Darwin Core List of Terms

Title: Darwin Core List of Terms
Date version issued: 2026-09-17
Date created: 2020-08-12
Part of TDWG Standard: http://www.tdwg.org/standards/450
This version: http://rs.tdwg.org/dwc/doc/list/2026-09-17
Latest version: http://rs.tdwg.org/dwc/doc/list/
Previous version: http://rs.tdwg.org/dwc/doc/list/2026-05-26
Replaced by: http://rs.tdwg.org/dwc/doc/list/2026-09-17
Abstract: Darwin Core is standard for transmitting information about biodiversity. This document lists all terms in namespaces currently in or borrowed by the vocabulary.
Contributors: John Wieczorek (VertNet), Peter Desmet (Instituut voor Natuur- en Bosonderzoek (INBO)), Steve Baskauf (Vanderbilt University Libraries), Tim Robertson (Global Biodiversity Information Facility), Markus Döring (Global Biodiversity Information Facility), Quentin Groom (Botanic Garden Meise), Stijn Van Hoey (Instituut voor Natuur- en Bosonderzoek (INBO)), David Bloom (VertNet), Paula Zermoglio (Instituto de Investigaciones en Recursos Naturales, Agroecología y Desarrollo Rural (IRNAD), UNRN-CONICET), Robert Guralnick (University of Florida, Florida Museum of Natural History), John Deck (Genomic Biodiversity Working Group), Gail Kampmeier (Illinois Natural History Survey), Dave Vieglais (KU Natural History Museum), Renato De Giovanni (Centro de Referência em Informação Ambiental), Campbell Webb (TDWG RDF/OWL Task Group), Paul J. Morris (Harvard University Herbaria/Museum of Comparative Zoölogy), Mark Schildhauer (National Center for Ecological Analysis and Synthesis), Sophia Ratcliffe (National Biodiversity Network Trust), Teresa J. Mayfield-Meyer (The University of New Mexico, Arctos), Christian Bölling (Museum für Naturkunde Berlin - Leibniz-Institut für Evolutions- und Biodiversitätsforschung), Laura Brenskelle (University of Florida), Kitty Emery (University of Florida), Michelle LeFebvre (University of Florida), Neill Wallis (University of Florida), Marie Elise Lecoq (GBIF France), Eric Kansa (Harvard University), Sarah Kansa (The Alexandria Archive Institute), Denné Reed (University of Texas at Austin), Yanina V. Sica (Yale University), Kate Ingenloff (Global Biodiversity Information Facility (GBIF)), Yi-Ming Gan (Royal Belgian Institute of Natural Sciences), Peter Brenton (Atlas of Living Australia, CSIRO), Wesley M. Hochachka (Cornell Lab of Ornithology), Zachary R. Kachian (Keller Science Action Center, Field Museum of Natural History), Robert D. Stevenson (Department of Biology, University of Massachusetts Boston), Anahita J. N. Kazem (German Centre for Integrative Biodiversity Research, Leipzig and Friedrich Schiller University, Jena), Dmitry Schigel (Global Biodiversity Information Facility (GBIF)), Tomomi Suwa (Keller Science Action Center, Field Museum of Natural History), Ramona L. Walls (University of Arizona), Walter Jetz (Yale University), Robert A. Morris (University of Massachusetts at Boston, USA), Gregor Hagedorn (JKI, Federal Research Institute for Cultivated Plants, Berlin, Germany), Annette Olson (American Association for the Advancement of Science), Vijay Barve (), Mihail Carausu (Danish Biodiversity Information Facility (DanBIF), Copenhagen, Denmark), Vishwas Chavan (Global Biodiversity Information Facility, Copenhagen, Denmark), José Cuadra (), Chris Freeland (Missouri Botanical Garden, St. Louis, USA), Patrick Leary (), Dimitry Mozzherin (Encyclopedia of Life, Woods Hole, USA), Greg Riccardi (Florida State University, Tallahassee, USA), Ivan Teage (), Dan Stowell (Queen Mary University of London), Edward Baker (Natural History Museum, London), Richard Pyle (Bernice P. Bishop Museum, Honolulu, HI, USA)
Creator: Darwin Core Maintenance Group
Bibliographic citation: Darwin Core Maintenance Group. 2026. Darwin Core List of Terms. Biodiversity Information Standards (TDWG). http://rs.tdwg.org/dwc/doc/list/2026-09-17

1 Introduction (Informative)

This document contains terms that are part of the most recent version of the Darwin Core vocabulary (http://rs.tdwg.org/version/dwc/2026-09-17).

This document provides a comprehensive list of terms, from multiple namespaces, that have ever been recommended for use in Darwin Core. The status of some terms, as noted in their metadata, is deprecated or superseded. Such terms should no longer be used. Terms from namespaces that contain only deprecated terms are not included in this document, but metadata about those terms can still be retrieved by dereferencing their IRIs.

For a simplified list that contains only the currently recommended terms, see the Darwin Core Quick Reference Guide.

1.1 Status of the content of this document

Sections 1 and 3 are non-normative.

Section 2 is normative.

In Section 4, the values of the Term IRI and Definition are normative. The values of Term Name are non-normative, although one can expect that the namespace abbreviation prefix is one commonly used for the term namespace. Label and the values of all other properties (such as Examples and Notes) are non-normative.

1.2 RFC 2119 key words

The key words “MUST”, “MUST NOT”, “REQUIRED”, “SHALL”, “SHALL NOT”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY”, and “OPTIONAL” in this document are to be interpreted as described in BCP 14 [RFC 2119] and [RFC 8174] when, and only when, they appear in all capitals, as shown here.

1.3 Namespace abbreviations

The following namespace abbreviations are used in this document:

abbreviation	IRI
ac:	http://rs.tdwg.org/ac/terms/
chrono:	http://rs.tdwg.org/chrono/terms/
chronoiri:	http://rs.tdwg.org/chrono/iri/
dwc:	http://rs.tdwg.org/dwc/terms/
dwciri:	http://rs.tdwg.org/dwc/iri/
dc:	http://purl.org/dc/elements/1.1/
dcterms:	http://purl.org/dc/terms/
eco:	http://rs.tdwg.org/eco/terms/
ecoiri:	http://rs.tdwg.org/eco/iri/

2 Use of Terms

Due to the requirements of Section 1.4.3 of the Darwin Core RDF Guide, properties in the chronoiri:, dwciri: and ecoiri: namespaces MUST be used with IRI values. Values for properties in the chrono:, dwc:, eco: and dc: namespaces are generally expected to have string literal values. Values for properties in the ac and dcterms: namespaces will depend on the details of the individual terms. See Section 3 of the Darwin Core RDF Guide for details.

3 Term indices

3.1 Index By Term Name

(See also 3.2 Index By Label)

Classes

Record level

Dublin Core legacy namespace

dc:language | dc:type

Dublin Core terms namespace

Agent

dwc:agentID | dwc:agentRemarks | dwc:agentType

Assertion

Bibliographic Resource

dwc:bibliographicIdentifier | dwc:bibliographicIdentifierType | dwc:referenceID | dwc:referenceRemarks | dwc:referenceType

Event

Geological Context

Identification

Location

Material Entity

Material Sample

dwc:materialSampleID

Measurement or Fact

Media

No properties are currently organized in this class.

Molecular Protocol

dwc:assayType | dwc:molecularProtocolID

Nucleotide Analysis

dwc:rawTotalReadCount | dwc:readCount

Nucleotide Sequence

dwc:nucleotideSequenceRemarks | dwc:processedTotalReadCount | dwc:sequence

Occurrence

Organism

Organism Interaction

dwc:organismInteractionDescription | dwc:organismInteractionID | dwc:organismInteractionType

Protocol

dwc:protocolDescription | dwc:protocolID | dwc:protocolReferences | dwc:protocolRemarks | dwc:protocolType

Provenance

ac:fundingAttribution | dwc:fundingAttributionID | dwc:projectID | dwc:projectTitle | dwc:provenanceID

Resource Relationship

Taxon

Usage Policy

dwc:usagePolicyID

IRI-value terms

3.2 Index By Label

(See also 3.1 Index By Term Name)

Classes

Record level

Dublin Core legacy namespace

Language | Type

Dublin Core terms namespace

Agent

Agent ID | Agent Remarks | Agent Type

Assertion

Bibliographic Resource

Bibliographic Identifier | Bibliographic Identifier Type | Reference ID | Reference Remarks | Reference Type

Event

Geological Context

Identification

Location

Material Entity

Material Sample

Material Sample ID

Measurement or Fact

Media

No properties are currently organized in this class.

Molecular Protocol

Assay Type | Molecular Protocol ID

Nucleotide Analysis

Raw Total Read Count | Read Count

Nucleotide Sequence

Nucleotide Sequence Remarks | Processed Total Read Count | Sequence

Occurrence

Organism

Organism Interaction

Organism Interaction Description | Organism Interaction ID | Organism Interaction Type

Protocol

Protocol Description | Protocol ID | Protocol References | Protocol Remarks | Protocol Type

Provenance

Funding Attribution | Funding Attribution ID | Project ID | Project Title | Provenance ID

Resource Relationship

Taxon

Usage Policy

Usage Policy ID

IRI-value terms

4 Vocabulary

Term Name ecoiri:absentTaxa
Term IRI	http://rs.tdwg.org/eco/iri/absentTaxa
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/absentTaxa-2026-09-17
Label	Absent Taxa
Definition	A taxon reported absent during an eco:Survey.
Notes	Absences can be reported at any taxonomic level. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:absentTaxa
Term IRI	http://rs.tdwg.org/eco/terms/absentTaxa
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/absentTaxa-2026-09-17
Label	Absent Taxa
Definition	A list (concatenated and separated) of taxa reported absent during an eco:Survey.
Notes	Absences can be reported at any taxonomic level. This term refers to the list of taxa within an eco:targetTaxonomicScope that were not detected in an eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:abundanceCap
Term IRI	http://rs.tdwg.org/eco/terms/abundanceCap
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/abundanceCap-2026-09-17
Label	Abundance Cap
Definition	The reported maximum number of dwc:Occurrences matching an eco:SurveyTarget.
Examples	`300` `700`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:acceptedNameUsage
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsage-2025-06-12
Label	Accepted Name Usage
Definition	The full name, with authorship and date information if known, of the currently valid (zoological) or accepted (botanical) dwc:Taxon.
Notes	The full scientific name, with authorship and date information if known, of the accepted (botanical) or valid (zoological) name in cases where the provided dwc:scientificName is considered by the reference indicated in the dwc:nameAccordingTo property, or of the content provider, to be a synonym or misapplied name. When applied to a dwc:Organism or dwc:Occurrence, this term should be used in cases where a content provider regards the provided dwc:scientificName to be inconsistent with the taxonomic perspective of the content provider. For example, there are many discrepancies within specimen collections and observation datasets between the recorded name (e.g., the most recent identification from an expert who examined a specimen, or a field identification for an observed dwc:Organism), and the name asserted by the content provider to be taxonomically accepted.
Examples	`Tamias minimus` (valid name for `Eutamias minimus`)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:acceptedNameUsageID
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/acceptedNameUsageID-2023-06-28
Label	Accepted Name Usage ID
Definition	An identifier for the name usage (documented meaning of the name according to a source) of the currently valid (zoological) or accepted (botanical) taxon.
Notes	This term should be used for synonyms or misapplied names to refer to the dwc:taxonID of a dwc:Taxon record that represents the accepted (botanical) or valid (zoological) name. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:acceptedScientificName
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedScientificName
Modified	2009-09-21
Label	Accepted Scientific Name
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedNameUsage
Definition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:acceptedScientificNameID
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Modified	2009-08-24
Label	Accepted Scientific Name ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Definition	A unique identifier for the acceptedScientificName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:AcceptedTaxon
Term IRI	http://rs.tdwg.org/dwc/terms/AcceptedTaxon
Modified	2009-04-24
Label	Accepted Taxon
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Definition	The currently valid (zoological) or accepted (botanical) name for the ScientificName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:AcceptedTaxonID
Term IRI	http://rs.tdwg.org/dwc/terms/AcceptedTaxonID
Modified	2009-04-24
Label	Accepted Taxon ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Definition	A global unique identifier for the parent to the AcceptedTaxon.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:acceptedTaxonID
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedTaxonID
Modified	2009-09-21
Label	Accepted Taxon ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedNameUsageID
Definition	An identifier for the name of the currently valid (zoological) or accepted (botanical) taxon. See acceptedTaxon.
Notes	Example: "8fa58e08-08de-4ac1-b69c-1235340b7001"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:acceptedTaxonName
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedTaxonName
Modified	2009-07-06
Label	Accepted Taxon Name
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedScientificName
Definition	The currently valid (zoological) or accepted (botanical) name for the scientificName.
Notes	Example: "Tamias minimus" valid name for "Eutamias minimus"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:acceptedTaxonNameID
Term IRI	http://rs.tdwg.org/dwc/terms/acceptedTaxonNameID
Modified	2009-07-06
Label	Accepted Taxon Name ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/acceptedScientificNameID
Definition	A unique identifier for the acceptedTaxonName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:AccessConstraints
Term IRI	http://rs.tdwg.org/dwc/terms/AccessConstraints
Modified	2009-09-21
Label	Access Constraints
	This term is deprecated and should no longer be used.
Is replaced by	http://purl.org/dc/terms/accessRights
Definition	A description of constraints on the use of the data as shared or access to further data that is not shared.
Notes	Example: "not-for-profit use only".
ABCD equivalence	DataSets/DataSet/Units/Unit/IPRStatements
Type	Property

Term Name dcterms:accessRights
Term IRI	http://purl.org/dc/terms/accessRights
Modified	2023-06-28
Term version IRI	http://dublincore.org/usage/terms/history/#accessRights-002
Label	Access Rights
Definition	Information about who can access the resource or an indication of its security status.
Notes	Access Rights may include information regarding access or restrictions based on privacy, security, or other policies.
Examples	`not-for-profit use only` (string literal example) `https://www.fieldmuseum.org/field-museum-natural-history-conditions-and-suggested-norms-use-collections-data-and-images` (URI example)
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:accordingTo
Term IRI	http://rs.tdwg.org/dwc/terms/accordingTo
Modified	2020-08-06
Label	According To
	This term is deprecated and should no longer be used.
Definition	Abstract term to attribute information to a source.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:accuracy
Term IRI	http://rs.tdwg.org/dwc/terms/accuracy
Modified	2009-04-24
Label	Accuracy
	This term is deprecated and should no longer be used.
Definition	Abstract term to capture error information about a measurement or fact.
ABCD equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property

