|
| assertionType |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionType |
| Definición | A category that best matches the nature of a dwc:Assertion. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | tailLengthwaterTemperaturetrapLineLengthsurveyAreatrapType
|
| verbatimAssertionType |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimAssertionType |
| Definición | A string representing the type of dwc:Assertion as it appeared in an original record. |
| Comentarios | This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it. |
| Ejemplos | water_tempFish biomasssampling net mesh size
|
| assertionValue |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionValue |
| Definición | An asserted value. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | 4520114.5UV-lightHamon grab
|
| assertionUnit |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionUnit |
| Definición | A unit associated with the value in dwc:assertionValue. |
| Comentarios | Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., g/cm^3 for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., individuals). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | |
| assertionError |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionError |
| Definición | A description of the potential error associated with a dwc:assertionValue. |
| Comentarios | |
| Ejemplos | 0.01normal distribution with variation of 2 m
|
| assertionBy |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionBy |
| Definición | A name for a dcterms:Agent responsible for making a dwc:Assertion. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | Rob GuralnickPeter Desmet | Stijn Van HoeyChatGPTNotes From NatureROV SuBastian
|
| assertionMadeDate |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionMadeDate |
| Definición | A date on which a dwc:Assertion was created. |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| assertionEffectiveDate |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionEffectiveDate |
| Definición | A date on which a state or measurement of a dwc:Assertion was deemed to first be in effect. |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| assertionReferences |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionReferences |
| Definición | A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion. |
| Comentarios | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | |
| assertionRemarks |
| Identificador | http://rs.tdwg.org/dwc/terms/assertionRemarks |
| Definición | Comments or notes about a dwc:Assertion. |
| Comentarios | |
| Ejemplos | tip of tail missingerror determined by independently calibrated measurementserror provided is from the manufacturer’s standard instrument specification
|
BibliographicResource
| referenceID |
| Identificador | http://rs.tdwg.org/dwc/terms/referenceID |
| Definición | An identifier for a dcterms:BibliographicResource. |
| Comentarios | Recommended best practice is to use a globally unique identifier. |
| Ejemplos | |
| referenceType |
| Identificador | http://rs.tdwg.org/dwc/terms/referenceType |
| Definición | A category that best matches the nature of a dcterms:BibliographicResource. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. |
| Ejemplos | book, bookSection, journalArticle, thesisproceedingsPaperreportposterfieldNotebooklogoralCommunication
|
Event
| Event Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Event |
| Definición | Una acción, un proceso o un conjunto de circunstancias que tienen lugar en una dcterms:Location durante un período de tiempo. |
| Comentarios | |
| Ejemplos | a material collecting eventa bird observationa camera trap image capturean organism occurrencea biotic survey
|
| eventID |
| Identificador | http://rs.tdwg.org/dwc/terms/eventID |
| Definición | Un identificador único para la información asociada al Evento de muestreo (dwc:Event), que ocurre en un lugar y tiempo determinado. |
| Comentarios | |
| Ejemplos | INBO:VIS:Ev:00009375 |
| parentEventID |
| Identificador | http://rs.tdwg.org/dwc/terms/parentEventID |
| Definición | An identifier for a broader dwc:Event that contains this and potentially other dwc:Events. |
| Comentarios | Recommended best practice is to use a globally unique identifier. |
| Ejemplos | A1 (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - A1:1, A1:2). |
| eventCategory |
| Identificador | http://rs.tdwg.org/dwc/terms/eventCategory |
| Definición | A broad category that best matches the nature of a dwc:Event. |
| Comentarios | Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: Event, MaterialGathering, Occurrence, OrganismInteraction, or Survey. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | EventMaterialGatheringOccurrenceOrganismInteractionSurvey
|
| eventType |
| Identificador | http://rs.tdwg.org/dwc/terms/eventType |
| Definición | Una categoría específica que se ajusta mejor a la naturaleza de un dwc:Event. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | bioBlitzcameraTrapDeploymentexpeditionprojectsiteVisittrawl
|
| fieldNumber |
| Identificador | http://rs.tdwg.org/dwc/terms/fieldNumber |
| Definición | Un identificador asignado a un dwc:Event en el campo. |
| Comentarios | A menudo sirve de enlace entre las notas de campo y un dwc:Event. Este término tiene un equivalente en el espacio de nombres dwciri: que solo admite una IRI como valor, mientras que este término permite cualquier valor de cadena de texto. |
| Ejemplos | RV Sol 87-03-08 |
| eventDate |
| Identificador | http://rs.tdwg.org/dwc/terms/eventDate |
| Definición | Una fecha y hora, o un intervalo de tiempo, durante el cual ocurrió un dwc:Event. |
| Comentarios | La mejor práctica recomendada es utilizar una fecha que cumpla con la norma ISO 8601-1:2019. No es adecuada para indicar un momento en un contexto geológico. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| eventTime |
| Identificador | http://rs.tdwg.org/dwc/terms/eventTime |
| Definición | La hora o el intervalo de horas en la cual se produjo el evento (dwc:Event). |
| Comentarios | La práctica recomendada es utilizar una fecha en el esquema de codificación ISO 8601. |
| Ejemplos | 14:07-06:00 (a las 14:07 o después y antes de las 14:08 en la zona horaria seis horas anterior a UTC)08:40:21Z (a las 08:40:21 o después y antes de las 08:41:22 UTC)13:00:00Z/15:30:00Z (a las 13:00 o después y antes de las 15:30 UTC)
|
| startDayOfYear |
| Identificador | http://rs.tdwg.org/dwc/terms/startDayOfYear |
| Definición | The earliest integer day of the year on which a dwc:Event occurred. |
| Comentarios | El valor es 1 para el 1 de enero y 365 para el 31 de diciembre, excepto en un año bisiesto, en cuyo caso es 366. |
| Ejemplos | 1 (1 de enero)32 (1 de febrero)366 (31 de diciembre)365 (30 de diciembre en año bisiesto, 31 de diciembre en año no bisiesto)
|
| endDayOfYear |
| Identificador | http://rs.tdwg.org/dwc/terms/endDayOfYear |
| Definición | El último día del año (expresado como número entero) en el que tuvo lugar un dwc:Event. |
| Comentarios | El valor es 1 para el 1 de enero y 365 para el 31 de diciembre, excepto en un año bisiesto, en cuyo caso es 366. |
| Ejemplos | 1 (1 de enero)32 (1 de febrero)366 (31 de diciembre)365 (30 de diciembre en año bisiesto, 31 de diciembre en año no bisiesto)
|
| year |
| Identificador | http://rs.tdwg.org/dwc/terms/year |
| Definición | The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar. |
| Comentarios | |
| Ejemplos | |
| month |
| Identificador | http://rs.tdwg.org/dwc/terms/month |
| Definición | El mes en números enteros en que ocurrió durante el cual se produjo el evento de observación o colecta de un organismo o muestra. |
| Comentarios | |
| Ejemplos | |
| day |
| Identificador | http://rs.tdwg.org/dwc/terms/day |
| Definición | El día en números enteros durante el cual se produjo el evento de observación o colecta de un organismo o muestra. |
| Comentarios | |
| Ejemplos | |
| verbatimEventDate |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimEventDate |
| Definición | The verbatim original representation of the date and time information for a dwc:Event. |
| Comentarios | |
| Ejemplos | spring 1910Marzo 20021999-03-XX17IV1934
|
| habitat |
| Identificador | http://rs.tdwg.org/dwc/terms/habitat |
| Definición | Una categoría o descripción del hábitat en el cual el dwc:Event ocurrió. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | oak savannapre-cordilleran steppe
|
| sampledSubstrateCategory |
| Identificador | http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory |
| Definición | A category or type of substrate sampled during a dwc:Event. |
| Comentarios | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | |
| sampledSubstrateLayer |
| Identificador | http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer |
| Definición | A list (concatenated and separated) of substrate layers sampled during a dwc:Event. |
| Comentarios | Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | forest floorherbaceous | shrubunderstorycanopyorganic (O)surface (A)eluviated (E)subsoil (B)parent material (C)bedrock (R)epipelagic | mesopelagicbathypelagicabysopelagichadalpelagic
|
| samplingProtocol |
| Identificador | http://rs.tdwg.org/dwc/terms/samplingProtocol |
| Definición | Los nombres, referencias o descripciones de los métodos o protocolos usados durante un dwc:Event. |
| Comentarios | Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary Event with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( | ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | |
| sampleSizeValue |
| Identificador | http://rs.tdwg.org/dwc/terms/sampleSizeValue |
| Definición | Un valor numérico para una medición del tamaño (duración de tiempo, longitud, área o volumen) de una muestra en un dwc:Event. |
| Comentarios | Un dwc:sampleSizeValue debe tener su correspondiente dwc:sampleSizeUnit. |
| Ejemplos | 5 (sampleSizeValue) con metros (sampleSizeUnit) |
| sampleSizeUnit |
| Identificador | http://rs.tdwg.org/dwc/terms/sampleSizeUnit |
| Definición | La unidad de medida de la magnitud (tiempo de duración, longitud, área o volumen) de una muestra en un evento dwc:Event. |
| Comentarios | Un dwc:sampleSizeUnit debe tener un correspondiente dwc:sampleSizeValue, por ejemplo, 5 para dwc:sampleSizeValue con m para dwc:sampleSizeUnit. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | minutehourdaymetresquare metrecubic metre
|
| fieldNotes |
| Identificador | http://rs.tdwg.org/dwc/terms/fieldNotes |
| Definición | Un indicador sobre la existencia o referencia (publicación URI) a las notas de campo; o el texto de las notas tomadas en campo sobre el evento (dwc:Event). |
| Comentarios | Este elemento tiene un equivalente en el dwciri: namespace que permite solamente un IRI como valor, mientras que este elemento permite cualquier cadena de texto libre. |
| Ejemplos | Notes available in the Grinnell-Miller Library. |
| eventRemarks |
| Identificador | http://rs.tdwg.org/dwc/terms/eventRemarks |
| Definición | Comentarios o anotaciones sobre el evento (dwc:Event). |
| Comentarios | |
| Ejemplos | After the recent rains the river is nearly at flood stage. |
Location
| Location Class |
| Identificador | http://purl.org/dc/terms/Location |
| Definición | Una región espacial o lugar mencionado. |
| Comentarios | |
| Ejemplos | the municipality of San Carlos de Bariloche, Río Negro, Argentinathe place defined by a georeference
|
| siteNumber |
| Identificador | http://rs.tdwg.org/dwc/terms/siteNumber |
| Definición | An identifier for a named site. |
| Comentarios | Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | USGS CENO LOC 21387UCM 2025001
|
| higherGeographyID |
| Identificador | http://rs.tdwg.org/dwc/terms/higherGeographyID |
| Definición | Un identificador de la región geográfica dentro de la cual se produjo dcterms:Location. |
| Comentarios | La mejor práctica recomendada es utilizar un identificador persistente de un vocabulario controlado como el Getty Thesaurus of Geographic Names. |
| Ejemplos | http://vocab.getty.edu/tgn/1002002 (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina). |
| higherGeography |
| Identificador | http://rs.tdwg.org/dwc/terms/higherGeography |
| Definición | Una lista (concatenada y separada) de nombres geográficos menos específicos que la información capturada en el término dwc:locality. |
| Comentarios | La práctica recomendada es separar los valores en la lista con espacio barra vertical espacio ( | ), con los elementos en orden desde el mayor rango taxonómico hasta el menor. |
| Ejemplos | Océano Atlántico NorteAmérica del Sur | Argentina | Patagonia | Parque Nacional Nahuel Huapi | Neuquén | Los Lagos con valores acompañantes América del Sur (continent) Argentina (country), Neuquén (División administrativa de primer orden), y Los Lagos (División administrativa de segundo orden)
|
| continent |
| Identificador | http://rs.tdwg.org/dwc/terms/continent |
| Definición | El nombre del continente en el que se encuentra la dcterms:Location. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado, como el Tesauro Getty de Nombres Geográficos. La práctica recomendada es dejar este elemento en blanco si la dcterms:Location abarca múltiples entidades en este nivel administrativo, o si la dcterms:Location tiene varias entidades posibles en este nivel. La multiplicidad e incertidumbre de la entidad geográfica puede documentarse en el término dwc:higherGeography o en el término dwc:locality, o en ambos. |
| Ejemplos | AfricaAntarcticaAsiaEuropeNorth AmericaOceaniaSouth America
|
| waterBody |
| Identificador | http://rs.tdwg.org/dwc/terms/waterBody |
| Definición | The name of the water body in which the dcterms:Location occurs. |
| Comentarios | La mejor práctica recomendada es utilizar un identificador persistente de un vocabulario controlado como el Getty Thesaurus of Geographic Names. |
| Ejemplos | Indian OceanBaltic SeaHudson RiverLago Nahuel Huapi
|
| islandGroup |
| Identificador | http://rs.tdwg.org/dwc/terms/islandGroup |
| Definición | El nombre del grupo de islas en el que se encuentra dcterms:Location. |