Term Name dcterms:Agent
Term IRI	http://purl.org/dc/terms/Agent
Modified	2026-05-26
Term version IRI	http://dublincore.org/usage/terms/history/#Agent-001
Label	Agent
Definition	A resource that acts or has the power to act.
Notes	A person, group, organization, machine, software or other entity that can act. Membership in the dcterms:Agent class is determined by the capacity to act, even if not doing so in a specific context. To act: To participate in an event or process by contributing through behavior, operation, or an effect resulting from active participation — regardless of whether that contribution is intentional, volitional, or conscious.
Examples	`a person` `a team of participants on an expedition` `a funding agency` `a particular bioacoustic monitoring installation` `a software instance` `a particular camera trap`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:agentID
Term IRI	http://rs.tdwg.org/dwc/terms/agentID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/agentID-2026-05-26
Label	Agent ID
Definition	An identifier for a dcterms:Agent.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:agentRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/agentRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/agentRemarks-2026-05-26
Label	Agent Remarks
Definition	Comments or notes about a dcterms:Agent.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:agentRoleOrder
Term IRI	http://rs.tdwg.org/dwc/terms/agentRoleOrder
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/agentRoleOrder-2026-05-26
Label	Agent Role Order
Definition	A numerical position of an AgentRole in a set of AgentRoles.
Notes	One could use dwc:agentRoleOrder to create an ordered list of collectors (agentRole = 'collector') for a dwc:MaterialEntity in a Darwin Core Data Package, for example. The first would have dwc:agentRoleOrder=1, the second would have dwc:agentRoleOrder=2.
Examples	`1` `2`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:agentType
Term IRI	http://rs.tdwg.org/dwc/terms/agentType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/agentType-2026-05-26
Label	Agent Type
Definition	A category that best matches the nature of a dcterms:Agent.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`person` `group` `organization` `camera`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:areNonTargetTaxaFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/areNonTargetTaxaFullyReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/areNonTargetTaxaFullyReported-2026-09-17
Label	Are Non-target Taxa Fully Reported
Definition	Every dwc:Occurrence that was outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) and detected during an eco:Survey, and that was detectable using the given protocol (given in eco:protocolDescriptions and dwc:samplingProtocol), was reported.
Notes	This term is meant to inform a user of the data whether there were non-target taxa that were detected, but left unreported. This term is only relevant if an eco:Survey used restricted search or open search methods and if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Within eco:Surveys that used either a restricted search or an open search method and declared a taxonomic scope, if all dwc:Occurrences that are not included within the target taxonomic scope and that were detected during an eco:Survey were reported, the value of this term should be 'true', otherwise the value of this term should be ‘false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_46
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:assayType
Term IRI	http://rs.tdwg.org/dwc/iri/assayType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/assayType-2026-05-26
Label	Assay Type (IRI)
Definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assayType
Term IRI	http://rs.tdwg.org/dwc/terms/assayType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assayType-2026-05-26
Label	Assay Type
Definition	A type of method used in a study to detect taxon/taxa of interest in a dwc:MaterialEntity.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`targeted` `metabarcoding` `other`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:Assertion
Term IRI	http://rs.tdwg.org/dwc/terms/Assertion
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Assertion-2026-05-26
Label	Assertion
Definition	A statement about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
ABCD equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionBy
Term IRI	http://rs.tdwg.org/dwc/terms/assertionBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionBy-2026-05-26
Label	Assertion By
Definition	A name for a dcterms:Agent responsible for making a dwc:Assertion.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey` `ChatGPT` `Notes From Nature` `ROV SuBastian`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:assertionBy
Term IRI	http://rs.tdwg.org/dwc/iri/assertionBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/assertionBy-2026-05-26
Label	Assertion By (IRI)
Definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionEffectiveDate
Term IRI	http://rs.tdwg.org/dwc/terms/assertionEffectiveDate
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionEffectiveDate-2026-09-17
Label	Assertion Effective Date
Definition	A date-time or time interval during which an asserted state or measurement was deemed to be in effect.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:assertionError
Term IRI	http://rs.tdwg.org/dwc/terms/assertionError
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionError-2026-05-26
Label	Assertion Error
Definition	A description of the potential error associated with a dwc:assertionValue.
Examples	`0.01` `normal distribution with variation of 2 m`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionID
Term IRI	http://rs.tdwg.org/dwc/terms/assertionID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionID-2026-05-26
Label	Assertion ID
Definition	An identifier for a dwc:Assertion.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionMadeDate
Term IRI	http://rs.tdwg.org/dwc/terms/assertionMadeDate
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionMadeDate-2026-05-26
Label	Assertion Made Date
Definition	A date on which a dwc:Assertion was created.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionProtocols
Term IRI	http://rs.tdwg.org/dwc/terms/assertionProtocols
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionProtocols-2026-05-26
Label	Assertion Protocols
Definition	Names of, references to, or descriptions of dwc:Protocols used in making a dwc:Assertion.
ABCD equivalence	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionReferences
Term IRI	http://rs.tdwg.org/dwc/terms/assertionReferences
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionReferences-2026-05-26
Label	Assertion References
Definition	A list (concatenated and separated) of dcterms:BibliographicResources associated with a dwc:Assertion.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/assertionRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionRemarks-2026-05-26
Label	Assertion Remarks
Definition	Comments or notes about a dwc:Assertion.
Examples	`tip of tail missing` `error determined by independently calibrated measurements` `error provided is from the manufacturer’s standard instrument specification`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionType
Term IRI	http://rs.tdwg.org/dwc/terms/assertionType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionType-2026-05-26
Label	Assertion Type
Definition	A category that best matches the nature of a dwc:Assertion.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tailLength` `waterTemperature` `trapLineLength` `surveyArea` `trapType`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:assertionType
Term IRI	http://rs.tdwg.org/dwc/iri/assertionType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/assertionType-2026-05-26
Label	Assertion Type (IRI)
Definition	A category that best matches the nature of a dwc:Assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionUnit
Term IRI	http://rs.tdwg.org/dwc/terms/assertionUnit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionUnit-2026-05-26
Label	Assertion Unit
Definition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. For units that are composed of multiple parts, use the patterns as given in "A Primer for Communicating Mathematics via Plain Text" (https://cse.sc.edu/~fenner/latex-ASCII.pdf) by Stephen Fenner (e.g., `g/cm^3` for grams per cubic centimeter). For other units, provide the value as a recognizable standard (e.g., '%') or written out in full and in the plural (e.g., `individuals`). It is fine to provide non-SI units in the original language of the dataset. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`m` `s` `g` `ml` `%` `individuals`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:assertionUnit
Term IRI	http://rs.tdwg.org/dwc/iri/assertionUnit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/assertionUnit-2026-05-26
Label	Assertion Unit (IRI)
Definition	A unit associated with the value in dwc:assertionValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.ontology-of-units-of-measure.org for SI units, derived units, or other non-SI units accepted for use within the SI. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://www.ontology-of-units-of-measure.org/resource/om-2/metre` `http://www.ontology-of-units-of-measure.org/resource/om-2/second-Time`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:assertionValue
Term IRI	http://rs.tdwg.org/dwc/iri/assertionValue
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/assertionValue-2026-05-26
Label	Assertion Value (IRI)
Definition	An asserted value.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:assertionValue
Term IRI	http://rs.tdwg.org/dwc/terms/assertionValue
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/assertionValue-2026-05-26
Label	Assertion Value
Definition	An asserted value.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`45` `20` `1` `14.5` `UV-light` `Hamon grab`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:associatedMedia
Term IRI	http://rs.tdwg.org/dwc/terms/associatedMedia
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedMedia-2026-09-17
Label	Associated Media
Definition	A list (concatenated and separated) of associated ac:Media resources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`https://arctos.database.museum/media/10520962 \| https://arctos.database.museum/media/10520964` `https://inaturalist-open-data.s3.amazonaws.com/photos/606894376/original.jpg`
ABCD equivalence	DataSets/DataSet/Units/Unit/MultimediaObjects
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:associatedOccurrences
Term IRI	http://rs.tdwg.org/dwc/terms/associatedOccurrences
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedOccurrences-2023-06-28
Label	Associated Occurrences
Definition	A list (concatenated and separated) of identifiers of other dwc:Occurrence records and their associations to this dwc:Occurrence.
Notes	This term can be used to provide a list of associations to other dwc:Occurrences. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"parasite collected from":"https://arctos.database.museum/guid/MSB:Mamm:215895?seid=950760"` `"encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3175067" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177393" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177394" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3177392" \| "encounter previous to":"http://arctos.database.museum/guid/MSB:Mamm:292063?seid=3609139"`
ABCD equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:associatedOrganisms
Term IRI	http://rs.tdwg.org/dwc/terms/associatedOrganisms
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedOrganisms-2023-06-28
Label	Associated Organisms
Definition	A list (concatenated and separated) of identifiers of other dwc:Organisms and the associations of this dwc:Organism to each of them.
Notes	This term can be used to provide a list of associations to other dwc:Organisms. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"sibling of":"http://arctos.database.museum/guid/DMNS:Mamm:14171"` `"parent of":"http://arctos.database.museum/guid/MSB:Mamm:196208" \| "parent of":"http://arctos.database.museum/guid/MSB:Mamm:196523" \| "sibling of":"http://arctos.database.museum/guid/MSB:Mamm:142638"`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Term Name dwc:associatedReferences
Term IRI	http://rs.tdwg.org/dwc/terms/associatedReferences
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedReferences-2026-09-17
Label	Associated References
Definition	A list (concatenated and separated) of associated dcterms:BibliographicResources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). Note that the intended usage of the term dcterms:references in Darwin Core is to point to the definitive source representation of the resource, if one is available. Note also that the intended usage of dcterms:bibliographicCitation in Darwin Core is to provide the preferred way to cite the resource itself.
Examples	`Christopher J. Conroy, Jennifer L. Neuwald. 2008. Phylogeographic study of the California vole, Microtus californicus Journal of Mammalogy, 89(3):755-767.` `Steven R. Hoofer and Ronald A. Van Den Bussche. 2001. Phylogenetic Relationships of Plecotine Bats and Allies Based on Mitochondrial Ribosomal Sequences. Journal of Mammalogy 82(1):131-137. \| Walker, Faith M., Jeffrey T. Foster, Kevin P. Drees, Carol L. Chambers. 2014. Spotted bat (Euderma maculatum) microsatellite discovery using illumina sequencing. Conservation Genetics Resources.` `https://doi.org/10.3897/BDJ.14.e177525`
ABCD equivalence	DataSets/DataSet/Units/Unit/UnitReferences
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:associatedSequences
Term IRI	http://rs.tdwg.org/dwc/terms/associatedSequences
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedSequences-2026-05-26
Label	Associated Sequences
Definition	A list (concatenated and separated) of dcterms:BibliographicResources for dwc:NucleotideSequences associated with a dwc:MaterialEntity.
Examples	`http://www.ncbi.nlm.nih.gov/nuccore/U34853.1` `http://www.ncbi.nlm.nih.gov/nuccore/GU328060 \| http://www.ncbi.nlm.nih.gov/nuccore/AF326093`
ABCD equivalence	DataSets/DataSet/Units/Unit/Sequences/Sequence/ID-in-Database + constant
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:associatedTaxa
Term IRI	http://rs.tdwg.org/dwc/terms/associatedTaxa
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/associatedTaxa-2023-06-28
Label	Associated Taxa
Definition	A list (concatenated and separated) of identifiers or names of dwc:Taxon records and the associations of this dwc:Occurrence to each of them.
Notes	This term can be used to provide a list of associations to dwc:Taxon records other than the one defined in the dwc:Occurrence. Note that the dwc:ResourceRelationship class is an alternative means of representing associations, and with more detail. This term is not apt for establishing relationships between dwc:Taxon records, only between specific dwc:Occurrences of a dwc:Organism with other dwc:Taxon records. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`"host":"Quercus alba"` `"host":"gbif.org/species/2879737"` `"parasitoid of":"Cyclocephala signaticollis" \| "predator of":"Apis mellifera"`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:basionym
Term IRI	http://rs.tdwg.org/dwc/terms/basionym
Modified	2009-09-21
Label	Basionym
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/originalNameUsage
Definition	The basionym (botany) or basonym (bacteriology) of the scientificName.
Notes	Example: "Pinus abies"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:basionymID
Term IRI	http://rs.tdwg.org/dwc/terms/basionymID
Modified	2009-09-21
Label	Basionym ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/originalNameUsageID
Definition	A unique identifier for the basionym (botany) or basonym (bacteriology) of the scientificName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:basisOfRecord
Term IRI	http://rs.tdwg.org/dwc/terms/basisOfRecord
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/basisOfRecord-2023-09-13
Label	Basis Of Record
Definition	The specific nature of the data record.
Notes	Recommended best practice is to use a controlled vocabulary such as the set of local names of the identifiers for classes in Darwin Core.
Examples	`MaterialEntity` `PreservedSpecimen` `FossilSpecimen` `LivingSpecimen` `MaterialSample` `Event` `HumanObservation` `MachineObservation` `Taxon` `Occurrence` `MaterialCitation`
ABCD equivalence	DataSets/DataSet/Units/Unit/RecordBasis
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2009-12-07_2
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:bed
Term IRI	http://rs.tdwg.org/dwc/terms/bed
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/bed-2023-09-13
Label	Bed
Definition	The full name of the lithostratigraphic bed from which the dwc:MaterialEntity was collected.
Examples	`Harlem coal`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:behavior
Term IRI	http://rs.tdwg.org/dwc/iri/behavior
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/behavior-2026-05-26
Label	Behavior (IRI)
Definition	A behavior shown by a dwc:Organism.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:behavior
Term IRI	http://rs.tdwg.org/dwc/terms/behavior
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/behavior-2026-05-26
Label	Behavior
Definition	A behavior shown by a dwc:Organism.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`roosting` `foraging` `running`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dcterms:bibliographicCitation
Term IRI	http://purl.org/dc/terms/bibliographicCitation
Modified	2023-06-28
Term version IRI	http://dublincore.org/usage/terms/history/#bibliographicCitation-002
Label	Bibliographic Citation
Definition	A bibliographic reference for the resource.
Notes	From Dublin Core, "Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible." The intended usage of this term in Darwin Core is to provide the preferred way to cite the resource itself - "how to cite this record". Note that the intended usage of dcterms:references in Darwin Core, by contrast, is to point to the definitive source representation of the resource - "where to find the as-close-to-original reference", if one is available.
Examples	`Museum of Vertebrate Zoology, UC Berkeley. MVZ Mammal Collection (Arctos). Record ID: http://arctos.database.museum/guid/MVZ:Mamm:165861?seid=101356. Source: http://ipt.vertnet.org:8080/ipt/resource.do?r=mvz_mammal.` (Occurrence example) `https://www.gbif.org/species/2439608 Source: GBIF Taxonomic Backbone` (Taxon example) `Rand, K.M., Logerwell, E.A. The first demersal trawl survey of benthic fish and invertebrates in the Beaufort Sea since the late 1970s. Polar Biol 34, 475–488 (2011). https://doi.org/10.1007/s00300-010-0900-2` (Event example)
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:bibliographicIdentifier
Term IRI	http://rs.tdwg.org/dwc/terms/bibliographicIdentifier
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/bibliographicIdentifier-2026-09-17
Label	Bibliographic Identifier
Definition	A number or symbol to uniquely identify a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a globally unique identifier issued by recognizable authority (e.g., International ISBN Agency, International DOI Foundation).
Examples	`978-0565095024` `10998406` `10.1046/j.1420-9101.1997.10010039.x`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:bibliographicIdentifierType
Term IRI	http://rs.tdwg.org/dwc/terms/bibliographicIdentifierType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/bibliographicIdentifierType-2026-09-17
Label	Bibliographic Identifier Type
Definition	A code that best matches the nature of an identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary of identifier issuers. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`ISBN` `DOI` `ISSN` `OCN`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:bibliographicIdentifierType
Term IRI	http://rs.tdwg.org/dwc/iri/bibliographicIdentifierType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/bibliographicIdentifierType-2026-09-17
Label	Bibliographic Identifier Type (IRI)
Definition	A code that best matches the nature of an identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary of identifier issuers. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dcterms:BibliographicResource
Term IRI	http://purl.org/dc/terms/BibliographicResource
Modified	2026-05-26
Term version IRI	http://dublincore.org/usage/terms/history/#BibliographicResource-001
Label	Bibliographic Resource
Definition	A book, article, or other documentary resource.
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:binomial
Term IRI	http://rs.tdwg.org/dwc/terms/binomial
Modified	2009-04-24
Label	Binomial
	This term is deprecated and should no longer be used.
Definition	The combination of genus and first (species) epithet of the scientificName.
Notes	Example: "Ctenomys sociabilis"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Synecology/AssociatedTaxa/TaxonIdentified/ScientificName/FullScientificNameString
Type	Property