| Comentarios | La mejor práctica recomendada es utilizar un identificador persistente de un vocabulario controlado como el Getty Thesaurus of Geographic Names. |
| Ejemplos | Alexander ArchipelagoArchipiélago Diego RamírezSeychelles
|
| island |
| Identificador | http://rs.tdwg.org/dwc/terms/island |
| Definición | El nombre de la isla en el que se encuentra dcterms:Location. |
| Comentarios | La mejor práctica recomendada es utilizar un identificador persistente de un vocabulario controlado como el Getty Thesaurus of Geographic Names. |
| Ejemplos | Nosy BeBikini AtollVancouverViti LevuZanzibar
|
| country |
| Identificador | http://rs.tdwg.org/dwc/terms/country |
| Definición | El nombre del país o unidad administrativa mayor en el que se encuentra la dcterms:Location. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado, como el Tesauro Getty de Nombres Geográficos. La práctica recomendada es dejar este elemento en blanco si la dcterms:Location abarca múltiples entidades en este nivel administrativo, o si la dcterms:Location tiene varias entidades posibles en este nivel. La mulitplicidad e incertidumbre de la entidad geográfica puede documentarse en el término dwc:higherGeography o en el término dwc:locality, o en ambos. |
| Ejemplos | |
| countryCode |
| Identificador | http://rs.tdwg.org/dwc/terms/countryCode |
| Definición | El código estándar para el país en el que se encuentra la dcterms:Location. |
| Comentarios | La mejor práctica recomendada consiste en utilizar un código de país ISO 3166-1-alpha-2, o bien 'ZZ' (para una ubicación desconocida o que no pueda asignarse a un único código de país) o 'XZ' (para alta mar, más allá de las jurisdicciones nacionales). La multiplicidad e incertidumbre de la entidad geográfica pueden registrarse en el término dwc:higherGeography, en el término dwc:locality o en ambos. |
| Ejemplos | |
| stateProvince |
| Identificador | http://rs.tdwg.org/dwc/terms/stateProvince |
| Definición | El nombre completo y sin abreviar de la siguiente región administrativa de menor jerarquía que dwc:country (estado, provincia, departamento, región, etc.) en el que se encuentra la dcterms:Location. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado, como el Tesauro Getty de Nombres Geográficos. La práctica recomendada es dejar este elemento en blanco si la dcterms:Location abarca múltiples entidades en este nivel administrativo, o si la dcterms:Location tiene varias entidades posibles en este nivel. La multiplicidad e incertidumbre de la entidad geográfica puede documentarse en el término dwc:higherGeography o en el término dwc:locality, o en ambos. |
| Ejemplos | MontanaMinas GeraisCórdoba
|
| county |
| Identificador | http://rs.tdwg.org/dwc/terms/county |
| Definición | El nombre completo y sin abreviar de la siguiente región administrativa de menor jerarquía que dwc:stateProvince (municipio, cantón, distrito, etc.) en el que se encuentra la dcterms:Location. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado, como el Tesauro Getty de Nombres Geográficos. La práctica recomendada es dejar este elemento en blanco si la dcterms:Location abarca múltiples entidades en este nivel administrativo, o si la dcterms:Location tiene varias entidades posibles en este nivel. La mulitplicidad e incertidumbre de la entidad geográfica puede documentarse en el término dwc:higherGeography o en el término dwc:locality, o en ambos. |
| Ejemplos | |
| municipality |
| Identificador | http://rs.tdwg.org/dwc/terms/municipality |
| Definición | El nombre completo y sin abreviar de la siguiente región administrativa más pequeña que el condado (ciudad, municipio, etc.) donde se encuentra el término dcterms:Location. No utilice este término para un lugar cercano que no contenga el término dcterms:Location. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado, como el Tesauro Getty de Nombres Geográficos. La práctica recomendada es dejar este elemento en blanco si la dcterms:Location abarca múltiples entidades en este nivel administrativo, o si la dcterms:Location tiene varias entidades posibles en este nivel. La multiplicidad e incertidumbre de la entidad geográfica puede documentarse en el término dwc:higherGeography o en el término dwc:locality, o en ambos. |
| Ejemplos | HolzmindenAraçatubaGa-Segonyana
|
| locality |
| Identificador | http://rs.tdwg.org/dwc/terms/locality |
| Definición | La descripción específica del sitio. |
| Comentarios | La información geográfica menos específica se puede proporcionar en otros términos geográficos (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). Este término puede contener información modificada de la original para corregir errores o estandarizar la descripción. |
| Ejemplos | Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)Queets Rainforest, Olympic National Park
|
| verticalDatum |
| Identificador | http://rs.tdwg.org/dwc/terms/verticalDatum |
| Definición | El datum vertical usado como referencia para la obtención de los valores de elevación. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | EGM84EGM96EGM2008PGM2000APGM2004PGM2006PGM2007EPSG:7030not recorded
|
| minimumDistanceAboveSurfaceInMeters |
| Identificador | http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters |
| Definición | La menor distancia en metros en un rango de distancias, desde una superficie de referencia en dirección vertical. Use valores positivos para ubicaciones por encima de la superficie y valores negativos para ubicaciones por debajo de ella. Si las medidas de profundidad son proporcionadas, la superficie de referencia es la ubicación determinada por la profundidad, de lo contrario la superficie de referencia es la ubicación dada por la elevación. |
| Comentarios | |
| Ejemplos | -1.5 (bajo la superficie)4.2 (sobre la superficie)- Para un núcleo de sedimento de 1,5 metros del fondo de un lago (a una profundidad de 20 m) a una altitud de 300 m: verbatimElevation:
300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: 20, minimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
|
| maximumDistanceAboveSurfaceInMeters |
| Identificador | http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters |
| Definición | La mayor distancia en metros, en un rango de distancia desde una superficie de referencia en dirección vertical. Use valores positivos para ubicaciones por encima de la superficie y valores negativos para ubicaciones por debajo de ella. Si las medidas de profundidad son proporcionadas, la superficie de referencia es la ubicación determinada por la profundidad, de lo contrario la superficie de referencia es la ubicación dada por la elevación. |
| Comentarios | |
| Ejemplos | -1.5 (bajo la superficie)4.2 (sobre la superficie)- Para un núcleo de sedimento de 1,5 metros del fondo de un lago (a una profundidad de 20 m) a una altitud de 300 m: verbatimElevation:
300m minimumElevationInMeters: 300, maximumElevationInMeters: 300, verbatimDepth: 20m, minimumDepthInMeters: 20, maximumDepthInMeters: 20, minimumDistanceAboveSurfaceInMeters: 0, maximumDistanceAboveSurfaceInMeters: -1.5.
|
| locationAccordingTo |
| Identificador | http://rs.tdwg.org/dwc/terms/locationAccordingTo |
| Definición | La información sobre la fuente del dcterms:Location. Podría ser una publicación (gacetero), institución o grupo de individuos. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | Getty Thesaurus of Geographic NamesGADM
|
| decimalLatitude |
| Identificador | http://rs.tdwg.org/dwc/terms/decimalLatitude |
| Definición | Una latitud geográfica (en grados decimales, utilizando el sistema de referencia espacial indicado en dwc:geodeticDatum) de un dcterms:Location. |
| Comentarios | Los valores positivos se sitúan al norte del Ecuador y los negativos, al sur. Los valores válidos se encuentran entre -90 y 90, inclusive. |
| Ejemplos | -41.0983423 |
| decimalLongitude |
| Identificador | http://rs.tdwg.org/dwc/terms/decimalLongitude |
| Definición | Una longitud geográfica (en grados decimales, utilizando el sistema de referencia espacial indicado en dwc:geodeticDatum) de un dcterms:Location. |
| Comentarios | Los valores positivos se sitúan al este del Meridiano de Greenwich, y los negativos, al oeste. Los valores válidos se encuentran entre -180 y 180, inclusive. |
| Ejemplos | -121.1761111 |
| geodeticDatum |
| Identificador | http://rs.tdwg.org/dwc/terms/geodeticDatum |
| Definición | El elipsoide, datum geodésico o sistema de referencia espacial (SRS por sus siglas en inglés) sobre el cual están referenciadas las coordenadas geográficas provistas en dwc:decimalLatitude y dwc:decimalLongitude. |
| Comentarios | Se recomienda usar el código EPSG del SRS, si se conoce. De lo contrario, utilice un vocabulario controlado para el nombre o código del datum geodésico, si se conoce. De lo contrario, utilice un vocabulario controlado para el nombre o código del elipsoide, si se conoce. Si no se conoce ninguno de estos, utilice el valor no registrado. Este término tiene un equivalente en el espacio de nombres dwciri: que solo permite un IRI como valor, mientras que este término permite un valor literal de cadena. |
| Ejemplos | EPSG:4326WGS84NAD27Campo InchauspeEuropean 1950Clarke 1866not recorded
|
| coordinateUncertaintyInMeters |
| Identificador | http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters |
| Definición | Una distancia horizontal (en metros) desde unas coordenadas dadas de dwc:decimalLatitude y dwc:decimalLongitude, que describe el círculo más pequeño que contiene la totalidad de la dcterms:Location. El valor cero no es válido para este término. |
| Comentarios | Deje el valor vacío si se desconoce la incertidumbre, si no se puede estimar o si no es aplicable (porque no hay coordenadas). El cero no es un valor válido para este término. |
| Ejemplos | 30 (límite inferior razonable para lecturas de GPS tomadas bajo buenas condiciones en 2000-05-01 y fechas posteriores, si la precisión real no fue registrada en el momento)100 (límite inferior razonable para lecturas de GPS tomadas bajo buenas condiciones antes de 2000-05-01, si la precisión real no fue registrada en el momento)71 (incertidumbre para una coordenada UTM con una precisión de 100 metros y un sistema de referencia espacial conocido)
|
| coordinatePrecision |
| Identificador | http://rs.tdwg.org/dwc/terms/coordinatePrecision |
| Definición | Una representación decimal de la precisión de las coordenadas provistas en dwc:decimalLatitude y dwc:decimalLongitude. |
| Comentarios | |
| Ejemplos | 0.00001 (límite normal del GPS para grados decimales)0.000278 (precisión hasta el segundo más cercano)0.01667 (precisión hasta el minuto más cercano)1.0 (precisión hasta el grado más cercano)
|
| pointRadiusSpatialFit |
| Identificador | http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit |
| Definición | A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location. |
| Comentarios | Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853). |
| Ejemplos | |
| verbatimCoordinates |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimCoordinates |
| Definición | Verbatim original spatial coordinates of a dcterms:Location. |
| Comentarios | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Ejemplos | 41 05 54S 121 05 34W17T 630000 4833400
|
| verbatimLatitude |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimLatitude |
| Definición | A verbatim original latitude of a dcterms:Location. |
| Comentarios | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Ejemplos | 41 05 54.03S |
| verbatimLongitude |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimLongitude |
| Definición | A verbatim original longitude of a dcterms:Location. |
| Comentarios | The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem. |
| Ejemplos | 121d 10' 34" W |
| verbatimCoordinateSystem |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem |
| Definición | A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | decimal degreesdegrees decimal minutesdegrees minutes secondsUTM
|
| verbatimSRS |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimSRS |
| Definición | El elipsoide, datum geodésico, o sistema de referencia espacial (SRS) en el que se basan las coordenadas provistas en dwc:verbatimLatitude y dwc:verbatimLongitude. |
| Comentarios | Se recomienda usar el código EPSG del SRS, si se conoce. De lo contrario, utilice un vocabulario controlado para el nombre o código del datum geodésico, si se conoce. De lo contrario, utilice un vocabulario controlado para el nombre o código del elipsoide, si se conoce. Si no se conoce ninguno de estos, utilice el valor no registrado. Este término tiene un equivalente en el espacio de nombres dwciri: que solo permite un IRI como valor, mientras que este término permite cualquier valor literal de cadena. |
| Ejemplos | EPSG:4326WGS84NAD27Campo InchauspeEuropean 1950Clarke 1866not recorded
|
| footprintWKT |
| Identificador | http://rs.tdwg.org/dwc/terms/footprintWKT |
| Definición | Una representación en formato Well-Known Text (WKT) de la forma (huella, geometría) que define un dcterms:Location. |
| Comentarios | Un dcterms:Location puede tener tanto una representación de punto y radio (véase dwc:decimalLatitude) como una representación de huella, y ambas pueden diferir entre sí. |
| Ejemplos | POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20)) (Para un cuadro delimitador de un grado con esquinas opuestas en (longitud=10, latitud=20) y (longitud=11, latitud=21) |
| footprintSRS |
| Identificador | http://rs.tdwg.org/dwc/terms/footprintSRS |
| Definición | El elipsoide, datum geodésico o sistema de referencia espacial (SRS por sus siglas en inglés) sobre el cual está referenciada la geometría dada en dwc:footprintWKT. |
| Comentarios | La mejor práctica recomendada es usar el código EPSG del SRS, si se conoce. De lo contrario, use un vocabulario controlado para el nombre o código del datum geodésico, si se conoce. De lo contrario, use un vocabulario controlado para el nombre o código del elipsoide, si se conoce. Si no se conoce ninguno de estos, use el valor no registrado. También se permite proporcionar el SRS en Well-Known-Text, especialmente si ningún código EPSG proporciona los valores necesarios para los atributos del SRS. No use este término para describir el SRS de dwc:decimalLatitude y dwc:decimalLongitude, ni de ninguna coordenada textual; use dwc:geodeticDatum y dwc:verbatimSRS en su lugar. Este término tiene un equivalente en el espacio de nombres dwciri: que solo permite un IRI como valor, mientras que este término permite cualquier valor literal de cadena. |
| Ejemplos | EPSG:4326GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]] (WKT para el Sistema de Referencia Espacial WGS84 estándar EPSG:4326)no registrado
|
| footprintSpatialFit |
| Identificador | http://rs.tdwg.org/dwc/terms/footprintSpatialFit |
| Definición | Una relación entre el área de una huella (dwc:footprintWKT) y el área de una representación espacial real (original o más específica) de una dcterms:Location. |
| Comentarios | Los valores válidos son 0, un valor mayor o igual a 1, o indefinido. Un valor de 1 indica una coincidencia exacta o una superposición del 100 %. Se debe utilizar un valor de 0 si el footprint proporcionado no contiene completamente la representación original. El valor de dwc:footprintSpatialFit es indefinido (y debe dejarse vacío) si la representación original es una geometría sin área (por ejemplo, un punto o una polilínea) y sin incertidumbre, y la georreferenciación proporcionada no corresponde a esa misma geometría (sin incertidumbre). Si tanto la representación original como la georreferenciación proporcionada son el mismo punto, el valor de dwc:footprintSpatialFit es 1. En el documento Georeferencing Best Practices (Chapman y Wieczorek, 2020; https://doi.org/10.15468/doc-gg7h-s853) se pueden encontrar explicaciones detalladas con ejemplos gráficos. |
| Ejemplos | |
| georeferencedBy |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferencedBy |
| Definición | Un nombre para un dcterms:Agent responsable de proporcionar una georreferencia. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | Brad Millen (ROM)Kristina Yamamoto | Janet Fang
|
| georeferencedDate |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferencedDate |
| Definición | La fecha en la cual el dcterms:Location fue georreferenciado. |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| georeferenceProtocol |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferenceProtocol |
| Definición | Una descripción o referencia a un dwc:Protocol utilizado para determinar una huella espacial, coordenadas e incertidumbres. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128) |
| georeferenceSources |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferenceSources |
| Definición | Una lista (concatenada y separada) de mapas, nomencladores u otros recursos utilizados para georreferenciar un dcterms:Location, descriptos con suficiente detalle para permitir que cualquier persona en el futuro utilice los mismos recursos. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | |
| georeferenceRemarks |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferenceRemarks |
| Definición | Comentarios o notas sobre la determinación de la descripción espacial, explicando los supuestos realizados en adición o en oposición a los formalizados en el método mencionado en dwc:georeferenceProtocol. |
| Comentarios | |
| Ejemplos | Assumed distance by road (Hwy. 101) |
GeologicalContext
| GeologicalContext Class |
| Identificador | http://rs.tdwg.org/dwc/terms/GeologicalContext |
| Definición | Un conjunto de designaciones geológicas, como la estratigrafía, que caracteriza un dcterms:Location o la fuente de un dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | a particular lithostratigraphic layera specific chronostratigraphic unit
|
| earliestEonOrLowestEonothem |
| Identificador | http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem |
| Definición | El nombre completo del eón geocronológico más antiguo posible o del eonotema cronoestratigráfico más inferior, o bien el nombre informal atribuible al horizonte estratigráfico del cual se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | PhanerozoicProterozoicPrecambrian
|
| latestEonOrHighestEonothem |
| Identificador | http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem |
| Definición | The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected. |
| Comentarios | |
| Ejemplos | PhanerozoicProterozoicPrecambrian
|
| earliestEraOrLowestErathem |
| Identificador | http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem |
| Definición | El nombre completo de la era geocronológica más temprana o el eratema cronoestratigráfico más bajo, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | |
| latestEraOrHighestErathem |
| Identificador | http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem |
| Definición | El nombre completo de la era geocronológica más tardía o el eratema cronoestratigráfico más alto posible, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | |
| earliestPeriodOrLowestSystem |
| Identificador | http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem |
| Definición | El nombre completo del periodo geocronológico más temprano posible o el sistema cronoestratigráfico más bajo, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | NeogeneTertiaryQuaternary
|
| latestPeriodOrHighestSystem |
| Identificador | http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem |
| Definición | El nombre completo del período geocronológico más tardío posible o del sistema cronoestratigráfico más alto, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | NeogeneTertiaryQuaternary
|
| earliestEpochOrLowestSeries |
| Identificador | http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries |
| Definición | El nombre completo de la época geocronológica más temprana o la serie cronoestratigráfica más baja posible, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | HolocenePleistoceneIbexian Series
|
| latestEpochOrHighestSeries |
| Identificador | http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries |
| Definición | El nombre completo de la época geocronológica más tardía posible o la serie cronoestratigráfica más alta, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | HolocenePleistoceneIbexian Series
|
| earliestAgeOrLowestStage |
| Identificador | http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage |
| Definición | El nombre completo de la edad geocronológica más temprana posible o piso cronoestratigráfico más bajo, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | AtlanticBorealSkullrockian
|
| latestAgeOrHighestStage |
| Identificador | http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage |
| Definición | El nombre completo de la edad geocronológica más tardía posible o piso cronoestratigráfico más alto, atribuible al horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | AtlanticBorealSkullrockian
|
| lowestBiostratigraphicZone |
| Identificador | http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone |
| Definición | El nombre completo de la zona geológica bioestratigráfica más baja posible del horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | Maastrichtian |
| highestBiostratigraphicZone |
| Identificador | http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone |
| Definición | El nombre completo de la zona geológica bioestratigráfica más alta posible del horizonte estratigráfico donde se recolectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | Blancan |
| group |
| Identificador | http://rs.tdwg.org/dwc/terms/group |
| Definición | El nombre completo del grupo litoestratigráfico del cual se colectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | |
| formation |
| Identificador | http://rs.tdwg.org/dwc/terms/formation |
| Definición | El nombre completo de la formación litoestratigráfica de la cual se colectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | Notch Peak FormationHouse LimestoneFillmore Formation
|
| member |
| Identificador | http://rs.tdwg.org/dwc/terms/member |
| Definición | El nombre completo del miembro litoestratigráfico del cual se colectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | Lava Dam MemberHellnmaria Member
|
| bed |
| Identificador | http://rs.tdwg.org/dwc/terms/bed |
| Definición | El nombre completo de la capa litoestratigráfica de la cual se colectó el dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | Harlem coal |
Identification
| Identification Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Identification |
| Definición | Una clasificación de un recurso según un esquema de clasificación. |
| Comentarios | En biología, la asignación de un nombre científico o concepto de taxón a un dwc:Organism. |
| Ejemplos | a subspecies determination of an organisma nomenclatural act designating a specimen as a holotype
|
| identificationID |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationID |
| Definición | Un identificador para un dwc:Identification. |
| Comentarios | La mejor práctica recomendada es utilizar un identificador único a nivel global. |
| Ejemplos | 9992 |
| identificationType |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationType |
| Definición | A category that best matches the nature of a dwc:Identification. |
| Comentarios | The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | geographytaxonomicRevisionfunctionalAttributesnucleotideAnalysiskaryotypemediarelationshipfeaturesfineFeaturesunknown
|
| verbatimIdentification |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimIdentification |
| Definición | A string representing the taxonomic identification as it appeared in the original record. |
| Comentarios | Este elemento permite documentar la identificación o determinación original inalterada, incluidos los calificadores de identificación, fórmulas híbridas, incertidumbres, etc. Este término está pensado para utilizarse como complemento de dwc:scientificName (y dwc:identificationQualifier etc.) no en sustitución de estos. |
| Ejemplos | Peromyscus sp.Ministrymon sp. nov. 1Anser anser × Branta canadensisPachyporidae?Potentilla × pantotricha SojákAconitum pilipes × A. variegatumLepomis auritus x cyanellus
|
| taxonFormula |
| Identificador | http://rs.tdwg.org/dwc/terms/taxonFormula |
| Definición | A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. |
| Ejemplos | Anot AA ?A or BA and BA x BA cf.A aff.
|
| identificationQualifier |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationQualifier |
| Definición | Una frase breve o un término estándar ("cf.", "aff.") para expresar las dudas del identificador sobre dwc:Identification. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | aff. agrifolia var. oxyadenia (para Quercus aff. agrifolia var. oxyadenia con valores acompañantes Quercus en genus, agrifolia en specificEpithet, oxyadenia en infraspecificEpithet, y var. en taxonRank)cf. var. oxyadenia (para Quercus agrifolia cf. var. oxyadenia con valores acompañantes Quercus en genus, agrifolia en specificEpithet, oxyadenia en infraspecificEpithet, y var. en taxonRank)
|
| typeStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/typeStatus |
| Definición | A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject. |
| Comentarios | La práctica recomendada es separar los valores de una lista con un espacio, una barra vertical y otro espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier valor literal de cadena. |
| Ejemplos | holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388holotype of Pinus abies | holotype of Picea abies
|
| identifiedBy |
| Identificador | http://rs.tdwg.org/dwc/terms/identifiedBy |
| Definición | El nombre de un dcterms:Agent responsable de realizar una dwc:Identification. |
| Comentarios | Cuando se utiliza en el contexto de un eco:Survey, el sujeto está constituido por todos los dwc:Identifications relacionados con dicho eco:Survey. La práctica recomendada consiste en separar los valores de la lista mediante la secuencia espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el espacio de nombres dwciri: que admite únicamente un IRI como valor, mientras que este término permite cualquier valor de tipo cadena de texto (string literal). |
| Ejemplos | James L. PattonTheodore Pappenfuss | Robert MaceyMegaDetector V5
|
| identifiedByID |
| Identificador | http://rs.tdwg.org/dwc/terms/identifiedByID |
| Definición | Un identificador de un dcterms:Agent responsable de realizar una dwc:Identification. |
| Comentarios | Cuando se utiliza en el contexto de un eco:Survey, el sujeto comprende todos los dwc:Identifications relacionados con dicho eco:Survey. La práctica recomendada consiste en proporcionar un único identificador que permita distinguir sin ambigüedades los detalles del dcterms:Agent responsable de la identificación. Si se utiliza una lista, no debe asumirse que el orden de los identificadores en ella conlleva algún significado semántico. La práctica recomendada es separar los valores de la lista mediante un espacio, una barra vertical y otro espacio ( | ). |
| Ejemplos | |
| dateIdentified |
| Identificador | http://rs.tdwg.org/dwc/terms/dateIdentified |
| Definición | La fecha en la que se determinó que el sujeto representaba al dwc:Taxon. |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| identificationReferences |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationReferences |
| Definición | Una lista (concatenada y separada) de dcterms:BibliographicResources utilizados en una dwc:Identification. |
| Comentarios | Cuando se utiliza en el contexto de un eco:Survey, el sujeto está constituido por todos los dwc:Identifications relacionados con dicho eco:Survey. La mejor práctica recomendada consiste en separar los valores de la lista mediante un espacio, una barra vertical y otro espacio ( | ). |
| Ejemplos | Aves del Noroeste Patagonico. Christie et al. 2004.Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. | Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.