Term Name dwc:caste
Term IRI	http://rs.tdwg.org/dwc/terms/caste
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/caste-2026-05-26
Label	Caste
Definition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`queen` `male alate` `intercaste` `minor worker` `soldier` `ergatoid`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:caste
Term IRI	http://rs.tdwg.org/dwc/iri/caste
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/caste-2026-05-26
Label	Caste (IRI)
Definition	A social caste of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary that aligns best with a dwc:Taxon. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:catalogNumber
Term IRI	http://rs.tdwg.org/dwc/terms/catalogNumber
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/catalogNumber-2026-05-26
Label	Catalog Number
Definition	An identifier (preferably unique) for a resource within a collection.
Examples	`145732` `145732a` `2008.1334` `R-4313`
ABCD equivalence	DataSets/DataSet/Units/Unit/UnitID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:CatalogNumberNumeric
Term IRI	http://rs.tdwg.org/dwc/terms/CatalogNumberNumeric
Modified	2009-04-24
Label	Catalog Number Numeric
	This term is deprecated and should no longer be used.
Definition	The numeric value of the catalogNumber, used to facilitate numerical sorting and searching by ranges.
ABCD equivalence	DataSets/DataSet/Units/Unit/UnitIDNumeric
Type	Property

Term Name dwc:causeOfDeath
Term IRI	http://rs.tdwg.org/dwc/terms/causeOfDeath
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/causeOfDeath-2025-06-12
Label	Cause Of Death
Definition	An indication of the known or suspected cause of death of a dwc:Organism.
Notes	The cause may be due to natural causes (e.g., disease, predation), human-related activities (e.g., roadkill, pollution), or other environmental factors (e.g., extreme weather events).
Examples	`trap` `poison` `starvation` `drowning` `shooting` `old age` `vehicle collision` `disease` `herbicide` `burning` `infanticide`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:chemistryRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/chemistryRemarks
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/chemistryRemarks-2026-09-17
Label	Chemistry Remarks
Definition	General remarks about the chemical and isotopic composition of a dwc:GeologicalMaterial.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name chrono:ChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/ChronometricAge
Modified	2021-02-21
Term version IRI	http://rs.tdwg.org/chrono/terms/version/ChronometricAge-2021-02-21
Label	Chronometric Age
Definition	An approximation of a temporal position (in the sense conveyed by https://www.w3.org/TR/owl-time/#time:TemporalPosition) that is supported via evidence.
Notes	The age of a specimen and how this age is known, whether by a dating assay, a relative association with dated material, or legacy collections information.
Examples	`An age range associated with a specimen derived from an AMS dating assay applied to an oyster shell in the same stratum` `An age range associated with a specimen derived from a ceramics analysis based on other materials found in the same stratum` `A maximum age associated with a specimen derived from K-Ar dating applied to a proximal volcanic tuff found stratigraphically below the specimen` `An age range of a specimen based on its biostratigraphic context` `An age of a specimen based on what is reported in legacy collections data`.
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-RadiometricDates
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name chronoiri:chronometricAgeConversionProtocol
Term IRI	http://rs.tdwg.org/chrono/iri/chronometricAgeConversionProtocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/chronometricAgeConversionProtocol-2026-05-26
Label	Chronometric Age Conversion Protocol (IRI)
Definition	The method used to convert the chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name chrono:chronometricAgeConversionProtocol
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeConversionProtocol
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeConversionProtocol-2025-06-12
Label	Chronometric Age Conversion Protocol
Definition	The method used for converting the chrono:uncalibratedChronometricAge into a chronometric age in years, as captured in the chrono:earliestChronometricAge, chrono:earliestChronometricAgeReferenceSystem, chrono:latestChronometricAge, and chrono:latestChronometricAgeReferenceSystem fields.
Notes	For example, calibration of conventional radiocarbon age or the currently accepted age range of a cultural or geological period. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`INTCAL13` `sequential 6 phase Bayesian model and IntCal13 calibration`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-Method
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chronoiri:chronometricAgeDeterminedBy
Term IRI	http://rs.tdwg.org/chrono/iri/chronometricAgeDeterminedBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/chronometricAgeDeterminedBy-2026-05-26
Label	Chronometric Age Determined By (IRI)
Definition	A person, group, or organization that determined the chrono:ChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name chrono:chronometricAgeDeterminedBy
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedBy
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeDeterminedBy-2025-06-12
Label	Chronometric Age Determined By
Definition	A list (concatenated and separated) of names of people, groups, or organizations who determined the chrono:ChronometricAge.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Michelle LeFebvre \| Neill Wallis`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-Identifiers
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:chronometricAgeDeterminedDate
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeDeterminedDate
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeDeterminedDate-2025-06-12
Label	Chronometric Age Determined Date
Definition	The date on which the chrono:ChronometricAge was determined.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-0600` (8 Mar 1963 at 2:07pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 8:40am UTC) `2018-08-29T15:19` (3:19pm local time on 29 August 2018) `1809-02-12` (some time during 12 February 1809) `1906-06` (some time in June 1906) `1971` (some time in the year 1971)
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-RadiometricDate-AnalysisDateTime
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:chronometricAgeID
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeID
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeID-2025-06-12
Label	Chronometric Age ID
Definition	An identifier for the set of information associated with a chrono:ChronometricAge.
Notes	May be a global unique identifier or an identifier specific to the dataset. This can be used to link this record to another repository where more information about the dataset is shared.
Examples	`https://www.canadianarchaeology.ca/samples/70673`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:chronometricAgeProtocol
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeProtocol
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeProtocol-2025-06-12
Label	Chronometric Age Protocol
Definition	A description of or reference to the methods used to determine the chrono:ChronometricAge.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`radiocarbon AMS` `K-Ar dates for the lower most marker tuff` `historic documentation` `ceramic seriation`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-Method
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chronoiri:chronometricAgeProtocol
Term IRI	http://rs.tdwg.org/chrono/iri/chronometricAgeProtocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/chronometricAgeProtocol-2026-05-26
Label	Chronometric Age Protocol (IRI)
Definition	A method used to determine the chrono:ChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name chrono:chronometricAgeReferences
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeReferences
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeReferences-2025-06-12
Label	Chronometric Age References
Definition	A list (concatenated and separated) of identifiers (publication, bibliographic reference, global unique identifier, URI) of literature associated with the chrono:ChronometricAge.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( \| ).
Examples	`Pluckhahn, Thomas J., Neill J. Wallis, and Victor D. Thompson. 2020 The History and Future of Migrationist Explanation in the Archaeology of the Eastern Woodlands: A Review and Case Study of the Woodland Period Gulf Coast. Journal of Archaeological Research. https://doi.org/10.1007/s10814-019-09140-x`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-MeasurementOrFactReference
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:chronometricAgeRemarks
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeRemarks
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeRemarks-2025-06-12
Label	Chronometric Age Remarks
Definition	Notes or comments about the chrono:ChronometricAge.
Examples	`Beta Analytic number: 323913 \| One of the Crassostrea virginica right valve specimens from North Midden Feature 17 was chosen for AMS dating, but it is unclear exactly which specimen it was.`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-DatingComment
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:chronometricAgeUncertaintyInYears
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyInYears
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeUncertaintyInYears-2026-05-26
Label	Chronometric Age Uncertainty In Years
Definition	The temporal uncertainty of the chrono:earliestChronometricAge and chrono:latestChronometricAge in years.
Notes	The expected unit for this field is years. The value in this field is number of years before and after the values given in the chrono:earliestChronometricAge and chrono:latestChronometricAge fields within which the actual values are estimated to be.
Examples	`100`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name chrono:chronometricAgeUncertaintyMethod
Term IRI	http://rs.tdwg.org/chrono/terms/chronometricAgeUncertaintyMethod
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/chronometricAgeUncertaintyMethod-2025-06-12
Label	Chronometric Age Uncertainty Method
Definition	The method used to generate the value of chrono:chronometricAgeUncertaintyInYears.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`2-sigma calibrated range` `Half of 95% confidence interval`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-Method
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chronoiri:chronometricAgeUncertaintyMethod
Term IRI	http://rs.tdwg.org/chrono/iri/chronometricAgeUncertaintyMethod
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/chronometricAgeUncertaintyMethod-2026-05-26
Label	Chronometric Age Uncertainty Method (IRI)
Definition	The method used to generate the value of chrono:chronometricAgeUncertaintyInYears.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name dwc:class
Term IRI	http://rs.tdwg.org/dwc/terms/class
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/class-2023-06-28
Label	Class
Definition	The full scientific name of the class in which the dwc:Taxon is classified.
Examples	`Mammalia` `Hepaticopsida`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = classis
Type	Property

Term Name dwc:classificationCodes
Term IRI	http://rs.tdwg.org/dwc/terms/classificationCodes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/classificationCodes-2026-09-17
Label	Classification Codes
Definition	A list (concatenated and separated) of codes that each identifies a name from a classification system applied to a dwc:GeologicalMaterial.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`71.02.02a.01` ("muscovite" in the Dana classification system) `9.AD.25` ("garnet group" in the Nickel-Strunz classification system) `75.01.03.01 \| 4.DA.05` ("quartz" the Dana classification system and "quartz group" in the Nickel-Strunz classification system)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:classificationSystem
Term IRI	http://rs.tdwg.org/dwc/terms/classificationSystem
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/classificationSystem-2026-09-17
Label	Classification System
Definition	A reference to the classification system in which an authoritative name or formal classification belongs.
Notes	Recommended best practice is to provide a formal citation or IRI. This term should not be confused with dwc:namePublishedIn as a classification system is not equivalent to a publication in which a taxon is first described. This term should not be confused with dwc:nameAccordingTo as a classification system is not equivalent to a publication or other source in which a specific taxon concept circumscription is defined or implied. This term should not be confused with dwc:nomenclaturalCode as a classification system is not equivalent to code of nomenclature, which states the rules for naming rather than an organized source of names. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Strunz, H., Nickel, E.H. (2001): Strunz Mineralogical Tables. Chemical-Structural Mineral Classification System. 9th edition. E. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart, ix + 870 p. (ISBN 3-510-65188-X)` `Gaines, R.V., Skinner, H.C.W., Foord, E.E., Mason, B., Rosenzweig, A. (1997): Dana's New Mineralogy: The System of Mineralogy of James Dwight Dana and Edward Salisbury Dana. 8th edition. John Wiley & Sons, New York, xlv + 1819 p. (ISBN 0-471-19310-0).` `https://kos.geospecimens.org/vocab/meteorite-classification` `Mammal Diversity Database. (2026). Mammal Diversity Database (Version 2.5) [Data set]. [Zenodo](https://zenodo.org/records/10595931). https://doi.org/10.5281/zenodo.17033774` `Index Fungorum. (2026). Index Fungorum electronic database. Royal Botanic Gardens, Kew. Retrieved August 17, 2026, from indexfungorum.org.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:classificationSystem
Term IRI	http://rs.tdwg.org/dwc/iri/classificationSystem
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/classificationSystem-2026-09-17
Label	Classification System (IRI)
Definition	A reference to the classification system in which an authoritative name or formal classification belongs.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:collectionCode
Term IRI	http://rs.tdwg.org/dwc/terms/collectionCode
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/collectionCode-2026-05-26
Label	Collection Code
Definition	A name, acronym, coden, or initialism identifying a collection.
Examples	`Mammals` `Hildebrandt` `EBIRD` `VP`
ABCD equivalence	DataSets/DataSet/Units/Unit/SourceID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:collectionID
Term IRI	http://rs.tdwg.org/dwc/terms/collectionID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/collectionID-2026-05-26
Label	Collection ID
Definition	An identifier for a collection.
Notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://scientific-collections.gbif.org/collection/fbd3ed74-5a21-4e01-b86a-33d36f032d9c`
ABCD equivalence	DataSets/DataSet/Units/Unit/SourceID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:compilationSourceTypes
Term IRI	http://rs.tdwg.org/eco/terms/compilationSourceTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/compilationSourceTypes-2026-09-17
Label	Compilation Source Types
Definition	The types of data sources contributing to the compilation reported.
Notes	This term is only relevant if an eco:Survey is a compilation in which one or more types of data sources were used. Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`museumSpecimens` `literature` `expertKnowledge \| localKnowledge`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:compilationSourceTypes
Term IRI	http://rs.tdwg.org/eco/iri/compilationSourceTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/compilationSourceTypes-2026-09-17
Label	Compilation Source Types
Definition	The type of data source contributing to the compilation reported.
Notes	This term is only relevant if the eco:Survey is a compilation in which one or more types of data sources were used. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:compilationTypes
Term IRI	http://rs.tdwg.org/eco/terms/compilationTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/compilationTypes-2026-09-17
Label	Compilation Types
Definition	A statement specifying whether data reported are derived from sampling events, ancillary data compiled from other sources, or a combination of both.
Notes	This term is only relevant if an eco:Survey is an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`samplingEvents` `compilationOfExistingSourcesAndSamplingEvents` `compilationOfExistingSources` `compilationOfExistingSourcesAndSamplingEvents \| compilationOfExistingSources`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:compilationTypes
Term IRI	http://rs.tdwg.org/eco/iri/compilationTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/compilationTypes-2026-09-17
Label	Compilation Types
Definition	A statement specifying whether data reported are derived from sampling events, ancillary data compiled from other sources, or a combination of both.
Notes	This term is only relevant if the eco:Survey is an inventory. Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:continent
Term IRI	http://rs.tdwg.org/dwc/terms/continent
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/continent-2023-06-28
Label	Continent
Definition	The name of the continent in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Africa` `Antarctica` `Asia` `Europe` `North America` `Oceania` `South America`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Continent
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:coordinatePrecision
Term IRI	http://rs.tdwg.org/dwc/terms/coordinatePrecision
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/coordinatePrecision-2023-06-28
Label	Coordinate Precision
Definition	A decimal representation of the precision of the coordinates given in the dwc:decimalLatitude and dwc:decimalLongitude.
Examples	`0.00001` (normal GPS limit for decimal degrees) `0.000278` (nearest second) `0.01667` (nearest minute) `1.0` (nearest degree)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/ISOAccuracy or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLong/AccuracyStatement
Type	Property