|
| identificationVerificationStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationVerificationStatus |
| Definición | Un indicador categórico del grado en que se ha verificado la exactitud de una determinación taxonómica. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado como el que se utiliza en HISPID y ABCD. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier valor literal de cadena. |
| Ejemplos | 0 (no verificado en HISPID/ABCD) |
| identificationRemarks |
| Identificador | http://rs.tdwg.org/dwc/terms/identificationRemarks |
| Definición | Comentarios o anotaciones sobre dwc:Identification. |
| Comentarios | |
| Ejemplos | Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas. |
MaterialEntity
| MaterialEntity Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MaterialEntity |
| Definición | Una entidad que puede identificarse, existe durante un período de tiempo determinado y está compuesta total o parcialmente de materia física mientras existe. |
| Comentarios | The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Ejemplos | the entire contents of a trawla subset of the contents of a trawlthe body of a fishthe stomach contents of a fisha rock containing fossilsa fossil within a rockan herbarium sheet with its attached plant specimena flower on a plant specimena pollen graina specific water samplean isolated molecule of DNA
|
| materialEntityID |
| Identificador | http://rs.tdwg.org/dwc/terms/materialEntityID |
| Definición | Un identificador para una instancia particular de dwc:MaterialEntity. |
| Comentarios | Los valores de dwc:materialEntityID están diseñados para identificar de forma única y persistente una dwc:MaterialEntity específica dentro de un contexto. Algunos ejemplos de contexto incluyen una colección de muestras específica, una organización o la escala mundial. Se recomienda utilizar un identificador único global y persistente. El identificador está vinculado a un objeto físico (dwc:MaterialEntity), en lugar de a un registro digital específico (representación) de dicho objeto físico. |
| Ejemplos | 06809dc5-f143-459a-be1a-6f03e63fc083 |
| digitalSpecimenID |
| Identificador | http://rs.tdwg.org/dwc/terms/digitalSpecimenID |
| Definición | An identifier for a Digital Specimen resource. |
| Comentarios | Un Espécimen Digital se define en https://doi.org/10.3897/rio.7.e67379. Un dwc:digitalSpecimenID tiene como objetivo identificar de forma única y persistente un espécimen digital. Se recomienda utilizar un DOI con metadatos legibles por máquina en el registro DOI que utilice un perfil de metadatos acordado por la comunidad (también conocido como perfil FDO) para un espécimen digital. Para un ejemplo, consulte: https://doi.org/10.3535/N75-CR4-0SM?noredirect. El identificador corresponde a un artefacto de información digital (el Espécimen Digital), a diferencia de un identificador para una instancia específica de un dwc:MaterialEntity. |
| Ejemplos | |
| materialEntityCategory |
| Identificador | http://rs.tdwg.org/dwc/terms/materialEntityCategory |
| Definición | A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity. |
| Comentarios | Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | liveOrganism, deadOrganism, partOfOrganism, nonMolecularBiologicalExtract, molecularBiologicalExtract, mineral, rock, fossil, chemical, humanArtifactWithBiologicalConstituent, humanArtifactWithoutBiologicalConstituent, and mixed |
| materialEntityType |
| Identificador | http://rs.tdwg.org/dwc/terms/materialEntityType |
| Definición | A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory. |
| Comentarios | Una clasificación más genérica de una dwc:MaterialEntity que dwc:preparations. Se recomienda usar un vocabulario controlado. Este término tiene un equivalente en el espacio de nombres dwciri: que solo permite un valor de IRI, mientras que este término permite cualquier valor literal de cadena. |
| Ejemplos | |
| discipline |
| Identificador | http://rs.tdwg.org/dwc/terms/discipline |
| Definición | The primary branch or branches of knowledge represented by a dwc:MaterialEntity. |
| Comentarios | This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( | ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | BotanyBotany | Virology | Taxonomy
|
| typeOfType |
| Identificador | http://rs.tdwg.org/dwc/terms/typeOfType |
| Definición | A category of nomenclatural type of a dwc:MaterialEntity. |
| Comentarios | The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | |
| typifiedName |
| Identificador | http://rs.tdwg.org/dwc/terms/typifiedName |
| Definición | A scientific name for which a specimen or other name is the type. |
| Comentarios | The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName. |
| Ejemplos | Polysiphonia amphibolis Womersley |
| catalogNumber |
| Identificador | http://rs.tdwg.org/dwc/terms/catalogNumber |
| Definición | Un identificador (preferiblemente único) para un recurso dentro de una colección. |
| Comentarios | |
| Ejemplos | 145732145732a2008.1334R-4313
|
| otherCatalogNumbers |
| Identificador | http://rs.tdwg.org/dwc/terms/otherCatalogNumbers |
| Definición | A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection. |
| Comentarios | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | FMNH:Mammal:1234NPS YELLO6778 | MBG 33424
|
| recordNumber |
| Identificador | http://rs.tdwg.org/dwc/terms/recordNumber |
| Definición | Un identificador dado al dwc:Ocurrence en el momento en que fue registrado. A menudo sirve como un vínculo entre las anotaciones de campo y el dwc:Occurrence, como el número de recolección de la muestra. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | OPP 7101 |
| objectQuantity |
| Identificador | http://rs.tdwg.org/dwc/terms/objectQuantity |
| Definición | A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity. |
| Comentarios | An dwc:objectQuantity must have a corresponding dwc:objectQuantityType. |
| Ejemplos | 27 (objectQuantity) with individuals (objectQuantityType)many (objectQuantity) with individuals (objectQuantityType)3 (objectQuantity) with legs (objectQuantityType)
|
| objectQuantityType |
| Identificador | http://rs.tdwg.org/dwc/terms/objectQuantityType |
| Definición | The type of quantification system used for the quantity of dwc:MaterialEntities. |
| Comentarios | An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | 27 (objectQuantity) with individuals (objectQuantityType)many (objectQuantity) with individuals (objectQuantityType)3 (objectQuantity) with legs (objectQuantityType)
|
| preparations |
| Identificador | http://rs.tdwg.org/dwc/terms/preparations |
| Definición | Una lista (concatenada y separada) de las preparaciones y los métodos de conservación de un dwc:MaterialEntity. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | fossilcastphotographDNA extractskin | skull | skeletonwhole animal (EtOH) | tissue (EDTA)
|
| disposition |
| Identificador | http://rs.tdwg.org/dwc/terms/disposition |
| Definición | El estado actual de una dwc:MaterialEntity con respecto a dónde se puede encontrar. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | in collectionmissingon loanused updestroyeddeaccessioned
|
| verbatimLabel |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimLabel |
| Definición | A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity. |
| Comentarios | The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel. |
| Ejemplos | |
| associatedSequences |
| Identificador | http://rs.tdwg.org/dwc/terms/associatedSequences |
| Definición | Una lista (concatenada y separada) de dcterms:BibliographicResources para dwc:NucleotideSequences asociados a una dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | |
MaterialSample
| MaterialSample Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MaterialSample |
| Definición | Una entidad material que representa alguna entidad de interés, completa o en parte. |
| Comentarios | |
| Ejemplos | a whole organism preserved in a collectiona part of an organism isolated for some purposea soil samplea marine microbial sample
|
| materialSampleID |
| Identificador | http://rs.tdwg.org/dwc/terms/materialSampleID |
| Definición | Un identificador para dwc:MaterialSample (no hace referencia a muestras digitales sino físicas, como exicados o tejidos). En ausencia de un identificador único global persistente, puede construir uno usando una combinación de identificadores del registro, de tal forma que el dwc:materialSampleID sea globalmente único. |
| Comentarios | La práctica recomendada es usar un identificador único global persistente. |
| Ejemplos | 06809dc5-f143-459a-be1a-6f03e63fc083 |
Occurrence
| Occurrence Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Occurrence |
| Definición | A dwc:Event that establishes the state of a dwc:Organism at a particular place and time. |
| Comentarios | In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Ejemplos | a wolf pack on the shore of Kluane Lake in 1988a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23a fungus in Central Park in the summer of 1929a male lance-tailed manakin in a courtship display on Isla Boca Brava
|
| occurrenceID |
| Identificador | http://rs.tdwg.org/dwc/terms/occurrenceID |
| Definición | An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence). |
| Comentarios | In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique. |
| Ejemplos | |
| recordedBy |
| Identificador | http://rs.tdwg.org/dwc/terms/recordedBy |
| Definición | A name for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | José E. CrespoOliver P. Pearson | Anita K. PearsonMegatherium ClubThe Natural History Society of NorthumbriaROV SuBastian
|
| recordedByID |
| Identificador | http://rs.tdwg.org/dwc/terms/recordedByID |
| Definición | An identifier for a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Comentarios | Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | |
| organismQuantity |
| Identificador | http://rs.tdwg.org/dwc/terms/organismQuantity |
| Definición | A number or enumeration value for the quantity of dwc:Organisms. |
| Comentarios | A dwc:organismQuantity must have a corresponding dwc:organismQuantityType. |
| Ejemplos | 27 (organismQuantity) with individuals (organismQuantityType)12.5 (organismQuantity) with % biomass (organismQuantityType)r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)many (organismQuantity) with individuals (organismQuantityType)
|
| organismQuantityType |
| Identificador | http://rs.tdwg.org/dwc/terms/organismQuantityType |
| Definición | Sistema de medida asociado a la cantidad de dwc:Organisms. |
| Comentarios | A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | 27 (organismQuantity) with individuals (organismQuantityType)12.5 (organismQuantity) with % biomass (organismQuantityType)r (organismQuantity) with Braun-Blanquet Scale (organismQuantityType)many (organismQuantity) with individuals (organismQuantityType)
|
| sex |
| Identificador | http://rs.tdwg.org/dwc/terms/sex |
| Definición | A sex of a dwc:Organism. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | |
| lifeStage |
| Identificador | http://rs.tdwg.org/dwc/terms/lifeStage |
| Definición | An age class or life stage of a dwc:Organism. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | zygotelarvajuvenileadultseedlingfloweringfruiting
|
| reproductiveCondition |
| Identificador | http://rs.tdwg.org/dwc/terms/reproductiveCondition |
| Definición | A reproductive condition of a dwc:Organism. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | non-reproductivepregnantin bloomfruit-bearing
|
| caste |
| Identificador | http://rs.tdwg.org/dwc/terms/caste |
| Definición | Una casta social de un dwc:Organism. |
| Comentarios | La mejor práctica recomendada consiste en utilizar un vocabulario controlado que se ajuste de la mejor manera a dwc:Taxon. Este término tiene un equivalente en el espacio de nombres dwciri: que solo admite una IRI como valor, mientras que este término permite cualquier valor de tipo cadena de texto (*string literal*). |
| Ejemplos | queenmale alateintercasteminor workersoldierergatoid
|
| behavior |
| Identificador | http://rs.tdwg.org/dwc/terms/behavior |
| Definición | Un comportamiento exhibido por un dwc:Organism. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | |
| vitality |
| Identificador | http://rs.tdwg.org/dwc/terms/vitality |
| Definición | Una indicación de si un dwc:Organism estaba vivo o muerto al momento de la colecta u observación. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | alivedeadmixedLotuncertainnotAssessed
|
| establishmentMeans |
| Identificador | http://rs.tdwg.org/dwc/terms/establishmentMeans |
| Definición | Declaración sobre si un dwc:Organism ha sido introducido en un lugar y tiempo determinado a través de actividad humana directa o indirecta. |
| Comentarios | La práctica recomendada es utilizar cadenas de texto provenientes del vocabulario controlado designado para documentar este término, disponibles en: http://rs.tdwg.org/dwc/doc/em/. Para más detalles, diríjase a https://doi.org/10.3897/biss.3.38084. Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | nativenativeEndemicnativeReintroducedintroducedintroducedAssistedColonisationvagrantuncertain
|
| degreeOfEstablishment |
| Identificador | http://rs.tdwg.org/dwc/terms/degreeOfEstablishment |
| Definición | El grado en el que un dwc:Organism sobrevive, se reproduce y expande su rango de distribución en un lugar y tiempo determinado. |
| Comentarios | La práctica recomendada es utilizar cadenas de texto provenientes del vocabulario controlado designado para documentar este término, disponibles en: http://rs.tdwg.org/dwc/doc/doe/. Para más detalles, diríjase a https://doi.org/10.3897/biss.3.38084. Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | nativecaptivecultivatedreleasedfailingcasualreproducingestablishedcolonisinginvasivewidespreadInvasive
|
| pathway |
| Identificador | http://rs.tdwg.org/dwc/terms/pathway |
| Definición | El proceso por el cual un dwc:Organism llegó a un lugar y tiempo determinado. |
| Comentarios | La práctica recomendada es utilizar cadenas de texto provenientes del vocabulario controlado designado para documentar este término, disponibles en: http://rs.tdwg.org/dwc/doc/pw/. Para más detalles, diríjase a https://doi.org/10.3897/biss.3.38084. Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | releasedForUseotherEscapetransportContaminanttransportStowawaycorridorunaided
|
| georeferenceVerificationStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus |
| Definición | Una descripción categórica sobre la verificación de la georreferenciación usada para representar la descripción espacial para dcterms:Location del dwc:Occurrence. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | unable to georeferencerequires georeferencerequires verificationverified by data custodianverified by contributor
|
| occurrenceStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/occurrenceStatus |
| Definición | A statement about the detection or non-detection of a dwc:Organism during a dwc:Event. |
| Comentarios | For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value. |
| Ejemplos | |
| associatedOccurrences |
| Identificador | http://rs.tdwg.org/dwc/terms/associatedOccurrences |
| Definición | Una lista (concatenada y delimitada) de identificadores para otros registros dwc:Occurrence y sus asociaciones con este dwc:Occurrence. |
| Comentarios | Este término puede utilizarse para proporcionar una lista de asociaciones con otros dwc:Occurrences. Cabe señalar que la clase dwc:ResourceRelationship es una alternativa para representar asociaciones, y permite incluir más detalle. La práctica recomendada es separar los valores en la lista con espacio barra vertical espacio ( | ). |
| Ejemplos | |
| associatedReferences |
| Identificador | http://rs.tdwg.org/dwc/terms/associatedReferences |
| Definición | Una lista (concatenada y separada) de los identificadores (publicación, referencia bibliográfica, identificador único global, URI) de la literatura asociada con el dwc:Occurrence. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). Cabe señalar que la clase dwc:ResourceRelationship es una alternativa para representar asociaciones, y permite incluir más detalle. También cabe señalar que el objetivo del término dcterms:references, cuando se aplica a un dwc:Occurrence, es dirigir a la representación definitiva de la fuente de ese dwc:Occurrence, si hay alguna disponible. También cabe señalar que el objetivo de dcterms:bibliographicCitation, cuando se aplica a un dwc:Occurrence, es proporcionar la forma preferida de citar el dwc:Occurrence en sí. |
| Ejemplos | http://www.sciencemag.org/cgi/content/abstract/322/5899/261Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. | Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.
|
| associatedTaxa |
| Identificador | http://rs.tdwg.org/dwc/terms/associatedTaxa |
| Definición | Una lista (concatenada y separada) de los identificadores o nombres de registros dwc:Taxon y las asociaciones de cada uno de ellos con este dwc:Occurrence. |
| Comentarios | Este término puede utilizarse para proporcionar una lista de asociaciones con registros dwc:Taxon adicionales al definido en el dwc:Occurrence. Cabe señalar que la clase dwc:ResourceRelationship es una alternativa para representar asociaciones, y permite incluir más detalle. Este término no es adecuado para establecer relaciones entre registros dwc:Taxon, sino para establecer relaciones entre dwc:Occurrences puntuales de un dwc:Organism con otros registros dwc:Taxon. La práctica recomendada es separar los valores en una lista con espacio-barra vertical-espacio ( | ). |
| Ejemplos | "host":"Quercus alba""host":"gbif.org/species/2879737""parasitoid of":"Cyclocephala signaticollis" | "predator of":"Apis mellifera"
|
Organism
| Organism Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Organism |
| Definición | A particular organism or defined group of organisms considered to be taxonomically homogeneous. |
| Comentarios | Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence. |
| Ejemplos | a specific birda specific wolf packa specific instance of a bacterial culturea particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection
|
| organismScope |
| Identificador | http://rs.tdwg.org/dwc/terms/organismScope |
| Definición | Una descripción en la instancia del tipo dwc:Organism. Puede ser utilizado para indicar si la instancia dwc:Organism representa un organismo discreto o un tipo particular de agregación. |
| Comentarios | Se recomienda usar un vocabulario controlado. Este elemento no está destinado a ser utilizado para especificar un tipo de dwc:Taxon. Para describir el tipo de dwc:Organism mediante un objeto URI en RDF, utilice rdf:type (http://www.w3.org/1999/02/22-rdf-syntax-ns#type) en su lugar. |
| Ejemplos | multicellular organismvirusclonepackcolony
|
| causeOfDeath |
| Identificador | http://rs.tdwg.org/dwc/terms/causeOfDeath |
| Definición | Una indicación de la causa conocida o sospechada de muerte de un dwc:Organism. |
| Comentarios | La causa puede deberse a causas naturales (por ejemplo, enfermedades, depredación), actividades humanas (por ejemplo, atropellos, contaminación) u otros factores ambientales (por ejemplo, fenómenos meteorológicos extremos). |
| Ejemplos | trappoisonstarvationdrowningshootingold agevehicle collisiondiseaseherbicideburninginfanticide
|
| associatedOrganisms |
| Identificador | http://rs.tdwg.org/dwc/terms/associatedOrganisms |
| Definición | Una lista (concatenada y separada) de los identificadores de otros dwc:Organisms y las asociaciones de cada uno de ellos con el dwc:Organism. |
| Comentarios | Este término puede utilizarse para proporcionar una lista de asociaciones con otros dwc:Organisms. Cabe señalar que la clase de dwc:ResourceRelationship es una alternativa para representar asociaciones y permite incluir más detalle. La práctica recomendada es separar los valores en la lista con espacio barra vertical espacio ( | ). |
| Ejemplos | |
| previousIdentifications |
| Identificador | http://rs.tdwg.org/dwc/terms/previousIdentifications |
| Definición | Una lista (concatenada y separada) de asignaciones taxonómicas previas que se le han dado al dwc:Organism. |
| Comentarios | La práctica recomendada es separar los valores en una lista con espacio barra vertical espacio ( | ). |
| Ejemplos | ChalepidaePinus abiesAnthus sp., field ID by G. Iglesias | Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology
|
OrganismInteraction
| OrganismInteraction Class |
| Identificador | http://rs.tdwg.org/dwc/terms/OrganismInteraction |
| Definición | An interaction between two dwc:Organisms during a dwc:Event. |
| Comentarios | Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences. |
| Ejemplos | a bee visiting a flowera Mallophora ruficauda hunting an Apis mellifera in flighta viral infection in a planta female spider mating with a male spidera lion cub nursing from its mothera mosquito sucking blood from a chimpanzee's arma slug eating a fungus growing on decomposing stump (2 interactions)
|
| organismInteractionType |
| Identificador | http://rs.tdwg.org/dwc/terms/organismInteractionType |
| Definición | A category that best matches the nature of a dwc:OrganismInteraction. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | visitedFlowerOfparasitizedmatedWithwasAttachedTo
|
MeasurementOrFact
| MeasurementOrFact Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MeasurementOrFact |
| Definición | Una medida o hecho sobre un rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource). |
| Comentarios | Los recursos pueden considerarse registros identificables o instancias de clases y pueden incluir, entre otras, instancias de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification o dwc:Taxon. |
| Ejemplos | the weight of a dwc:Organism in gramsthe number of placental scarssurface water temperature in Celsius
|
| measurementID |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementID |
| Definición | Un identificador para la medida, hecho, característica, o afirmación (dwc:MeasurementOrFact). Puede ser un identificador único global o un identificador específico para el conjunto de datos. |
| Comentarios | |
| Ejemplos | 9c752d22-b09a-11e8-96f8-529269fb1459 |
| parentMeasurementID |
| Identificador | http://rs.tdwg.org/dwc/terms/parentMeasurementID |
| Definición | An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts. |
| Comentarios | May be a globally unique identifier or an identifier specific to the data set. |
| Ejemplos | 9c752d22-b09a-11e8-96f8-529269fb1459E1_E1_O1_M1
|
| measurementType |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementType |
| Definición | El nombre o naturaleza de la medida, hecho, característica o afirmación. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | tail lengthtemperaturetrap line lengthsurvey areatrap type
|
| verbatimMeasurementType |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimMeasurementType |
| Definición | Una cadena que representa el tipo de medición o hecho tal como apareció en el registro original. |
| Comentarios | Este término permite capturar el nombre original inalterado de un tipo de medida o hecho. Debe utilizarse junto con dwc:measurementType, no en su lugar. |
| Ejemplos | water_tempFish biomasssampling net mesh size
|
| measurementValue |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementValue |
| Definición | El valor de la medida, hecho, característica o afirmación. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto. |
| Ejemplos | |
| measurementUnit |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementUnit |
| Definición | Las unidades asociadas al dwc:measurementValue. |
| Comentarios | La práctica recomendada es utilizar el Sistema Internacional de Unidades (SI). Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | |
| measurementDeterminedBy |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementDeterminedBy |
| Definición | Una lista (en una fila continua y separada) de los nombres de las personas, grupos u organizaciones que determinan el dwc:MeasurementOrFact. |
| Comentarios | La práctica recomendada es separar los valores de una lista con un espacio, una barra vertical y otro espacio ( | ). Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | Rob GuralnickPeter Desmet | Stijn Van Hoey
|