Term Name dwc:coordinateUncertaintyInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/coordinateUncertaintyInMeters
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/coordinateUncertaintyInMeters-2026-05-26
Label	Coordinate Uncertainty In Meters
Definition	A horizontal distance (in meters) from a given dwc:decimalLatitude and dwc:decimalLongitude describing the smallest circle containing the whole of the dcterms:Location. Zero is not a valid value for this term.
Notes	Leave the value empty if the uncertainty is unknown, cannot be estimated, or is not applicable (because there are no coordinates). Zero is not a valid value for this term.
Examples	`30` (reasonable lower limit on or after 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `100` (reasonable lower limit before 2000-05-01 of a GPS reading under good conditions if the actual precision was not recorded at the time) `71` (uncertainty for a UTM coordinate having 100 meter precision and a known spatial reference system)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinateErrorDistanceInMeters
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:country
Term IRI	http://rs.tdwg.org/dwc/terms/country
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/country-2023-06-28
Label	Country
Definition	The name of the country or major administrative unit in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Denmark` `Colombia` `España`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Country/Name
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:countryCode
Term IRI	http://rs.tdwg.org/dwc/terms/countryCode
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/countryCode-2026-05-26
Label	Country Code
Definition	The standard code for the country in which the dcterms:Location occurs.
Notes	Recommended best practice is to use an ISO 3166-1-alpha-2 country code, or 'ZZ' (for an unknown location or a location unassignable to a single country code), or 'XZ' (for the high seas beyond national jurisdictions). Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`AR` `SV` `XZ` `ZZ`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Country/ISO3166Code
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:county
Term IRI	http://rs.tdwg.org/dwc/terms/county
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/county-2023-06-28
Label	Second Order Division
Definition	The full, unabbreviated name of the next smaller administrative region than stateProvince (county, shire, department, etc.) in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Missoula` `Los Lagos` `Mataró`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= County
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:cultivarEpithet
Term IRI	http://rs.tdwg.org/dwc/terms/cultivarEpithet
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/cultivarEpithet-2026-05-26
Label	Cultivar Epithet
Definition	Part of the name of a cultivar, cultivar group or grex that follows the dwc:scientificName.
Notes	According to the Rules of the Cultivated Plant Code, a cultivar name consists of a botanical name followed by a cultivar epithet. The value given as the dwc:cultivarEpithet should exclude any quotes. The term dwc:taxonRank should be used to indicate which type of cultivated plant name (e.g., cultivar, cultivar group, grex) is concerned. This epithet, including any enclosing apostrophes or suffix, should be provided in dwc:scientificName as well.
Examples	`King Edward` (for scientificName `Solanum tuberosum 'King Edward'` and taxonRank `cultivar`) `Mishmiense` (for scientificName `Rhododendron boothii Mishmiense Group` and taxonRank `cultivar group`) `Atlantis` (for scientificName `Paphiopedilum Atlantis grex` and taxonRank `grex`)
ABCD equivalence	http://rs.tdwg.org/abcd/terms/cultivarName or http://rs.tdwg.org/abcd/terms/cultivarGroupName or http://rs.tdwg.org/abcd/terms/breed (ABCD 3.0)
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:damageRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/damageRemarks
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/damageRemarks-2026-09-17
Label	Damage Remarks
Definition	A general description of any physical changes to a dwc:MaterialEntity that have negatively affected its value.
Notes	See Royce, K., Baars, C., & Viles, H. (2021). Defining Damage and Susceptibility, with Implications for Mineral Specimens and Objects: Introducing the Mineral Susceptibility Database. Studies in Conservation, 68(3), 298-317. https://doi.org/10.1080/00393630.2021.2015947
Examples	`Due to oxidation and hydration of the pyrite in the coal, the sample has largely decayed to a coal powder with some larger coal pieces \| Some terminations broken off \| Attached label not legible (or torn, or covered)`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:dataGeneralizations
Term IRI	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/dataGeneralizations-2023-06-28
Label	Data Generalizations
Definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Coordinates generalized from original GPS coordinates to the nearest half degree grid cell`.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:dataGeneralizations
Term IRI	http://rs.tdwg.org/dwc/iri/dataGeneralizations
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/dataGeneralizations-2025-07-10
Label	Data Generalizations (IRI)
Definition	Actions taken to make the shared data less specific or complete than in its original form. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:Dataset
Term IRI	http://rs.tdwg.org/dwc/terms/Dataset
Modified	2009-09-11
Label	Dataset
	This term is deprecated and should no longer be used.
Definition	The category of information pertaining to a logical set of records.
ABCD equivalence	DataSets/DataSet
Type	Class

Term Name dwc:datasetID
Term IRI	http://rs.tdwg.org/dwc/terms/datasetID
Modified	2017-10-06
Term version IRI	http://rs.tdwg.org/dwc/terms/version/datasetID-2017-10-06
Label	Dataset ID
Definition	An identifier for the set of data. May be a global unique identifier or an identifier specific to a collection or institution.
Examples	`b15d4952-7d20-46f1-8a3e-556a512b04c5`
ABCD equivalence	DataSets/DataSet/DataSetGUID
Type	Property

Term Name dwc:datasetName
Term IRI	http://rs.tdwg.org/dwc/terms/datasetName
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/datasetName-2026-05-26
Label	Dataset Name
Definition	A name of a source dataset.
Examples	`Grinnell Resurvey Mammals` `Lacey Ctenomys Recaptures`
ABCD equivalence	DataSets/DataSet/Units/Unit/SourceID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:dateIdentified
Term IRI	http://rs.tdwg.org/dwc/terms/dateIdentified
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/dateIdentified-2026-09-17
Label	Date Identified
Definition	The date on which the dwc:Identification was made.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Date/DateText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:day
Term IRI	http://rs.tdwg.org/dwc/terms/day
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/day-2023-06-28
Label	Day
Definition	The integer day of the month on which the dwc:Event occurred.
Examples	`9` `28`
ABCD equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Property

Term Name dwc:decimalLatitude
Term IRI	http://rs.tdwg.org/dwc/terms/decimalLatitude
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/decimalLatitude-2026-05-26
Label	Decimal Latitude
Definition	A geographic latitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are north of the Equator, negative values are south of it. Valid values lie between -90 and 90, inclusive.
Examples	`-41.0983423`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LatitudeDecimal
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:decimalLongitude
Term IRI	http://rs.tdwg.org/dwc/terms/decimalLongitude
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/decimalLongitude-2026-05-26
Label	Decimal Longitude
Definition	A geographic longitude (in decimal degrees, using the spatial reference system given in dwc:geodeticDatum) of a dcterms:Location.
Notes	Positive values are east of the Greenwich Meridian, negative values are west of it. Valid values lie between -180 and 180, inclusive.
Examples	`-121.1761111`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/LongitudeDecimal
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:degreeOfEstablishment
Term IRI	http://rs.tdwg.org/dwc/terms/degreeOfEstablishment
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/degreeOfEstablishment-2023-06-28
Label	Degree of Establishment
Definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `captive` `cultivated` `released` `failing` `casual` `reproducing` `established` `colonising` `invasive` `widespreadInvasive`
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_27
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:degreeOfEstablishment
Term IRI	http://rs.tdwg.org/dwc/iri/degreeOfEstablishment
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/degreeOfEstablishment-2025-07-10
Label	Degree of Establishment (IRI)
Definition	The degree to which a dwc:Organism survives, reproduces, and expands its range at the given place and time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcdoe/values/d003` `http://rs.tdwg.org/dwcdoe/values/d005`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_27
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:digitalSpecimenID
Term IRI	http://rs.tdwg.org/dwc/terms/digitalSpecimenID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/digitalSpecimenID-2026-05-26
Label	Digital Specimen ID
Definition	An identifier for a Digital Specimen resource.
Notes	A Digital Specimen is defined in https://doi.org/10.3897/rio.7.e67379. A dwc:digitalSpecimenID is intended to uniquely and persistently identify a Digital Specimen. Recommended best practice is to use a DOI with machine readable metadata in the DOI record that uses a community agreed metadata profile (also known as FDO profile) for a Digital Specimen. For an example see: https://doi.org/10.3535/N75-CR4-0SM?noredirect. The identifier is for a digital information artifact (the Digital Specimen) as opposed to an identifier for a specific instance of a dwc:MaterialEntity.
Examples	`https://doi.org/10.3535/M42-Z4P-DRD` `https://doi.org/10.3535/M42-Z4P-DRD?urlappend=/1` `https://doi.org/10.3535/M42-Z4P-DRD?locatt=/1` `doi:10.3535/M42-Z4P-DRD`
ABCD equivalence	Note: /DataSets/DataSet/Units/Unit/UnitGUID could be used. A new term /DataSets/DataSet/Units/Unit/SpecimenUnit/digitalSpecimenID would make it distinguishable from URIs that identify the physical object or catalogue record.
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:discipline
Term IRI	http://rs.tdwg.org/dwc/terms/discipline
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/discipline-2026-05-26
Label	Discipline
Definition	The primary branch or branches of knowledge represented by a dwc:MaterialEntity.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary and to separate the values in a list with space vertical bar space ( `\|` ). It is also recommended to use this field to describe specimenType in MIDS. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Botany` `Botany \| Virology \| Taxonomy`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:discipline
Term IRI	http://rs.tdwg.org/dwc/iri/discipline
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/iri/version/discipline-2025-06-12
Label	Discipline (IRI)
Definition	The primary branch or branches of knowledge represented by the record.
Notes	This term can be used to classify records according to branches of knowledge. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:disposition
Term IRI	http://rs.tdwg.org/dwc/terms/disposition
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/disposition-2026-05-26
Label	Disposition
Definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`in collection` `missing` `on loan` `used up` `destroyed` `deaccessioned`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/Disposition
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:disposition
Term IRI	http://rs.tdwg.org/dwc/iri/disposition
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/disposition-2026-05-26
Label	Disposition (IRI)
Definition	A current state of a dwc:MaterialEntity with respect to where it can be found.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:DwCType
Term IRI	http://rs.tdwg.org/dwc/terms/DwCType
Modified	2014-10-23
Label	Darwin Core Type
	This term is deprecated and should no longer be used.
Definition	The set of classes specified by the Darwin Core Type Vocabulary, used to categorize the nature or genre of the resource.
ABCD equivalence	not in ABCD
Type	http://purl.org/dc/dcam/VocabularyEncodingScheme

Term Name dwc:dynamicProperties
Term IRI	http://rs.tdwg.org/dwc/terms/dynamicProperties
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/dynamicProperties-2023-06-28
Label	Dynamic Properties
Definition	A list of additional measurements, facts, characteristics, or assertions about the record. Meant to provide a mechanism for structured content.
Notes	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples	`{"heightInMeters":1.5}` `{"targusLengthInMeters":0.014, "weightInGrams":120}` `{"natureOfID":"expert identification", "identificationEvidence":"cytochrome B sequence"}` `{"relativeHumidity":28, "airTemperatureInCelsius":22, "sampleSizeInKilograms":10}` `{"aspectHeading":277, "slopeInDegrees":6}` `{"iucnStatus":"vulnerable", "taxonDistribution":"Neuquén, Argentina"}`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:earliestAgeOrLowestStage
Term IRI	http://rs.tdwg.org/dwc/terms/earliestAgeOrLowestStage
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/earliestAgeOrLowestStage-2023-09-13
Label	Earliest Age Or Lowest Stage
Definition	The full name of the earliest possible geochronologic age or lowest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Atlantic` `Boreal` `Skullrockian`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name chrono:earliestChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/earliestChronometricAge
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/earliestChronometricAge-2025-06-12
Label	Earliest Chronometric Age
Definition	The maximum/earliest/oldest possible age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated chrono:earliestChronometricAgeReferenceSystem.
Examples	`100`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:earliestChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/terms/earliestChronometricAgeReferenceSystem
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/earliestChronometricAgeReferenceSystem-2025-06-12
Label	Earliest Chronometric Age Reference System
Definition	The reference system associated with the chrono:earliestChronometricAge.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chronoiri:earliestChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/iri/earliestChronometricAgeReferenceSystem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/earliestChronometricAgeReferenceSystem-2026-05-26
Label	Earliest Chronometric Age Reference System (IRI)
Definition	The reference system associated with the chrono:earliestChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name dwc:EarliestDateCollected
Term IRI	http://rs.tdwg.org/dwc/terms/EarliestDateCollected
Modified	2009-04-24
Label	Earliest Date Collected
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventDate
Definition	The earliest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Property