| measurementDeterminedDate |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementDeterminedDate |
| Definición | La fecha o el intervalo en la que se realizó la medida o hecho (dwc:MeasurementOrFact). |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| measurementMethod |
| Identificador | http://rs.tdwg.org/dwc/terms/measurementMethod |
| Definición | Una descripción o referencia (publicación, URI) del método o protocolo utilizado para determinar la medida, hecho, característica o afirmación. |
| Comentarios | Este término tiene un equivalente en el dwciri: namespace que solo permite usar un IRI como valor, mientras que este término permite cualquier valor de cadena de texto libre. |
| Ejemplos | polígono convexo mínimo alrededor de las entradas de las madrigueras (para un área de distribución)altímetro barométrico (para una elevación)
|
| Media Class |
| Identificador | http://rs.tdwg.org/ac/terms/Media |
| Definición | A digital or physical media resource. |
| Comentarios | An instance of digital textual media may be better represented as a dcterms:BibliographicResource. |
| Ejemplos | dcmi:Sounddcmi:StillImagedcmi:MovingImagedcmi:InteractiveResourceac:Digital3DResource
|
MolecularProtocol
| MolecularProtocol Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MolecularProtocol |
| Definición | A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity. |
| Comentarios | |
| Ejemplos | a standard DNA barcoding workflow using Sanger sequencinga shotgun metagenomics pipeline for microbial community profilinga high-throughput amplicon sequencing protocol targeting 16S rRNA
|
| assayType |
| Identificador | http://rs.tdwg.org/dwc/terms/assayType |
| Definición | A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | targetedmetabarcodingother
|
NucleotideAnalysis
| NucleotideAnalysis Class |
| Identificador | http://rs.tdwg.org/dwc/terms/NucleotideAnalysis |
| Definición | A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol. |
| Comentarios | |
| Ejemplos | |
| readCount |
| Identificador | http://rs.tdwg.org/dwc/terms/readCount |
| Definición | The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis. |
| Comentarios | |
| Ejemplos | |
NucleotideSequence
| sequence |
| Identificador | http://rs.tdwg.org/dwc/terms/sequence |
| Definición | A string representing nucleotide base pairs. |
| Comentarios | Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction. |
| Ejemplos | TCTATCCTCAATTATAGGTCATAATTCACCATCAG |
Protocol
| Protocol Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Protocol |
| Definición | A method used during an action. |
| Comentarios | |
| Ejemplos | a pitfall trap method for sampling ground-dwelling arthropodsa point-radius georeferencing methoda linear regression model to estimate body mass from skeletal measurementsa Bayesian phylogenetic inference method
|
| protocolType |
| Identificador | http://rs.tdwg.org/dwc/terms/protocolType |
| Definición | A category that best matches the nature of a dwc:Protocol. |
| Comentarios | La práctica recomendada es usar un vocabulario controlado. Este término tiene un equivalente en el dwciri: namespace que solo permite un IRI como valor, mientras que este término permite cualquier cadena de texto. |
| Ejemplos | measurementgeoreferencechronometricAgechronometricAgeConversionsamplingEffort
|
Provenance
| Provenance Class |
| Identificador | http://rs.tdwg.org/dwc/terms/Provenance |
| Definición | Information about an entity’s origins. |
| Comentarios | This is a convenience class to group related properties. |
| Ejemplos | |
| projectTitle |
| Identificador | http://rs.tdwg.org/dwc/terms/projectTitle |
| Definición | Una lista (concatenada y separada) de títulos o nombres de proyectos que contribuyeron a un dwc:Event. |
| Comentarios | Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | Arctic DeepScalidophora i NoregThe Nansen LegacyUnderwater Oases of the Mar del Plata Canyon: Talud Continental IV
|
| projectID |
| Identificador | http://rs.tdwg.org/dwc/terms/projectID |
| Definición | Una lista (concatenada y separada) de identificadores de proyectos que contribuyeron a un dwc:Event. |
| Comentarios | A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | |
| fundingAttribution |
| Identificador | http://rs.tdwg.org/ac/terms/fundingAttribution |
| Definición | Descripción textual de las organizaciones o personas que financiaron la creación del recurso. |
| Comentarios | Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | ArtsdatabankenNational Science FoundationNorges forskningsrådOcean Census | Nippon Foundation
|
| fundingAttributionID |
| Identificador | http://rs.tdwg.org/dwc/terms/fundingAttributionID |
| Definición | An identifier for a dcterms:Agent that financially supported a project. |
| Comentarios | Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( | ). |
| Ejemplos | |
ResourceRelationship
| ResourceRelationship Class |
| Identificador | http://rs.tdwg.org/dwc/terms/ResourceRelationship |
| Definición | A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another. |
| Comentarios | Los recursos pueden considerarse registros identificables o instancias de clases y pueden incluir, entre otras, instancias de dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification o dwc:Taxon. |
| Ejemplos | an instance of a dwc:Organism is the mother of another instance of a dwc:Organisma uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrencea dwc:MaterialEntity is a subsample of another dwc:MaterialEntity
|
| resourceID |
| Identificador | http://rs.tdwg.org/dwc/terms/resourceID |
| Definición | An identifier for the resource that is the subject of the relationship. |
| Comentarios | |
| Ejemplos | f809b9e0-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResourceID |
| Identificador | http://rs.tdwg.org/dwc/terms/relationshipOfResourceID |
| Definición | An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID. |
| Comentarios | Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology. |
| Ejemplos | |
| relatedResourceID |
| Identificador | http://rs.tdwg.org/dwc/terms/relatedResourceID |
| Definición | An identifier for the related resource (the object) of a dwc:ResourceRelationship. |
| Comentarios | Recommended best practice is to use a globally unique identifier. |
| Ejemplos | dc609808-b09b-11e8-96f8-529269fb1459 |
| relationshipOfResource |
| Identificador | http://rs.tdwg.org/dwc/terms/relationshipOfResource |
| Definición | The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID). |
| Comentarios | Recommended best practice is to use a controlled vocabulary. |
| Ejemplos | same asduplicate ofmother ofoffspring ofsibling ofparasite ofhost ofvalid synonym oflocated withinpollinator of members of taxonpollinated specific plantpollinated by members of taxonon slab with
|
| relationshipEstablishedDate |
| Identificador | http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate |
| Definición | The date-time on which the relationship between the two resources was established. |
| Comentarios | La práctica recomendada es utilizar una fecha de acuerdo con ISO 8601-1:2019. |
| Ejemplos | 1963-03-08T14:07-06:00 (8 de marzo de 1963 a partir de las 2:07 p. m. y antes de las 2:08 p. m. en la zona horaria seis horas anterior a UTC)2009-02-20T08:40Z (20 de febrero de 2009 a partir de las 8:40 a. m. y antes de las 8:41 UTC)2018-08-29T15:19 (29 de agosto de 2018 a partir de las 3:19 p. m. y antes de las 3:20 p. m. hora local)1809-02-12 (dentro del día 12 de febrero de 1809)1906-06 (en el mes de junio de 1906)1971 (en el año 1971)2007-03-01T13:00:00Z/2008-05-11T15:30:00Z (en algún momento dentro del intervalo que comienza el 1 de marzo de 2007 a la 1 p. m. UTC y antes del 11 de mayo de 2008 a las 3:30 p. m. UTC)1900/1909 (en algún momento dentro del intervalo entre principios del año 1900 y antes del año 1909)2007-11-13/15 (en algún momento en el intervalo entre principios del 13 de noviembre de 2007 y antes del 15 de noviembre de 2007)
|
| relationshipRemarks |
| Identificador | http://rs.tdwg.org/dwc/terms/relationshipRemarks |
| Definición | Comments or notes about the relationship between the two resources. |
| Comentarios | |
| Ejemplos | mother and offspring collected from the same nestpollinator captured in the act
|
Taxon
| scientificNameID |
| Identificador | http://rs.tdwg.org/dwc/terms/scientificNameID |
| Definición | Un identificador de los detalles de la nomenclatura (no taxonómica) de un nombre científico. |
| Comentarios | |
| Ejemplos | urn:lsid:ipni.org:names:37829-1:1.3 |
| acceptedNameUsageID |
| Identificador | http://rs.tdwg.org/dwc/terms/acceptedNameUsageID |
| Definición | Un identificador para el nombre científico aceptado en uso (significado documentado del nombre según una fuente) del taxón actualmente válido (en zoología) o aceptado (en botánica). |
| Comentarios | Este término debe usarse para sinónimos o nombres mal aplicados, para hacer referencia al dwc:taxonID de un registro dwc:Taxon que representa el nombre aceptado (en botánica) o válido (en zoología). En los Archivos Darwin Core, el registro relacionado debe estar presente localmente en el mismo archivo. |
| Ejemplos | tsn:41107 (ITIS)urn:lsid:ipni.org:names:320035-2 (IPNI)2704179 (GBIF)6W3C4 (COL)
|
| parentNameUsageID |
| Identificador | http://rs.tdwg.org/dwc/terms/parentNameUsageID |
| Definición | An identifier for the name usage (documented meaning of the name according to a source) of the direct, most proximate higher-rank parent taxon (in a classification) of the most specific element of the dwc:scientificName. |
| Comentarios | This term should be used for accepted names to refer to the dwc:taxonID of a dwc:Taxon record that represents the next higher taxon rank in the same taxonomic classification. For Darwin Core Archives the related record should be present locally in the same archive. |
| Ejemplos | tsn:41074 (ITIS)urn:lsid:ipni.org:names:30001404-2 (IPNI)2704173 (GBIF)6T8N (COL)
|
| originalNameUsageID |
| Identificador | http://rs.tdwg.org/dwc/terms/originalNameUsageID |
| Definición | An identifier for the name usage (documented meaning of the name according to a source) in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. |
| Comentarios | This term should be used to refer to the dwc:taxonID of a dwc:Taxon record that represents the usage of the terminal element of the dwc:scientificName as originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would establish the relationship between a record representing a subsequent combination and the record for its corresponding basionym. Unlike basionyms, however, this term can apply to scientific names at all ranks. For Darwin Core Archives the related record should be present locally in the same archive. |
| Ejemplos | tsn:41107 (ITIS)urn:lsid:ipni.org:names:320035-2 (IPNI)2704179 (GBIF)6W3C4 (COL)
|
| namePublishedInID |
| Identificador | http://rs.tdwg.org/dwc/terms/namePublishedInID |
| Definición | An identifier for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. |
| Comentarios | A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedInID should be empty. |
| Ejemplos | |
| taxonConceptID |
| Identificador | http://rs.tdwg.org/dwc/terms/taxonConceptID |
| Definición | An identifier for the taxonomic concept to which the record refers - not for the nomenclatural details of a dwc:Taxon. |
| Comentarios | |
| Ejemplos | 8fa58e08-08de-4ac1-b69c-1235340b7001 |
| scientificName |
| Identificador | http://rs.tdwg.org/dwc/terms/scientificName |
| Definición | The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined. |
| Comentarios | This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign × (Unicode U+00D7, HTML ×) to identify a hybrid, not x or X, if possible. |
| Ejemplos | Coleoptera (orden)Vespertilionidae (family)Manis (genus)Ctenomys sociabilis (genus + specificEpithet)Ambystoma tigrinum diaboli (genus + specificEpithet + infraspecificEpithet)Roptrocerus typographi (Györfi, 1952) (genus + specificEpithet + scientificNameAuthorship)Quercus agrifolia var. oxiadenia (Torr.) J.T. Howell (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship)×Agropogon littoralis (Sm.) C. E. Hubb.Mentha ×smithiana R. A. GrahamAgrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.
|
| acceptedNameUsage |
| Identificador | http://rs.tdwg.org/dwc/terms/acceptedNameUsage |
| Definición | El nombre completo, con autoría e información de fecha si se conoce, del taxón actualmente válido (zoológico) o aceptado (botánico) dwc:Taxon. |
| Comentarios | El nombre científico completo, con información sobre la autoría y la fecha si se conoce, del nombre aceptado (botánico) o válido (zoológico) en los casos en que el dwc:scientificName proporcionado se considera, por la referencia indicada en la propiedad dwc:nameAccordingTo, o del proveedor de contenido, un sinónimo o un nombre mal aplicado. Cuando se aplica a un dwc:Organism o dwc:Occurrence, este término debe usarse en los casos en que un proveedor de contenido considera que el dwc:scientificName proporcionado es inconsistente con la perspectiva taxonómica del proveedor de contenido. Por ejemplo, existen muchas discrepancias dentro de las colecciones de especímenes y los conjuntos de datos de observación entre el nombre registrado (p. ej., la identificación más reciente de un experto que examinó un espécimen, o una identificación de campo para un dwc:Organism observado) y el nombre que el proveedor de contenido afirma que es taxonómicamente aceptado. |
| Ejemplos | Tamias minimus (nombre válido para Eutamias minimus) |
| parentNameUsage |
| Identificador | http://rs.tdwg.org/dwc/terms/parentNameUsage |
| Definición | The full name, with authorship and date information if known, of the direct, most proximate higher-rank parent dwc:Taxon (in a classification) of the most specific element of the dwc:scientificName. |
| Comentarios | |
| Ejemplos | RubiaceaeGruiformesTestudinae
|
| originalNameUsage |
| Identificador | http://rs.tdwg.org/dwc/terms/originalNameUsage |
| Definición | The taxon name, with authorship and date information if known, as it originally appeared when first established under the rules of the associated dwc:nomenclaturalCode. The basionym (botany) or basonym (bacteriology) of the dwc:scientificName or the senior/earlier homonym for replaced names. |
| Comentarios | The full scientific name, with authorship and date information if known, of the name usage in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would indicate the basionym of a record representing a subsequent combination. Unlike basionyms, however, this term can apply to scientific names at all ranks. |
| Ejemplos | Pinus abiesGasterosteus saltatrix Linnaeus 1768
|
| nameAccordingTo |
| Identificador | http://rs.tdwg.org/dwc/terms/nameAccordingTo |
| Definición | La referencia a la fuente en la que está definida o implícita la definición conceptual del taxón documentado en scientificName, tradicionalmente representado por el Latín “sensu” o “sec.” (de secundum, que significa “según”). Para los taxones que resultan de las identificaciones, una referencia a las claves, monografías, expertos y otras fuentes debe ser provista. |
| Comentarios | This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by sensu or sec., it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context. |
| Ejemplos | Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236. (as the full citation of the Franz & Cardona-Duque (2013) in Perelleschus splendida sec. Franz & Cardona-Duque (2013)) |
| namePublishedIn |
| Identificador | http://rs.tdwg.org/dwc/terms/namePublishedIn |
| Definición | Una referencia para la publicación en que se estableció originalmente el taxón presente en el dwc:scientificName, bajo las reglas del dwc:nomenclaturalCode asociado. |
| Comentarios | La citación de la primera publicación del nombre científico documentado en este registro, no el basónimo/nombre original. Las recombinaciones usualmente no se publican en zoología, en ese caso dwc:namePublishedIn debe estar vacío. |
| Ejemplos | Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886
|
| higherClassification |
| Identificador | http://rs.tdwg.org/dwc/terms/higherClassification |
| Definición | Una lista (concatenada y separada) de los nombres de los taxones terminando en el rango inmediatamente superior al referenciado en el dwc:Taxon. |
| Comentarios | La práctica recomendada es separar los valores en la lista con una barra vertical espaciadora ( | ), con los elementos en orden desde el mayor rango taxonómico hasta el menor. |
| Ejemplos | Plantae | Tracheophyta | Magnoliopsida | Ranunculales | Ranunculaceae | RanunculusAnimaliaAnimalia | Chordata | Vertebrata | Mammalia | Theria | Eutheria | Rodentia | Hystricognatha | Hystricognathi | Ctenomyidae | Ctenomyini | Ctenomys
|
| kingdom |
| Identificador | http://rs.tdwg.org/dwc/terms/kingdom |
| Definición | El nombre científico completo del reino en el que se clasifica el dwc:Taxon. |
| Comentarios | |
| Ejemplos | AnimaliaArchaeaBacteriaChromistaFungiPlantaeProtozoaViruses
|
| phylum |
| Identificador | http://rs.tdwg.org/dwc/terms/phylum |
| Definición | El nombre científico completo del filo o división en el que se clasifica el dwc:Taxon. |
| Comentarios | |
| Ejemplos | Chordata (filo)Bryophyta (división)
|
| superfamily |
| Identificador | http://rs.tdwg.org/dwc/terms/superfamily |
| Definición | El nombre científico completo de la superfamilia en el que se clasifica el dwc:Taxon. |
| Comentarios | A taxonomic category subordinate to an order and superior to a family. According to ICZN article 29.2, the suffix -oidea is used for a superfamily name. |
| Ejemplos | AchatinoideaCerithioideaHelicoideaHypsibioideaValvatoideaZonitoidea
|
| subfamily |
| Identificador | http://rs.tdwg.org/dwc/terms/subfamily |
| Definición | El nombre científico completo de la subfamilia en el que se clasifica el dwc:Taxon. |
| Comentarios | |
| Ejemplos | PeriptyctinaeOrchidoideaeSphindociinae
|
| genericName |
| Identificador | http://rs.tdwg.org/dwc/terms/genericName |
| Definición | La parte del género en un dwc:scientificName sin la autoría. |
| Comentarios | Para sinónimos el género aceptado y la parte del género del nombre pueden ser diferentes. El elemento dwc:genericName debe ser usado junto al dwc:specificEpithet para formar un binomio y con dwc:infraspecificEpithet para formar un trinomio. El elemento dwc:genericName solo debe ser usado para combinaciones. Uninomiales de rango genérico no tienen un dwc:genericName. |
| Ejemplos | Felis (para el scientificName “Felis concolor”, con los valores correspondientes de Puma concolor en acceptedNameUsage y Puma en genus) |
| subgenus |
| Identificador | http://rs.tdwg.org/dwc/terms/subgenus |
| Definición | El nombre científico completo del subgénero en el que se clasifica el dwc:Taxon. |
| Comentarios | Un valor para este término debe ser un nombre de subgénero completo según lo requiera el código de nomenclatura apropiado. |
| Ejemplos | Abacetus (Parastygis)Dicranum subgen. Orthodicranum
|
| infragenericEpithet |
| Identificador | http://rs.tdwg.org/dwc/terms/infragenericEpithet |
| Definición | La parte del epíteto infragenérico en un nombre binomial en rangos que están por encima de la especie, pero por debajo del género. |
| Comentarios | El término dwc:infragenericEpithet debe ser utilizado conjuntamente con dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank y dwc:scientificNameAuthorship para representar los elementos individuales del dwc:scientificName completo. Este puede ser utilizado para indicar la colocación del subgénero de una especie, que en zoología normalmente se coloca entre parentesis. También puede ser utilizado para compartir nombres infragenéricos como secciones botánicas (e.g.Vicia sect. Cracca). |
| Ejemplos | Abacetillus (para scientificName Abacetus (Abacetillus) ambiguus)Cracca (para scientificName Vicia sect. Cracca)
|
| infraspecificEpithet |
| Identificador | http://rs.tdwg.org/dwc/terms/infraspecificEpithet |
| Definición | El nombre de la categoría infraespecífica más baja o terminal del dwc:scientificName. |
| Comentarios | En botánica, las cadenas de nombres que aparecen en la literatura y en las identificaciones pueden incluir múltiples rangos infraespecíficos. Según el Código Internacional de Nomenclatura para algas, hongos y plantas (artículos 6.7 y 24.1 del Código de Shenzhen), los nombres válidos solo constan de dos epítetos, siendo el de rango inferior el correspondiente a dwc:infraspecificEpithet. Por ejemplo: en la cadena Indigofera charlieriana subsp. sessilis var. scaberrima, el dwc:infraspecificEpithet es scaberrima y el dwc:scientificName es Indigofera charlieriana var. scaberrima. Utilice dwc:verbatimIdentification para la cadena de nombre completa empleada en una dwc:Identification. |
| Ejemplos | concolor (para el scientificName Puma concolor concolor)oxyadenia (para el scientificName Quercus agrifolia var. oxyadenia)laxa (para el scientificName Cheilanthes hirta f. laxa)scaberrima (para el scientificName Indigofera charlieriana var. scaberrima)
|
| cultivarEpithet |
| Identificador | http://rs.tdwg.org/dwc/terms/cultivarEpithet |
| Definición | La parte del nombre de un cultivar, grupo de cultivares, o grex que sigue al dwc:scientificName. |
| Comentarios | De acuerdo con las normas del Código de Plantas Cultivadas, el nombre de un cultivar consta de un nombre botánico seguido de un epíteto de cultivar. El valor asignado a dwc:cultivarEpithet no debe incluir comillas. Se debe utilizar el término dwc:taxonRank para indicar de qué tipo de nombre de planta cultivada se trata (p. ej., cultivar, grupo de cultivares, grex). Este epíteto, incluyendo cualquier apóstrofe que lo encierre o sufijo, también debe indicarse en dwc:scientificName. |
| Ejemplos | King Edward (para scientificName Solanum tuberosum 'King Edward' y taxonRank cultivar)Mishmiense (para scientificName Rhododendron boothii Mishmiense Group y taxonRank grupo de cultivares)Atlantis (para scientificName Paphiopedilum Atlantis grex y taxonRank grex)
|
| taxonRank |
| Identificador | http://rs.tdwg.org/dwc/terms/taxonRank |
| Definición | La categoría taxonómica del nombre más específico presente en el dwc:scientificName. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1). |
| Ejemplos | subspeciesvarietasformaspeciesgenusnothogenusnothospeciesnothosubspecies
|
| verbatimTaxonRank |
| Identificador | http://rs.tdwg.org/dwc/terms/verbatimTaxonRank |
| Definición | La categoría taxonómica del nombre más específico presente en el dwc:scientificName tal como aparece en el registro original. |
| Comentarios | |
| Ejemplos | Agamospeciessub-lesusproleapomictnothogrexsp.subsp.var.
|
| scientificNameAuthorship |
| Identificador | http://rs.tdwg.org/dwc/terms/scientificNameAuthorship |
| Definición | The authorship information for the dwc:scientificName formatted according to the conventions of the applicable dwc:nomenclaturalCode. |
| Comentarios | |
| Ejemplos | (Torr.) J.T. Howell(Martinovský) Tzvelev(Györfi, 1952)
|
| nomenclaturalCode |
| Identificador | http://rs.tdwg.org/dwc/terms/nomenclaturalCode |
| Definición | The nomenclatural code (or codes in the case of an ambiregnal name) under which the dwc:scientificName is constructed. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. |
| Ejemplos | |
| taxonomicStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/taxonomicStatus |
| Definición | The status of the use of the dwc:scientificName as a label for a taxon. Requires taxonomic opinion to define the scope of a dwc:Taxon. Rules of priority then are used to define the taxonomic status of the nomenclature contained in that scope, combined with the experts opinion. It must be linked to a specific taxonomic reference that defines the concept. |
| Comentarios | La práctica recomendada es utilizar un vocabulario controlado. |
| Ejemplos | invalidmisappliedhomotypic synonymaccepted
|
| nomenclaturalStatus |
| Identificador | http://rs.tdwg.org/dwc/terms/nomenclaturalStatus |
| Definición | El estado nomenclatural en la publicación original del scientificName y su conformidad con las normas pertinentes de nomenclatura. Está basado en las definiciones del nomenclaturalCode en uso y no requiere una opinión taxonómica. |
| Comentarios | |
| Ejemplos | nom. ambig.nom. illeg.nom. subnud.
|
UsagePolicy
| UsagePolicy Class |
| Identificador | http://rs.tdwg.org/dwc/terms/UsagePolicy |
| Definición | Information about rights, usage, and attribution statements applicable to an entity. |
| Comentarios | This is a convenience class to group related properties. |
| Ejemplos | |
LivingSpecimen
PreservedSpecimen
FossilSpecimen
| FossilSpecimen Class |
| Identificador | http://rs.tdwg.org/dwc/terms/FossilSpecimen |
| Definición | Un ejemplar conservado que es un fósil. |
| Comentarios | |
| Ejemplos | a body fossila coprolitea gastrolithan ichnofossila piece of a petrified tree
|
MaterialCitation
| MaterialCitation Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MaterialCitation |
| Definición | Una referencia o cita de uno, parte de, o varios especímenes en publicaciones académicas. |
| Comentarios | Esta clase constituye un nuevo valor para el vocabulario controlado en las recomendaciones para basisOfRecord. Al importar conjuntos de datos basados en la literatura de Darwin Core Archives a GBIF, basisOfRecord debe cambiarse de "Occurrence", "PreservedSpecimen" or "Literature" a "MaterialCitation". |
| Ejemplos | a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publicationa citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication
|
HumanObservation
| HumanObservation Class |
| Identificador | http://rs.tdwg.org/dwc/terms/HumanObservation |
| Definición | El resultado de un proceso de observación humana. |
| Comentarios | |
| Ejemplos | evidence of a dwc:Occurrence taken from field notes or literaturea record of a dwc:Occurrence without physical evidence or evidence captured with a machine
|
MachineObservation
| MachineObservation Class |
| Identificador | http://rs.tdwg.org/dwc/terms/MachineObservation |
| Definición | El resultado de un proceso de observación por una máquina. |
| Comentarios | |
| Ejemplos | a photographa videoan audio recordinga remote sensing imagea dwc:Occurrence record based on telemetry
|
UseWithIRI
Para más información sobre UseWithIRI, consulta la Sección 2.5 de la Guía RDF.