Term Name dwc:earliestEonOrLowestEonothem
Term IRI	http://rs.tdwg.org/dwc/terms/earliestEonOrLowestEonothem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/earliestEonOrLowestEonothem-2026-05-26
Label	Earliest Eon Or Lowest Eonothem
Definition	The full name of the earliest possible geochronologic eon or lowest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Phanerozoic` `Proterozoic` `Precambrian`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:earliestEpochOrLowestSeries
Term IRI	http://rs.tdwg.org/dwc/terms/earliestEpochOrLowestSeries
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/earliestEpochOrLowestSeries-2023-09-13
Label	Earliest Epoch Or Lowest Series
Definition	The full name of the earliest possible geochronologic epoch or lowest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Holocene` `Pleistocene` `Ibexian Series`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:earliestEraOrLowestErathem
Term IRI	http://rs.tdwg.org/dwc/terms/earliestEraOrLowestErathem
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/earliestEraOrLowestErathem-2023-09-13
Label	Earliest Era Or Lowest Erathem
Definition	The full name of the earliest possible geochronologic era or lowest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Cenozoic` `Mesozoic`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:earliestGeochronologicalEra
Term IRI	http://rs.tdwg.org/dwc/iri/earliestGeochronologicalEra
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/iri/version/earliestGeochronologicalEra-2023-09-13
Label	Earliest Geochronological Era
Definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the earliest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:earliestPeriodOrLowestSystem
Term IRI	http://rs.tdwg.org/dwc/terms/earliestPeriodOrLowestSystem
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/earliestPeriodOrLowestSystem-2023-09-13
Label	Earliest Period Or Lowest System
Definition	The full name of the earliest possible geochronologic period or lowest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Neogene` `Tertiary` `Quaternary`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:endDayOfYear
Term IRI	http://rs.tdwg.org/dwc/terms/endDayOfYear
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/endDayOfYear-2026-05-26
Label	End Day Of Year
Definition	The latest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberEnd
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:EndTimeOfDay
Term IRI	http://rs.tdwg.org/dwc/terms/EndTimeOfDay
Modified	2009-04-24
Label	End Time of Day
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventTime
Definition	The time of day when the event ended, expressed as decimal hours from midnight, local time.
Notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/TimeOfDayEnd
Type	Property

Term Name dwc:establishmentMeans
Term IRI	http://rs.tdwg.org/dwc/terms/establishmentMeans
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/establishmentMeans-2026-05-26
Label	Establishment Means
Definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `nativeEndemic` `nativeReintroduced` `introduced` `introducedAssistedColonisation` `vagrant` `uncertain`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/EstablishmentMeans
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_25
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:establishmentMeans
Term IRI	http://rs.tdwg.org/dwc/iri/establishmentMeans
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/establishmentMeans-2025-07-10
Label	Establishment Means (IRI)
Definition	Statement about whether a dwc:Organism has been introduced to a given place and time through the direct or indirect activity of modern humans.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/em/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_25
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:Event
Term IRI	http://rs.tdwg.org/dwc/terms/Event
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Event-2026-05-26
Label	Event
Definition	An action, process, or set of circumstances occurring at a dcterms:Location during a period of time.
Examples	`a material collecting event` `a bird observation` `a camera trap image capture` `an organism occurrence` `a biotic survey`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:EventAttribute
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttribute
Modified	2009-04-24
Label	Event Attribute
	This term is deprecated and should no longer be used.
Definition	Container class for information about attributes related to a given sampling event.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Class

Term Name dwc:EventAttributeAccuracy
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeAccuracy
Modified	2009-04-24
Label	Event Attribute Accuracy
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Definition	The description of the error associated with the EventAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property

Term Name dwc:EventAttributeDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedBy
Modified	2009-04-24
Label	Event Attribute Determined By
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Definition	The agent responsible for having determined the value of the measurement or characteristic of the sampling event.
Notes	Example: "Robert Hijmans"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Property

Term Name dwc:EventAttributeDeterminedDate
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeDeterminedDate
Modified	2009-04-24
Label	Event Attribute Determined Date
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Definition	The date on which the the measurement or characteristic of the sampling event was made.
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property

Term Name dwc:EventAttributeID
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeID
Modified	2009-04-24
Label	Event Attribute ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementID
Definition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:EventAttributeRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeRemarks
Modified	2009-04-24
Label	Event Attribute Remarks
	This term is deprecated and should no longer be used.
Definition	Comments or notes accompanying the measurement or characteristic of the sampling event.
Notes	Example: "temperature taken at 15:00"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:eventAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/eventAttributes
Modified	2009-10-09
Label	Event Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements or characteristics of the Event.
Notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Property

Term Name dwc:EventAttributeType
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeType
Modified	2009-04-24
Label	Event Attribute Type
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementType
Is replaced by	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Definition	The nature of the measurement or characteristic of the sampling event. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "Temperature"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property

Term Name dwc:EventAttributeUnit
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeUnit
Modified	2009-04-24
Label	Event Attribute Unit
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Definition	The units for the value of the measurement or characteristic of the sampling event. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "C"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property

Term Name dwc:EventAttributeValue
Term IRI	http://rs.tdwg.org/dwc/terms/EventAttributeValue
Modified	2009-04-24
Label	Event Attribute
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Definition	The value of the measurement or characteristic of the sampling event.
Notes	Example: "22"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Property

Term Name dwciri:eventCategory
Term IRI	http://rs.tdwg.org/dwc/iri/eventCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/eventCategory-2026-05-26
Label	Event Category (IRI)
Definition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:eventCategory
Term IRI	http://rs.tdwg.org/dwc/terms/eventCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventCategory-2026-05-26
Label	Event Category
Definition	A broad category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Recommended best practice is to use one of the following controlled values: `Event`, `MaterialGathering`, `Occurrence`, `OrganismInteraction`, or `Survey`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Event` `MaterialGathering` `Occurrence` `OrganismInteraction` `Survey`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:eventDate
Term IRI	http://rs.tdwg.org/dwc/terms/eventDate
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventDate-2026-05-26
Label	Event Date
Definition	A date-time or time interval during which a dwc:Event occurred.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019. Not suitable for a time in a geological context.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name ecoiri:eventDurationUnit
Term IRI	http://rs.tdwg.org/eco/iri/eventDurationUnit
Modified	2024-03-26
Term version IRI	http://rs.tdwg.org/eco/iri/version/eventDurationUnit-2024-03-26
Label	Event Duration Unit (IRI)
Definition	The units associated with the eco:eventDurationValue.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42

Term Name eco:eventDurationUnit
Term IRI	http://rs.tdwg.org/eco/terms/eventDurationUnit
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/eco/terms/version/eventDurationUnit-2025-07-10
Label	Event Duration Unit
Definition	The units associated with the eco:eventDurationValue.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minutes` `hours` `days` `months` `years`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51

Term Name eco:eventDurationValue
Term IRI	http://rs.tdwg.org/eco/terms/eventDurationValue
Modified	2024-02-28
Term version IRI	http://rs.tdwg.org/eco/terms/version/eventDurationValue-2024-02-28
Label	Event Duration Value
Definition	The numeric value for the duration of the dwc:Event.
Notes	An eco:eventDurationValue must have a corresponding eco:eventDurationUnit.
Examples	`1` `30`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42

Term Name dwc:eventID
Term IRI	http://rs.tdwg.org/dwc/terms/eventID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventID-2023-06-28
Label	Event ID
Definition	An identifier for the set of information associated with a dwc:Event (something that occurs at a place and time). May be a global unique identifier or an identifier specific to the data set.
Examples	`INBO:VIS:Ev:00009375`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Property

Term Name dwc:EventMeasurement
Term IRI	http://rs.tdwg.org/dwc/terms/EventMeasurement
Modified	2009-10-09
Label	Event Measurement
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Definition	The category of information pertaining to measurements associated with an event.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Class

Term Name dwc:eventMeasurementAccuracy
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementAccuracy
Modified	2009-10-09
Label	Event Measurement Accuracy
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definition	The description of the error associated with the EventAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence	DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property

Term Name dwc:eventMeasurementDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedBy
Modified	2009-10-09
Label	Event Measurement Determined By
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Definition	The agent responsible for having determined the value of the measurement or characteristic of the event.
Notes	Example: "Robert Hijmans"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Property

Term Name dwc:eventMeasurementDeterminedDate
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementDeterminedDate
Modified	2009-10-09
Label	Event Measurement Determined Date
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definition	The date on which the the measurement or characteristic of the event was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property

Term Name dwc:eventMeasurementID
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementID
Modified	2009-10-09
Label	Event Measurement ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementID
Definition	An identifier for the event attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:eventMeasurementRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementRemarks
Modified	2009-10-09
Label	Event Measurement Remarks
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementRemarks
Definition	Comments or notes accompanying the measurement or characteristic of the event.
Notes	Example: "temperature taken at 15:00"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:eventMeasurementType
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementType
Modified	2009-10-09
Label	Event Measurement Type
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementType
Definition	The nature of the measurement or characteristic of the event. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "temperature"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property

Term Name dwc:eventMeasurementUnit
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementUnit
Modified	2009-10-09
Label	Event Measurement Unit
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementUnit
Definition	The units for the value of the measurement or characteristic of the event. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "C"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property

Term Name dwc:eventMeasurementValue
Term IRI	http://rs.tdwg.org/dwc/terms/eventMeasurementValue
Modified	2009-10-09
Label	Event Measurement Value
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementValue
Definition	The value of the measurement or characteristic of the event.
Notes	Example: "22"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Property

Term Name dwc:eventRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/eventRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventRemarks-2023-06-28
Label	Event Remarks
Definition	Comments or notes about the dwc:Event.
Examples	`After the recent rains the river is nearly at flood stage.`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Notes
Type	Property

Term Name dwc:eventTime
Term IRI	http://rs.tdwg.org/dwc/terms/eventTime
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventTime-2025-06-12
Label	Event Time
Definition	The time or interval during which a dwc:Event occurred.
Notes	Recommended best practice is to use a time of day that conforms to ISO 8601-1:2019.
Examples	`14:07-06:00` (at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `08:40:21Z` (at or after 8:40:21am and before 8:41:22am UTC) `13:00:00Z/15:30:00Z` (at or after 1pm and before 3:30pm UTC)
ABCD equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin and DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:eventType
Term IRI	http://rs.tdwg.org/dwc/terms/eventType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/eventType-2026-05-26
Label	Event Type
Definition	A narrow category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`bioBlitz` `cameraTrapDeployment` `expedition` `project` `siteVisit` `trawl`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:eventType
Term IRI	http://rs.tdwg.org/dwc/iri/eventType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/eventType-2026-05-26
Label	Event Type (IRI)
Definition	A narrow category that best matches the nature of a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name ecoiri:excludedDegreeOfEstablishmentScope
Term IRI	http://rs.tdwg.org/eco/iri/excludedDegreeOfEstablishmentScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/excludedDegreeOfEstablishmentScope-2026-09-17
Label	Excluded Degree of Establishment Scope
Definition	The degree of establishment of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:excludedDegreeOfEstablishmentScope
Term IRI	http://rs.tdwg.org/eco/terms/excludedDegreeOfEstablishmentScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/excludedDegreeOfEstablishmentScope-2026-09-17
Label	Excluded Degree of Establishment Scope
Definition	The degrees of establishment of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary (http://rs.tdwg.org/dwcdoe/) for dwc:degreeOfEstablishment. For details, refer to https://doi.org/10.3897/biss.3.38084. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `invasive \| widespreadInvasive`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:excludedGrowthFormScope
Term IRI	http://rs.tdwg.org/eco/terms/excludedGrowthFormScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/excludedGrowthFormScope-2026-09-17
Label	Excluded Growth Form Scope
Definition	The growth forms or habits of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tree` `shrub \| subShrub`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:excludedGrowthFormScope
Term IRI	http://rs.tdwg.org/eco/iri/excludedGrowthFormScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/excludedGrowthFormScope-2026-09-17
Label	Excluded Growth Form Scope
Definition	The growth form or habit of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:excludedHabitatScope
Term IRI	http://rs.tdwg.org/eco/iri/excludedHabitatScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/excludedHabitatScope-2026-09-17
Label	Excluded Habitat Scope
Definition	The habitat explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:excludedHabitatScope
Term IRI	http://rs.tdwg.org/eco/terms/excludedHabitatScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/excludedHabitatScope-2026-09-17
Label	Excluded Habitat Scope
Definition	The habitats explicitly excluded from sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`wetFlatwoods` `swamp \| estuary`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:excludedLifeStageScope
Term IRI	http://rs.tdwg.org/eco/iri/excludedLifeStageScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/excludedLifeStageScope-2026-09-17
Label	Excluded Life Stage Scope
Definition	The age class or life stage of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	This term is defined based on dwciri:lifeStage (http://rs.tdwg.org/dwc/terms/iri/lifeStage). Recommended best practice is to use an IRI from the same controlled vocabulary as for dwciri:lifeStage. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:excludedLifeStageScope
Term IRI	http://rs.tdwg.org/eco/terms/excludedLifeStageScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/excludedLifeStageScope-2026-09-17
Label	Excluded Life Stage Scope
Definition	The age classes or life stages of the dwc:Organisms explicitly excluded from sampling during an eco:Survey.
Notes	This term is defined based on dwc:lifeStage (http://rs.tdwg.org/dwc/terms/lifeStage). Recommended best practice is to use the same controlled vocabulary as for dwc:lifeStage and to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`seedling` `nestling \| fledgling`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:excludedTaxonomicScope
Term IRI	http://rs.tdwg.org/eco/iri/excludedTaxonomicScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/excludedTaxonomicScope-2026-09-17
Label	Excluded Taxonomic Scope
Definition	The taxonomic group explicitly excluded from sampling during an eco:Survey.
Notes	The eco:Survey to which the ecoiri:excludedTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the taxonomic groups explicitly excluded from the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:excludedTaxonomicScope
Term IRI	http://rs.tdwg.org/eco/terms/excludedTaxonomicScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/excludedTaxonomicScope-2026-09-17
Label	Excluded Taxonomic Scope
Definition	The taxonomic group(s) explicitly excluded from sampling during an eco:Survey.
Notes	An eco:Survey to which the eco:excludedTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the taxonomic groups explicitly excluded from the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Aves` `Quercus \| Acer`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:family
Term IRI	http://rs.tdwg.org/dwc/terms/family
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/family-2023-06-28
Label	Family
Definition	The full scientific name of the family in which the dwc:Taxon is classified.
Examples	`Felidae` `Monocleaceae`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = familia
Type	Property