| assayType |
| Identificador | http://rs.tdwg.org/dwc/iri/assayType |
| Definición | A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| assertionBy |
| Identificador | http://rs.tdwg.org/dwc/iri/assertionBy |
| Definición | An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| assertionType |
| Identificador | http://rs.tdwg.org/dwc/iri/assertionType |
| Definición | A category that best matches the nature of a dwc:Assertion. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| assertionUnit |
| Identificador | http://rs.tdwg.org/dwc/iri/assertionUnit |
| Definición | A unit associated with the value in dwc:assertionValue. |
| Comentarios | Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| behavior |
| Identificador | http://rs.tdwg.org/dwc/iri/behavior |
| Definición | A behavior shown by a dwc:Organism. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| caste |
| Identificador | http://rs.tdwg.org/dwc/iri/caste |
| Definición | A social caste of a dwc:Organism. |
| Comentarios | Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| dataGeneralizations |
| Identificador | http://rs.tdwg.org/dwc/iri/dataGeneralizations |
| Definición | Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| discipline |
| Identificador | http://rs.tdwg.org/dwc/iri/discipline |
| Definición | The primary branch or branches of knowledge represented by the record. |
| Comentarios | This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| disposition |
| Identificador | http://rs.tdwg.org/dwc/iri/disposition |
| Definición | A current state of a dwc:MaterialEntity with respect to where it can be found. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| earliestGeochronologicalEra |
| Identificador | http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra |
| Definición | Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected. |
| Comentarios | Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details. |
| Ejemplos | |
| eventCategory |
| Identificador | http://rs.tdwg.org/dwc/iri/eventCategory |
| Definición | A broad category that best matches the nature of a dwc:Event. |
| Comentarios | Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| eventType |
| Identificador | http://rs.tdwg.org/dwc/iri/eventType |
| Definición | A narrow category that best matches the nature of a dwc:Event. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| fieldNotes |
| Identificador | http://rs.tdwg.org/dwc/iri/fieldNotes |
| Definición | One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event. |
| Comentarios | The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes. |
| Ejemplos | |
| fieldNumber |
| Identificador | http://rs.tdwg.org/dwc/iri/fieldNumber |
| Definición | An identifier given to a dwc:Event in the field. |
| Comentarios | Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| footprintSRS |
| Identificador | http://rs.tdwg.org/dwc/iri/footprintSRS |
| Definición | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based. |
| Comentarios | Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded. |
| Ejemplos | |
| footprintWKT |
| Identificador | http://rs.tdwg.org/dwc/iri/footprintWKT |
| Definición | A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| fromLithostratigraphicUnit |
| Identificador | http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit |
| Definición | Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy. |
| Comentarios | Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details. |
| Ejemplos | |
| fundingAttribution |
| Identificador | http://rs.tdwg.org/dwc/iri/fundingAttribution |
| Definición | An organization or agency that provided funding for a project. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| geodeticDatum |
| Identificador | http://rs.tdwg.org/dwc/iri/geodeticDatum |
| Definición | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based. |
| Comentarios | Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value not recorded. |
| Ejemplos | |
| georeferencedBy |
| Identificador | http://rs.tdwg.org/dwc/iri/georeferencedBy |
| Definición | An IRI identifying a dcterms:Agent responsible for providing a georeference. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| georeferenceProtocol |
| Identificador | http://rs.tdwg.org/dwc/iri/georeferenceProtocol |
| Definición | A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| georeferenceSources |
| Identificador | http://rs.tdwg.org/dwc/iri/georeferenceSources |
| Definición | An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location. |
| Comentarios | Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| georeferenceVerificationStatus |
| Identificador | http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus |
| Definición | A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| habitat |
| Identificador | http://rs.tdwg.org/dwc/iri/habitat |
| Definición | A category or description of the habitat in which the dwc:Event occurred. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| identificationQualifier |
| Identificador | http://rs.tdwg.org/dwc/iri/identificationQualifier |
| Definición | A controlled value to express the determiner's doubts about the dwc:Identification. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| identificationType |
| Identificador | http://rs.tdwg.org/dwc/iri/identificationType |
| Definición | A category that best matches the nature of a dwc:Identification. |
| Comentarios | The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| identificationVerificationStatus |
| Identificador | http://rs.tdwg.org/dwc/iri/identificationVerificationStatus |
| Definición | A categorical indicator of the extent to which a taxonomic determination has been verified to be correct. |
| Comentarios | Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| identifiedBy |
| Identificador | http://rs.tdwg.org/dwc/iri/identifiedBy |
| Definición | An IRI identifying a dcterms:Agent responsible for making a dwc:Identification. |
| Comentarios | When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| inCollection |
| Identificador | http://rs.tdwg.org/dwc/iri/inCollection |
| Definición | Use to link any subject resource that is part of a collection to the collection containing the resource. |
| Comentarios | Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details. |
| Ejemplos | |
| inDataset |
| Identificador | http://rs.tdwg.org/dwc/iri/inDataset |
| Definición | Use to link a subject dataset record to the dataset which contains it. |
| Comentarios | A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details. |
| Ejemplos | |
| inDescribedPlace |
| Identificador | http://rs.tdwg.org/dwc/iri/inDescribedPlace |
| Definición | Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource. |
| Comentarios | Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details. |
| Ejemplos | http://vocab.getty.edu/tgn/1019987 |
| informationWithheld |
| Identificador | http://rs.tdwg.org/dwc/iri/informationWithheld |
| Definición | Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| latestGeochronologicalEra |
| Identificador | http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra |
| Definición | Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected. |
| Comentarios | Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details. |
| Ejemplos | |
| lifeStage |
| Identificador | http://rs.tdwg.org/dwc/iri/lifeStage |
| Definición | An age class or life stage of a dwc:Organism. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| locationAccordingTo |
| Identificador | http://rs.tdwg.org/dwc/iri/locationAccordingTo |
| Definición | Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| materialEntityCategory |
| Identificador | http://rs.tdwg.org/dwc/iri/materialEntityCategory |
| Definición | A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity. |
| Comentarios | Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| materialEntityType |
| Identificador | http://rs.tdwg.org/dwc/iri/materialEntityType |
| Definición | A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory. |
| Comentarios | A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| measurementDeterminedBy |
| Identificador | http://rs.tdwg.org/dwc/iri/measurementDeterminedBy |
| Definición | A person, group, or organization who determined the value of the dwc:MeasurementOrFact. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| measurementMethod |
| Identificador | http://rs.tdwg.org/dwc/iri/measurementMethod |
| Definición | The method or protocol used to determine the measurement, fact, characteristic, or assertion. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| measurementType |
| Identificador | http://rs.tdwg.org/dwc/iri/measurementType |
| Definición | The nature of the measurement, fact, characteristic, or assertion. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| objectQuantityType |
| Identificador | http://rs.tdwg.org/dwc/iri/objectQuantityType |
| Definición | The type of quantification system used for the quantity of dwc:MaterialEntities. |
| Comentarios | An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| occurrenceStatus |
| Identificador | http://rs.tdwg.org/dwc/iri/occurrenceStatus |
| Definición | A statement about the detection or non-detection of a dwc:Organism during a dwc:Event. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| organismInteractionType |
| Identificador | http://rs.tdwg.org/dwc/iri/organismInteractionType |
| Definición | A category that best matches the nature of a dwc:OrganismInteraction. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| organismQuantityType |
| Identificador | http://rs.tdwg.org/dwc/iri/organismQuantityType |
| Definición | The type of quantification system used for the quantity of organisms. |
| Comentarios | A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. |
| Ejemplos | |
| organismScope |
| Identificador | http://rs.tdwg.org/dwc/iri/organismScope |
| Definición | A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. This term is not intended to be used to specify a type of dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| preferredSpatialRepresentation |
| Identificador | http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation |
| Definición | An indication of which spatial representation best represents the dcterms:Location. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| preparations |
| Identificador | http://rs.tdwg.org/dwc/iri/preparations |
| Definición | A preparation or preservation method for a specimen. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| protocolType |
| Identificador | http://rs.tdwg.org/dwc/iri/protocolType |
| Definición | A category that best matches the nature of a dwc:Protocol. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| recordedBy |
| Identificador | http://rs.tdwg.org/dwc/iri/recordedBy |
| Definición | An IRI identifying a dcterms:Agent responsible for recording a dwc:Occurrence. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| recordNumber |
| Identificador | http://rs.tdwg.org/dwc/iri/recordNumber |
| Definición | An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:Occurrence record, such as a specimen collector's number. |
| Comentarios | The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes. |
| Ejemplos | |
| reproductiveCondition |
| Identificador | http://rs.tdwg.org/dwc/iri/reproductiveCondition |
| Definición | A reproductive condition of a dwc:Organism. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| sampledSubstrateCategory |
| Identificador | http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory |
| Definición | A category or type of substrate sampled during a dwc:Event. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| sampledSubstrateLayer |
| Identificador | http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer |
| Definición | An IRI identifying a substrate layer sampled during a dwc:Event. |
| Comentarios | Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| sampleSizeUnit |
| Identificador | http://rs.tdwg.org/dwc/iri/sampleSizeUnit |
| Definición | The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event. |
| Comentarios | A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI. |
| Ejemplos | |
| samplingProtocol |
| Identificador | http://rs.tdwg.org/dwc/iri/samplingProtocol |
| Definición | The methods or protocols used during a dwc:Event, denoted by an IRI. |
| Comentarios | Recommended best practice is to describe a dwc:Event with no more than one sampling protocol. In the case of a summary dwc:Event in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence. |
| Ejemplos | |
| sex |
| Identificador | http://rs.tdwg.org/dwc/iri/sex |
| Definición | A sex of a dwc:Organism. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| siteNumber |
| Identificador | http://rs.tdwg.org/dwc/iri/siteNumber |
| Definición | An identifier for a named site. |
| Comentarios | Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| taxonFormula |
| Identificador | http://rs.tdwg.org/dwc/iri/taxonFormula |
| Definición | A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| toDigitalSpecimen |
| Identificador | http://rs.tdwg.org/dwc/iri/toDigitalSpecimen |
| Definición | Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use. |
| Comentarios | Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity. |
| Ejemplos | |
| toTaxon |
| Identificador | http://rs.tdwg.org/dwc/iri/toTaxon |
| Definición | Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use. |
| Comentarios | A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details. |
| Ejemplos | |
| typeStatus |
| Identificador | http://rs.tdwg.org/dwc/iri/typeStatus |
| Definición | A nomenclatural type (type status, typified scientific name, publication) applied to the subject. |
| Comentarios | Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| verbatimCoordinateSystem |
| Identificador | http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem |
| Definición | A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| verbatimSRS |
| Identificador | http://rs.tdwg.org/dwc/iri/verbatimSRS |
| Definición | The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based. |
| Comentarios | Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to not recorded. |
| Ejemplos | |
| verticalDatum |
| Identificador | http://rs.tdwg.org/dwc/iri/verticalDatum |
| Definición | The vertical datum used as the reference upon which the values in the elevation terms are based. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
| vitality |
| Identificador | http://rs.tdwg.org/dwc/iri/vitality |
| Definición | An indication of whether a dwc:Organism was alive or dead at the time of collection or observation. |
| Comentarios | Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects. |
| Ejemplos | |
Cómo citar Darwin Core
Para citar Darwin Core en general, utiliza el artículo revisado por pares sobre el estándar:
Wieczorek J, Bloom D, Guralnick R, Blum S, Döring M, et al. (2012) Darwin Core: An Evolving Community-Developed Biodiversity Data Standard. PLoS ONE 7(1): e29715. https://doi.org/10.1371/journal.pone.0029715
Para citar el documento base del estándar sobre el cual se construye esta página, utiliza la siguiente referencia:
Darwin Core Maintenance Group. 2021. List of Darwin Core terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/
Para citar específicamente este documento, utiliza la siguiente referencia:
Darwin Core Maintenance Group. 2021. Guía de Referencia Rápida de Darwin Core. Biodiversity Information Standards (TDWG). https://dwc.tdwg.org/terms/