Term Name dwc:feedbackURL
Term IRI	http://rs.tdwg.org/dwc/terms/feedbackURL
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/feedbackURL-2025-06-12
Label	Feedback URL
Definition	A uniform resource locator (URL) that points to a webpage on which a form may be submitted to gather feedback about the record.
Notes	Recommended best practice is to optionally include query strings that act to pre-populate web page form elements and communicate the context.
Examples	`https://example.com/new?title=New+issue&body=This+comment+is+about+CAN12345`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:fieldNotes
Term IRI	http://rs.tdwg.org/dwc/terms/fieldNotes
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/fieldNotes-2023-06-28
Label	Field Notes
Definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Notes available in the Grinnell-Miller Library.`
ABCD equivalence	DataSets/DataSet/Units/Unit/FieldNotes
Type	Property

Term Name dwciri:fieldNotes
Term IRI	http://rs.tdwg.org/dwc/iri/fieldNotes
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/iri/version/fieldNotes-2023-06-28
Label	Field Notes (IRI)
Definition	One of a) an indicator of the existence of, b) a reference to (publication, URI), or c) the text of notes taken in the field about the dwc:Event.
Notes	The subject is a dwc:Event instance and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:fieldNumber
Term IRI	http://rs.tdwg.org/dwc/iri/fieldNumber
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/fieldNumber-2026-05-26
Label	Field Number (IRI)
Definition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:fieldNumber
Term IRI	http://rs.tdwg.org/dwc/terms/fieldNumber
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/fieldNumber-2026-05-26
Label	Field Number
Definition	An identifier given to a dwc:Event in the field.
Notes	Often serves as a link between field notes and a dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`RV Sol 87-03-08`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:footprintSpatialFit
Term IRI	http://rs.tdwg.org/dwc/terms/footprintSpatialFit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/footprintSpatialFit-2026-05-26
Label	Footprint Spatial Fit
Definition	A ratio of the area of a footprint (dwc:footprintWKT) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given footprint does not completely contain the original representation. A dwc:footprintSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, a dwc:footprintSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples	`0` `1` `1.5708`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/FootprintSpatialFit
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:footprintSRS
Term IRI	http://rs.tdwg.org/dwc/terms/footprintSRS
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/footprintSRS-2025-06-12
Label	Footprint SRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. It is also permitted to provide the SRS in Well-Known-Text, especially if no EPSG code provides the necessary values for the attributes of the SRS. Do not use this term to describe the SRS of the dwc:decimalLatitude and dwc:decimalLongitude, nor of any verbatim coordinates - use the dwc:geodeticDatum and dwc:verbatimSRS instead. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EPSG:4326` `GEOGCS["GCS_WGS_1984", DATUM["D_WGS_1984", SPHEROID["WGS_1984",6378137,298.257223563]], PRIMEM["Greenwich",0], UNIT["Degree",0.0174532925199433]]` (WKT for the standard WGS84 Spatial Reference System EPSG:4326) `not recorded`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:footprintSRS
Term IRI	http://rs.tdwg.org/dwc/iri/footprintSRS
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/iri/version/footprintSRS-2025-06-12
Label	Footprint SRS (IRI)
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geometry given in dwc:footprintWKT is based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:footprintWKT
Term IRI	http://rs.tdwg.org/dwc/iri/footprintWKT
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/footprintWKT-2025-07-10
Label	Footprint WKT (IRI)
Definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines the dcterms:Location. A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:footprintWKT
Term IRI	http://rs.tdwg.org/dwc/terms/footprintWKT
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/footprintWKT-2026-05-26
Label	Footprint WKT
Definition	A Well-Known Text (WKT) representation of the shape (footprint, geometry) that defines a dcterms:Location.
Notes	A dcterms:Location may have both a point-radius representation (see dwc:decimalLatitude) and a footprint representation, and they may differ from each other.
Examples	`POLYGON ((10 20, 11 20, 11 21, 10 21, 10 20))` (the one-degree bounding box with opposite corners at longitude=10, latitude=20 and longitude=11, latitude=21)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/FootprintWKT (ABCD v2.06b)
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:formation
Term IRI	http://rs.tdwg.org/dwc/terms/formation
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/formation-2023-09-13
Label	Formation
Definition	The full name of the lithostratigraphic formation from which the dwc:MaterialEntity was collected.
Examples	`Notch Peak Formation` `House Limestone` `Fillmore Formation`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:FossilSpecimen
Term IRI	http://rs.tdwg.org/dwc/terms/FossilSpecimen
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/FossilSpecimen-2023-09-18
Label	Fossil Specimen
Definition	A preserved specimen that is a fossil.
Examples	`a body fossil` `a coprolite` `a gastrolith` `an ichnofossil` `a piece of a petrified tree`
ABCD equivalence	RecordBasisEnum/FossileSpecimen
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwciri:fromLithostratigraphicUnit
Term IRI	http://rs.tdwg.org/dwc/iri/fromLithostratigraphicUnit
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/fromLithostratigraphicUnit-2015-03-27
Label	From Lithostratigraphic Unit
Definition	Use to link a dwc:GeologicalContext instance to an IRI-identified lithostratigraphic unit at the lowest possible level in a hierarchy.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.7 of the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property

Term Name ac:fundingAttribution
Term IRI	http://rs.tdwg.org/ac/terms/fundingAttribution
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/ac/terms/version/fundingAttribution-2020-01-27
Label	Funding Attribution
Definition	Text description of organizations or individuals who funded the creation of the resource.
Notes	Specify the full official name of the funding body. This should include the complete name without abbreviations, unless the abbreviation is an official and commonly recognized form (e.g., NSF for the National Science Foundation). The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Artsdatabanken` `National Science Foundation` `Norges forskningsråd` `Ocean Census \| Nippon Foundation`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:fundingAttribution
Term IRI	http://rs.tdwg.org/dwc/iri/fundingAttribution
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/fundingAttribution-2025-07-10
Label	Funding Attribution (IRI)
Definition	An organization or agency that provided funding for a project.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:fundingAttributionID
Term IRI	http://rs.tdwg.org/dwc/terms/fundingAttributionID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/fundingAttributionID-2026-05-26
Label	Funding Attribution ID
Definition	An identifier for a dcterms:Agent that financially supported a project.
Notes	Provide a unique identifier for the funding body, such as an identifier used in governmental or international databases. If no official identifier exists, use a persistent and unique identifier within your organization or dataset. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://ror.org/00epmv149` `https://ror.org/00epmv149 \| https://ror.org/04jnzhb65` `https://www.wikidata.org/wiki/Q13102615`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:Generalizations
Term IRI	http://rs.tdwg.org/dwc/terms/Generalizations
Modified	2009-04-24
Label	Generalizations
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/dataGeneralizations
Definition	Actions taken to make the data as shared less specific or complete than in its original form. Suggests that alternative data of highly quality may be available on request.
Notes	Examples: "Coordinates generalized from original GPS coordinates to the nearest half degree grid cell", "locality information given only to nearest county".
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:genericName
Term IRI	http://rs.tdwg.org/dwc/terms/genericName
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/genericName-2023-06-28
Label	Generic Name
Definition	The genus part of the dwc:scientificName without authorship.
Notes	For synonyms the accepted genus and the genus part of the name may be different. The term dwc:genericName should be used together with dwc:specificEpithet to form a binomial and with dwc:infraspecificEpithet to form a trinomial. The term dwc:genericName should only be used for combinations. Uninomials of generic rank do not have a dwc:genericName.
Examples	`Felis` (for scientificName `Felis concolor`, with accompanying values of `Puma concolor` in acceptedNameUsage and `Puma` in genus)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:genus
Term IRI	http://rs.tdwg.org/dwc/terms/genus
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/genus-2023-06-28
Label	Genus
Definition	The full scientific name of the genus in which the dwc:Taxon is classified.
Examples	`Puma` `Monoclea`
ABCD equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Viral/GenusOrMonomial or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/GenusOrMonomial}
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:geodeticDatum
Term IRI	http://rs.tdwg.org/dwc/terms/geodeticDatum
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geodeticDatum-2025-06-12
Label	Geodetic Datum
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for a string literal value.
Examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/SpatialDatum
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:geodeticDatum
Term IRI	http://rs.tdwg.org/dwc/iri/geodeticDatum
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/iri/version/geodeticDatum-2025-06-12
Label	Geodetic Datum (IRI)
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which the geographic coordinates given in dwc:decimalLatitude and dwc:decimalLongitude are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use an IRI corresponding to the value `not recorded`.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:GeologicalContext
Term IRI	http://rs.tdwg.org/dwc/terms/GeologicalContext
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/GeologicalContext-2026-09-17
Label	Geological Context
Definition	A set of geological designations, such as stratigraphy, that qualify a dcterms:Location or source of a dwc:MaterialEntity.
Examples	`a particular lithostratigraphic layer` `a specific chronostratigraphic unit`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicalContextID
Term IRI	http://rs.tdwg.org/dwc/terms/geologicalContextID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicalContextID-2026-09-17
Label	Geological Context ID
Definition	An identifier for a dwc:GeologicalContext.
Notes	May be a global unique identifier or an identifier specific to the data set.
Examples	`https://opencontext.org/subjects/e54377f7-4452-4315-b676-40679b10c4d9`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:GeologicalMaterial
Term IRI	http://rs.tdwg.org/dwc/terms/GeologicalMaterial
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/GeologicalMaterial-2026-09-17
Label	Geological Material
Definition	A dwc:MaterialEntity that is geological in nature.
Examples	`a specific mineral` `a specific rock` `a specific ore`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicalMaterialNames
Term IRI	http://rs.tdwg.org/dwc/terms/geologicalMaterialNames
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicalMaterialNames-2026-09-17
Label	Geological Material Names
Definition	A list (concatenated and separated) of mineral or lithotaxon names for a dwc:GeologicalMaterial.
Notes	May includes both informal (e.g., variety, synonym) and formal (classification) names. The first name in the list should be considered the preferred name. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`quartz \| smoky quartz` `muscovite` `garnet group`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicalMaterialNameTypes
Term IRI	http://rs.tdwg.org/dwc/terms/geologicalMaterialNameTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicalMaterialNameTypes-2026-09-17
Label	Geological Material Name Types
Definition	A list (concatenated and separated) of the types of names provided in dwc:geologicalMaterialNames.
Notes	If this term is populated, it should have an equal number of items in the list as for the list in dwc:geologicalMaterialNames and the types should have the same order as the names to which they refer. Recommended best practice is to use a controlled vocabulary for the values in a list (e.g., https://kos.geospecimens.org/def/geological-specimen-name-type). See Gavryliv (2023), https://doi.org/10.1180/mgm.2023.23, for a detailed breakdown of informal, alternate names.
Examples	`species \| variety` `species` `group` `synonym` `classification` `historical`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:geologicEvent
Term IRI	http://rs.tdwg.org/dwc/iri/geologicEvent
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/geologicEvent-2026-09-17
Label	Geologic Event (IRI)
Definition	A name of an identifiable event during which one or more geologic processes acted to create or modify one or more dwc:GeologicalMaterials.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicEvent
Term IRI	http://rs.tdwg.org/dwc/terms/geologicEvent
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicEvent-2026-09-17
Label	Geologic Event
Definition	A name of an identifiable event during which one or more geologic processes acted to create or modify one or more dwc:GeologicalMaterials.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Sevier orogeny` `Alleghanian orogeny` `Alpine orogeny` `Variscan orogeny` `Vredefort impact`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicMaterialNameID
Term IRI	http://rs.tdwg.org/dwc/terms/geologicMaterialNameID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicMaterialNameID-2026-09-17
Label	Geologic Material Name ID
Definition	An identifier for a mineral or lithotaxon name for a dwc:GeologicalMaterial. May be a global unique identifier or an identifier specific to the data set.
Notes	Recommended best practice is to use a persistent, globally unique identifier.
Examples	`https://geospecimens.org/api/v1/catalog/resource/mineral-name/ba673bdf-7228-11f0-a057-52f8e1bb0628`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:geologicProvince
Term IRI	http://rs.tdwg.org/dwc/iri/geologicProvince
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/geologicProvince-2026-09-17
Label	Geologic Province (IRI)
Definition	An extensive named region with similar geologic history, structural, petrographic, or physiographic features throughout in which the GeologicalContext was located.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:geologicProvince
Term IRI	http://rs.tdwg.org/dwc/terms/geologicProvince
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/geologicProvince-2026-09-17
Label	Geologic Province
Definition	An extensive named region with similar geologic history, structural, petrographic, or physiographic features throughout in which the GeologicalContext was located.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Northwest Province` `Surprise Paleovalley` `Basin and Range` ;`Coastal Plain` `Piedmont` `Blue Ridge`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:georeferencedBy
Term IRI	http://rs.tdwg.org/dwc/terms/georeferencedBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferencedBy-2026-05-26
Label	Georeferenced By
Definition	A name for a dcterms:Agent responsible for providing a georeference.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Brad Millen (ROM)` `Kristina Yamamoto \| Janet Fang`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:georeferencedBy
Term IRI	http://rs.tdwg.org/dwc/iri/georeferencedBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/georeferencedBy-2026-05-26
Label	Georeferenced By (IRI)
Definition	An IRI identifying a dcterms:Agent responsible for providing a georeference.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:georeferencedDate
Term IRI	http://rs.tdwg.org/dwc/terms/georeferencedDate
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferencedDate-2025-06-12
Label	Georeferenced Date
Definition	The date on which the dcterms:Location was georeferenced.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2011-10-16_9
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:georeferenceProtocol
Term IRI	http://rs.tdwg.org/dwc/iri/georeferenceProtocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/georeferenceProtocol-2026-05-26
Label	Georeference Protocol (IRI)
Definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:georeferenceProtocol
Term IRI	http://rs.tdwg.org/dwc/terms/georeferenceProtocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferenceProtocol-2026-05-26
Label	Georeference Protocol
Definition	A description or reference to a dwc:Protocol used to determine a spatial footprint, coordinates, and uncertainties.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Georeferencing Quick Reference Guide (Zermoglio et al. 2020, https://doi.org/10.35035/e09p-h128)`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinateMethod
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:georeferenceRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/georeferenceRemarks
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferenceRemarks-2025-06-12
Label	Georeference Remarks
Definition	Comments or notes about the spatial description determination, explaining assumptions made in addition or opposition to the those formalized in the method referred to in dwc:georeferenceProtocol.
Examples	`Assumed distance by road (Hwy. 101)`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceRemarks
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:georeferenceSources
Term IRI	http://rs.tdwg.org/dwc/iri/georeferenceSources
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/georeferenceSources-2026-05-26
Label	Georeference Sources (IRI)
Definition	An IRI for a map, gazetteer, or other resource used to georeference a dcterms:Location.
Notes	Recommended best practice is describe a georeference with no more than one sampled georeference source. In the case of a georeference that cannot be attributed to a specific source, the recommended best practice is to repeat the property for each IRI that denotes a different source that applies to the georeference. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:georeferenceSources
Term IRI	http://rs.tdwg.org/dwc/terms/georeferenceSources
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferenceSources-2026-05-26
Label	Georeference Sources
Definition	A list (concatenated and separated) of maps, gazetteers, or other resources used to georeference a dcterms:Location, described specifically enough to allow anyone in the future to use the same resources.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`GeoLocate` `GeoPick` `https://www.geonames.org/` `USGS 1:24000 Florence Montana Quad 1967 \| Terrametrics 2008 on Google Earth`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceSources
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:georeferenceVerificationStatus
Term IRI	http://rs.tdwg.org/dwc/terms/georeferenceVerificationStatus
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/georeferenceVerificationStatus-2023-06-28
Label	Georeference Verification Status
Definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`unable to georeference` `requires georeference` `requires verification` `verified by data custodian` `verified by contributor`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/GeoreferenceVerificationStatus
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Term Name dwciri:georeferenceVerificationStatus
Term IRI	http://rs.tdwg.org/dwc/iri/georeferenceVerificationStatus
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/georeferenceVerificationStatus-2025-07-10
Label	Georeference Verification Status (IRI)
Definition	A categorical description of the extent to which the georeference has been verified to represent the best possible spatial description for the dcterms:Location of the dwc:Occurrence.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name eco:geospatialScopeAreaUnit
Term IRI	http://rs.tdwg.org/eco/terms/geospatialScopeAreaUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/geospatialScopeAreaUnit-2026-09-17
Label	Geospatial Scope Area Unit
Definition	The units associated with eco:geospatialScopeAreaValue.
Notes	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:geospatialScopeAreaUnit
Term IRI	http://rs.tdwg.org/eco/iri/geospatialScopeAreaUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/geospatialScopeAreaUnit-2026-09-17
Label	Geospatial Scope Area Unit
Definition	The units associated with eco:geospatialScopeAreaValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:geospatialScopeAreaValue
Term IRI	http://rs.tdwg.org/eco/terms/geospatialScopeAreaValue
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/geospatialScopeAreaValue-2026-09-17
Label	Geospatial Scope Area Value
Definition	The numeric value for the total area of the geospatial scope of an eco:Survey.
Notes	Geospatial scope refers to the place described by a dcterms:Location. This area is always greater than or equal to the eco:totalAreaSampledValue because it reflects the targeted location for which an inventory is intended and informs the sampling design. An eco:geospatialScopeAreaValue must have a corresponding eco:geospatialScopeAreaUnit.
Examples	`25`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:group
Term IRI	http://rs.tdwg.org/dwc/terms/group
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/group-2023-09-13
Label	Group
Definition	The full name of the lithostratigraphic group from which the dwc:MaterialEntity was collected.
Examples	`Bathurst` `Lower Wealden`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:habitat
Term IRI	http://rs.tdwg.org/dwc/terms/habitat
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/habitat-2023-06-28
Label	Habitat
Definition	A category or description of the habitat in which the dwc:Event occurred.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`oak savanna` `pre-cordilleran steppe`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Biotope/Text
Type	Property

Term Name dwciri:habitat
Term IRI	http://rs.tdwg.org/dwc/iri/habitat
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/habitat-2025-07-10
Label	Habitat (IRI)
Definition	A category or description of the habitat in which the dwc:Event occurred.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:handlingRequirements
Term IRI	http://rs.tdwg.org/dwc/terms/handlingRequirements
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/handlingRequirements-2026-09-17
Label	Handling Requirements
Definition	A description of the procedures required to preserve and protect a dwc:MaterialEntity during handling.
Examples	`handle with gloves` `not to be taken out of storage medium` `avoid contact with direct sunlight`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:hasMaterialSamples
Term IRI	http://rs.tdwg.org/eco/terms/hasMaterialSamples
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/hasMaterialSamples-2026-09-17
Label	Has Material Samples
Definition	One or more dwc:MaterialEntities were collected during an eco:Survey.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:hasNonTargetOrganisms
Term IRI	http://rs.tdwg.org/eco/terms/hasNonTargetOrganisms
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/hasNonTargetOrganisms-2026-09-17
Label	Has Non-target Organisms
Definition	One or more dwc:Occurrences outside the target organismal scopes (eco:targetDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:targetLifeStageScope) were detected and reported for an eco:Survey.
Notes	This term is meant to alert users to the presence of non-target organisms (in some disciplines called “bycatch”) reported in an eco:Survey. This term is relevant only if a target organismal scope is declared. Organismal scope is based on the combination of all of the following terms: eco:targetLifeStageScope, eco:excludedLifeStageScope, eco:targetDegreeOfEstablishmentScope, eco:excludedDegreeOfEstablishmentScope, eco:targetGrowthFormScope, and eco:excludedGrowthFormScope. Examination of the organismal scope is needed in order to identify the non-target dwc:Occurrences. It should be possible to confirm the expectations by investigating dwc:Occurrences in an eco:Survey and in its child eco:Surveys (if available). The value of this term should be 'true' if dwc:Occurrences outside the organismal scope(s) as defined at the time of an eco:Survey are reported, otherwise the value of this term should be 'false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:hasNonTargetTaxa
Term IRI	http://rs.tdwg.org/eco/terms/hasNonTargetTaxa
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/hasNonTargetTaxa-2026-09-17
Label	Has Non-target Taxa
Definition	One or more dwc:Occurrences of taxa outside the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) were detected and reported for an eco:Survey.
Notes	This term is meant to alert users to the presence of non-target taxa (in some disciplines called “bycatch”) reported in an eco:Survey. This term is relevant only if a target taxonomic scope is declared. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Examination of the taxonomic scope is needed in order to identify the non-target taxa. It should be possible to confirm the expectations by investigating the dwc:Occurrences in an eco:Survey and in its child eco:Surveys (if available) or by exploring eco:nonTargetTaxa for an eco:Survey (if populated). The value of this term should be 'true' if dwc:Occurrences of taxa outside the taxonomic scope as defined at the time of an eco:Survey are reported, otherwise the value of this term should be 'false'. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:hasVouchers
Term IRI	http://rs.tdwg.org/eco/terms/hasVouchers
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/hasVouchers-2026-09-17
Label	Has Vouchers
Definition	One or more specimen vouchers were collected during an eco:Survey.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:hazardRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/hazardRemarks
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/hazardRemarks-2026-09-17
Label	Hazard Remarks
Definition	Comments or notes about the type of hazards associated with a dwc:MaterialEntity.
Examples	`asbestos` `slightly radioactive` `requires skin protection`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:hazardType
Term IRI	http://rs.tdwg.org/dwc/terms/hazardType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/hazardType-2026-09-17
Label	Hazard Type
Definition	A term that belongs to a hazard classification scheme based on a set of unique characteristics and negative health outcomes.
Notes	Recommended best practice is to use a controlled vocabulary such as https://kos.geospecimens.org/vocab/hazard-type. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`carcinogen` `skin irritant` `radioactive` `toxic`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:hazardType
Term IRI	http://rs.tdwg.org/dwc/iri/hazardType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/hazardType-2026-09-17
Label	Hazard Type (IRI)
Definition	A term that belongs to a hazard classification scheme based on a set of unique characteristics and negative health outcomes.
Notes	Recommended best practice is to use a controlled vocabulary such as https://kos.geospecimens.org/vocab/hazard-type. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:higherClassification
Term IRI	http://rs.tdwg.org/dwc/terms/higherClassification
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/higherClassification-2023-06-28
Label	Higher Classification
Definition	A list (concatenated and separated) of taxa names terminating at the rank immediately superior to the referenced dwc:Taxon.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from the highest taxonomic rank to the lowest.
Examples	`Plantae \| Tracheophyta \| Magnoliopsida \| Ranunculales \| Ranunculaceae \| Ranunculus` `Animalia` `Animalia \| Chordata \| Vertebrata \| Mammalia \| Theria \| Eutheria \| Rodentia \| Hystricognatha \| Hystricognathi \| Ctenomyidae \| Ctenomyini \| Ctenomys`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:higherGeography
Term IRI	http://rs.tdwg.org/dwc/terms/higherGeography
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/higherGeography-2023-06-28
Label	Higher Geography
Definition	A list (concatenated and separated) of geographic names less specific than the information captured in the dwc:locality term.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ), with terms in order from least specific to most specific.
Examples	`North Atlantic Ocean` `South America \| Argentina \| Patagonia \| Parque Nacional Nahuel Huapi \| Neuquén \| Los Lagos` with accompanying values `South America` (continent) `Argentina` (country), `Neuquén` (first order division), and `Los Lagos` (second order division)
ABCD equivalence	{DataSets/DataSet/Units/Unit/Gathering/LocalityText or DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName}
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:higherGeographyID
Term IRI	http://rs.tdwg.org/dwc/terms/higherGeographyID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/higherGeographyID-2023-06-28
Label	Higher Geography ID
Definition	An identifier for the geographic region within which the dcterms:Location occurred.
Notes	Recommended best practice is to use a persistent identifier from a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`http://vocab.getty.edu/tgn/1002002` (Antártida e Islas del Atlántico Sur, Territorio Nacional de la Tierra del Fuego, Argentina).
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:HigherTaxon
Term IRI	http://rs.tdwg.org/dwc/terms/HigherTaxon
Modified	2009-08-24
Label	Higher Taxon
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than the ScientificName.
Notes	Example: "Animalia, Chordata, Vertebrata, Mammalia, Theria, Eutheria, Rodentia, Hystricognatha, Hystricognathi, Ctenomyidae, Ctenomyini, Ctenomys".
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Property

Term Name dwc:higherTaxonconceptID
Term IRI	http://rs.tdwg.org/dwc/terms/higherTaxonconceptID
Modified	2009-08-24
Label	Higher Taxon Concept ID
	This term is deprecated and should no longer be used.
Definition	A unique identifier for the taxon concept less specific than that given in the taxonConceptID.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:HigherTaxonID
Term IRI	http://rs.tdwg.org/dwc/terms/HigherTaxonID
Modified	2009-08-24
Label	Higher Taxon ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Definition	A global unique identifier for the parent to the taxon.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:higherTaxonName
Term IRI	http://rs.tdwg.org/dwc/terms/higherTaxonName
Modified	2009-08-24
Label	Higher Taxon Name
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/higherClassification
Definition	A list (concatenated and separated) of the names for the taxonomic ranks less specific than that given in the scientificName.
Notes	Example: "Animalia; Chordata; Vertebrata; Mammalia; Theria; Eutheria; Rodentia; Hystricognatha; Hystricognathi; Ctenomyidae; Ctenomyini; Ctenomys"
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Property

Term Name dwc:higherTaxonNameID
Term IRI	http://rs.tdwg.org/dwc/terms/higherTaxonNameID
Modified	2009-08-24
Label	Higher Taxon Name ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/parentNameUsageID
Definition	A unique identifier for the name of the next higher rank than the scientificName in a taxonomic classification. See higherTaxonName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:highestBiostratigraphicZone
Term IRI	http://rs.tdwg.org/dwc/terms/highestBiostratigraphicZone
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/highestBiostratigraphicZone-2023-09-13
Label	Highest Biostratigraphic Zone
Definition	The full name of the highest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Blancan`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:HumanObservation
Term IRI	http://rs.tdwg.org/dwc/terms/HumanObservation
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/HumanObservation-2023-09-18
Label	Human Observation
Definition	An output of a human observation process.
Examples	`evidence of a dwc:Occurrence taken from field notes or literature` `a record of a dwc:Occurrence without physical evidence or evidence captured with a machine`
ABCD equivalence	RecordBasisEnum/HumanObservation
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwc:Identification
Term IRI	http://rs.tdwg.org/dwc/terms/Identification
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Identification-2026-05-26
Label	Identification
Definition	A classification of a resource according to a classification scheme.
Notes	For biology, the assignment of a scientific name or taxon concept to a dwc:Organism.
Examples	`a subspecies determination of an organism` `a nomenclatural act designating a specimen as a holotype`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:identificationAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/identificationAttributes
Modified	2009-10-09
Label	Identification Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Identification.
Notes	Example: "natureOfID=expert identification; identificationEvidence=cytochrome B sequence"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:identificationID
Term IRI	http://rs.tdwg.org/dwc/terms/identificationID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationID-2026-05-26
Label	Identification ID
Definition	An identifier for a dwc:Identification.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`9992`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:identificationQualifier
Term IRI	http://rs.tdwg.org/dwc/iri/identificationQualifier
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/identificationQualifier-2025-07-10
Label	Identification Qualifier (IRI)
Definition	A controlled value to express the determiner's doubts about the dwc:Identification.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:identificationQualifier
Term IRI	http://rs.tdwg.org/dwc/terms/identificationQualifier
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationQualifier-2023-06-28
Label	Identification Qualifier
Definition	A brief phrase or a standard term ("cf.", "aff.") to express the determiner's doubts about the dwc:Identification.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`aff. agrifolia var. oxyadenia` (for `Quercus aff. agrifolia var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank) `cf. var. oxyadenia` (for `Quercus agrifolia cf. var. oxyadenia` with accompanying values `Quercus` in genus, `agrifolia` in specificEpithet, `oxyadenia` in infraspecificEpithet, and `var.` in taxonRank)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/IdentificationQualifier
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Term Name dwc:identificationReferences
Term IRI	http://rs.tdwg.org/dwc/terms/identificationReferences
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationReferences-2026-05-26
Label	Identification References
Definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Aves del Noroeste Patagonico. Christie et al. 2004.` `Stebbins, R. Field Guide to Western Reptiles and Amphibians. 3rd Edition. 2003. \| Irschick, D.J. and Shaffer, H.B. (1997). The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata). Herpetologica, 53(1), 30-49.`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/References
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:identificationRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/identificationRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationRemarks-2023-06-28
Label	Identification Remarks
Definition	Comments or notes about the dwc:Identification.
Examples	`Distinguished between Anthus correndera and Anthus hellmayri based on the comparative lengths of the uñas.`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Notes
Type	Property

Term Name dwc:identificationType
Term IRI	http://rs.tdwg.org/dwc/terms/identificationType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationType-2026-05-26
Label	Identification Type
Definition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`geography` `taxonomicRevision` `functionalAttributes` `nucleotideAnalysis` `karyotype` `media` `relationship` `features` `fineFeatures` `unknown`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:identificationType
Term IRI	http://rs.tdwg.org/dwc/iri/identificationType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/identificationType-2026-05-26
Label	Identification Type (IRI)
Definition	A category that best matches the nature of a dwc:Identification.
Notes	The evidentiary basis, analytical approach, or inferential method by which an identification was determined. Values describe the dominant source of information supporting the identification (e.g., morphology, geography, molecular data, functional attributes, relationships, or taxonomic revision), independent of confidence level or taxonomic outcome. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:identificationVerificationStatus
Term IRI	http://rs.tdwg.org/dwc/iri/identificationVerificationStatus
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/identificationVerificationStatus-2026-09-17
Label	Identification Verification Status (IRI)
Definition	A categorical indicator of the extent to which a dwc:Identification has been verified to be correct.
Notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:identificationVerificationStatus
Term IRI	http://rs.tdwg.org/dwc/terms/identificationVerificationStatus
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identificationVerificationStatus-2026-09-17
Label	Identification Verification Status
Definition	A categorical indicator of the extent to which a dwc:Identification has been verified to be correct.
Notes	Recommended best practice is to use a controlled vocabulary such as that used in HISPID and ABCD. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`0` (unverified in HISPID/ABCD)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/VerificationLevel
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2011-10-16_10
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:identifiedBy
Term IRI	http://rs.tdwg.org/dwc/terms/identifiedBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identifiedBy-2026-05-26
Label	Identified By
Definition	A name for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`James L. Patton` `Theodore Pappenfuss \| Robert Macey` `MegaDetector V5`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Identifiers/IdentifiersText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:identifiedBy
Term IRI	http://rs.tdwg.org/dwc/iri/identifiedBy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/identifiedBy-2026-05-26
Label	Identified By (IRI)
Definition	An IRI identifying a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:identifiedByID
Term IRI	http://rs.tdwg.org/dwc/terms/identifiedByID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/identifiedByID-2026-05-26
Label	Identified By ID
Definition	An identifier for a dcterms:Agent responsible for making a dwc:Identification.
Notes	When used in the context of an eco:Survey, the subject consists of all of the dwc:Identifications related to the eco:Survey. Recommended best practice is to provide a single identifier that disambiguates the details of the identifying dcterms:Agent. If a list is used, the order of the identifiers on the list should not be assumed to convey any semantics. Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:includeOrExclude
Term IRI	http://rs.tdwg.org/eco/terms/includeOrExclude
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/includeOrExclude-2026-05-26
Label	Include Or Exclude
Definition	Whether to include or exclude eco:surveyTargetValue in a scope categorized by eco:surveyTargetType.
Notes	Combinations of eco:SurveyTarget records of inclusions and exclusions can define complex scopes such as all flying adult Aves except Passeriformes. Recommended best practice is to use a controlled vocabulary consisting of 'include' and 'exclude' only.
Examples	`include` `exclude`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name dwciri:inCollection
Term IRI	http://rs.tdwg.org/dwc/iri/inCollection
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/inCollection-2015-03-27
Label	In Collection
Definition	Use to link any subject resource that is part of a collection to the collection containing the resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces literal-value terms related to collections and institutions. See Section 2.7.3 of the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:inDataset
Term IRI	http://rs.tdwg.org/dwc/iri/inDataset
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/inDataset-2015-03-27
Label	In Dataset
Definition	Use to link a subject dataset record to the dataset which contains it.
Notes	A string literal name of the dataset can be provided using the term dwc:datasetName. See the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:inDescribedPlace
Term IRI	http://rs.tdwg.org/dwc/iri/inDescribedPlace
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/inDescribedPlace-2015-03-27
Label	In Described Place
Definition	Use to link a dcterms:Location instance subject to the lowest level standardized hierarchically-described resource.
Notes	Recommended best practice is to use an IRI from a controlled registry. A "convenience property" that replaces Darwin Core literal-value terms related to locations. See Section 2.7.5 of the Darwin Core RDF Guide for details.
Examples	`http://vocab.getty.edu/tgn/1019987`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:individualCount
Term IRI	http://rs.tdwg.org/dwc/terms/individualCount
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/individualCount-2023-06-28
Label	Individual Count
Definition	The number of individuals present at the time of the dwc:Occurrence.
Examples	`0` `1` `25`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue
Type	Property

Term Name dwc:individualID
Term IRI	http://rs.tdwg.org/dwc/terms/individualID
Modified	2014-10-23
Label	Individual ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/organismID
Definition	An identifier for an individual or named group of individual organisms represented in the Occurrence. Meant to accommodate resampling of the same individual or group for monitoring purposes. May be a global unique identifier or an identifier specific to a data set.
Notes	Examples: "U.amer. 44", "Smedley", "Orca J 23"
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/NamedIndividual or DataSets/DataSet/Units/Unit/ObservationUnit/ObservationUnitIdentifiers/ObservationUnitIdentifier or DataSets/DataSet/Units/Unit/SpecimenUnit/Accessions/AccessionNumber
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:informationWithheld
Term IRI	http://rs.tdwg.org/dwc/terms/informationWithheld
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/informationWithheld-2026-05-26
Label	Information Withheld
Definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`location information not given for endangered species` `collector identities withheld \| ask about tissue samples`
ABCD equivalence	DataSets/DataSet/Units/Unit/InformationWithheld
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:informationWithheld
Term IRI	http://rs.tdwg.org/dwc/iri/informationWithheld
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/informationWithheld-2026-05-26
Label	Information Withheld (IRI)
Definition	Additional information that exists about a resource, but that is not shared publicly. Suggests that alternative data of higher quality may be available on request.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:infragenericEpithet
Term IRI	http://rs.tdwg.org/dwc/terms/infragenericEpithet
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/infragenericEpithet-2023-06-28
Label	Infrageneric Epithet
Definition	The infrageneric part of a binomial name at ranks above species but below genus.
Notes	The term dwc:infragenericEpithet should be used in conjunction with dwc:genericName, dwc:specificEpithet, dwc:infraspecificEpithet, dwc:taxonRank and dwc:scientificNameAuthorship to represent the individual elements of the complete dwc:scientificName. It can be used to indicate the subgenus placement of a species, which in zoology is often given in parentheses. Can also be used to share infrageneric names such as botanical sections (e.g., `Vicia sect. Cracca`).
Examples	`Abacetillus` (for scientificName `Abacetus (Abacetillus) ambiguus`) `Cracca` (for scientificName `Vicia sect. Cracca`)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Bacterial/Subgenus (for bacterial names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Zoological/Subgenus (for zoological names) or DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet (for botanical names)
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:infraspecificEpithet
Term IRI	http://rs.tdwg.org/dwc/terms/infraspecificEpithet
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/infraspecificEpithet-2026-05-26
Label	Infraspecific Epithet
Definition	The name of the lowest or terminal infraspecific of the dwc:scientificName.
Notes	In botany, name strings in literature and identifications may have multiple infraspecific ranks. According to the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles 6.7 & Art. 24.1), valid names only have two epithets, with the lowest rank being the dwc:infraspecificEpithet. For example: the dwc:infraspecificEpithet in the string `Indigofera charlieriana subsp. sessilis var. scaberrima` is `scaberrima` and the dwc:scientificName is `Indigofera charlieriana var. scaberrima`. Use dwc:verbatimIdentification for the full name string used in a dwc:Identification.
Examples	`concolor` (for scientificName `Puma concolor concolor`) `oxyadenia` (for scientificName `Quercus agrifolia var. oxyadenia`) `laxa` (for scientificName `Cheilanthes hirta f. laxa`) `scaberrima` (for scientificName `Indigofera charlieriana var. scaberrima`)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SubspeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/SecondEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SubspeciesEpithet
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:institutionCode
Term IRI	http://rs.tdwg.org/dwc/terms/institutionCode
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/institutionCode-2026-05-26
Label	Institution Code
Definition	A name (or acronym) in use by an institution having custody of a resource.
Notes	The institution having ownership of a resource should be given in dwc:ownerInstitutionCode.
Examples	`MVZ` `FMNH` `CLO` `UCMP` `National Museum of Kenya` `Kew Gardens`
ABCD equivalence	DataSets/DataSet/Units/Unit/SourceInstitutionID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:institutionID
Term IRI	http://rs.tdwg.org/dwc/terms/institutionID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/institutionID-2026-05-26
Label	Institution ID
Definition	An identifier for an organization.
Notes	For physical specimens, the recommended best practice is to use a globally unique and resolvable identifier from a collections registry such as the Research Organization Registry (ROR) or the Global Registry of Scientific Collections (https://scientific-collections.gbif.org/).
Examples	`https://ror.org/015hz7p22` `http://grscicoll.org/institution/museum-southwestern-biology` `https://www.gbif.org/grscicoll/institution/e3d4dcc4-81e2-444c-8a5c-41d1044b5381`
ABCD equivalence	DataSets/DataSet/Units/Unit/SourceInstitutionID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name ecoiri:inventoryTypes
Term IRI	http://rs.tdwg.org/eco/iri/inventoryTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/inventoryTypes-2026-09-17
Label	Inventory Types
Definition	The type of search process used to conduct an eco:Survey.
Notes	This term is only relevant if the eco:Survey represents an inventory. Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:inventoryTypes
Term IRI	http://rs.tdwg.org/eco/terms/inventoryTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/inventoryTypes-2026-09-17
Label	Inventory Types
Definition	The types of search processes used to conduct an eco:Survey.
Notes	This term is only relevant if an eco:Survey represents an inventory. Recommended best practice is to use a controlled vocabulary. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`restrictedSearch` `openSearch` `compilation` `openSearch \| opportunisticSearch`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isAbsenceReported
Term IRI	http://rs.tdwg.org/eco/terms/isAbsenceReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isAbsenceReported-2026-09-17
Label	Is Absence Reported
Definition	Taxonomic absences were reported.
Notes	Absences can be reported at any taxonomic level. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isAbundanceCapReported
Term IRI	http://rs.tdwg.org/eco/terms/isAbundanceCapReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isAbundanceCapReported-2026-09-17
Label	Is Abundance Cap Reported
Definition	A maximum number of dwc:Organisms was reported, as specified or restricted by the protocol used.
Notes	Values of abundance cap should be captured under the term eco:abundanceCap. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isAbundanceReported
Term IRI	http://rs.tdwg.org/eco/terms/isAbundanceReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isAbundanceReported-2026-09-17
Label	Is Abundance Reported
Definition	The number of dwc:Organisms collected or observed was reported.
Notes	Typically the abundance values would be reported in the dwc:organismQuantity and dwc:organismQuantityType terms for the child dwc:Occurrence records for an eco:Survey. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:isAcceptedIdentification
Term IRI	http://rs.tdwg.org/dwc/terms/isAcceptedIdentification
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/isAcceptedIdentification-2026-05-26
Label	Is Accepted Identification
Definition	An indicator that a dwc:Identification of a dwc:Organism is a currently an accepted or preferred one.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:isDegreeOfEstablishmentScopeFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/isDegreeOfEstablishmentScopeFullyReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isDegreeOfEstablishmentScopeFullyReported-2026-09-17
Label	Is Degree of Establishment Scope Fully Reported
Definition	Every dwc:Occurrence that was included within the degree of establishment scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrence included within the degree of establishment scope and detected during an dwc:Survey were reported, the value should be 'true'. Degree of establishment scope is based on the combination of eco:targetDegreeOfEstablishmentScope and eco:excludedDegreeOfEstablishmentScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isGrowthFormScopeFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/isGrowthFormScopeFullyReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isGrowthFormScopeFullyReported-2026-09-17
Label	Is Growth Form Scope Fully Reported
Definition	Every dwc:Occurrence that was included within the growth form scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the growth form scope and detected during an eco:Survey were reported, the value should be 'true'. Growth form scope is based on the combination of eco:targetGrowthFormScope and eco:excludedGrowthFormScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:island
Term IRI	http://rs.tdwg.org/dwc/terms/island
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/island-2023-06-28
Label	Island
Definition	The name of the island on or near which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Nosy Be` `Bikini Atoll` `Vancouver` `Viti Levu` `Zanzibar`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:islandGroup
Term IRI	http://rs.tdwg.org/dwc/terms/islandGroup
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/islandGroup-2023-06-28
Label	Island Group
Definition	The name of the island group in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Alexander Archipelago` `Archipiélago Diego Ramírez` `Seychelles`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Island group
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name eco:isLeastSpecificTargetCategoryQuantityInclusive
Term IRI	http://rs.tdwg.org/eco/terms/isLeastSpecificTargetCategoryQuantityInclusive
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isLeastSpecificTargetCategoryQuantityInclusive-2026-09-17
Label	Is Least Specific Target Category Quantity Inclusive
Definition	The total detected quantity for a dwc:Taxon (including subcategories thereof) in an eco:Survey is given explicitly in a single record (dwc:organismQuantity value) for that dwc:Taxon.
Notes	This term is only relevant if dwc:organismQuantity is a number. For a detailed explanation, see http://rs.tdwg.org/dwc/doc/inclusive/. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_46
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isLifeStageScopeFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/isLifeStageScopeFullyReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isLifeStageScopeFullyReported-2026-09-17
Label	Is Life Stage Scope Fully Reported
Definition	Every dwc:Occurrence that was included within the life stage scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an dwc:Survey used restricted search or open search methods. If all dwc:Occurrences included within the life stage scope and detected during an eco:Survey were reported, the value should be 'true'. Life stage scope is based on the combination of eco:targetLifeStageScope and eco:excludedLifeStageScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:isPartOfMaterialEntityID
Term IRI	http://rs.tdwg.org/dwc/terms/isPartOfMaterialEntityID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/isPartOfMaterialEntityID-2026-09-17
Label	Is Part Of MaterialEntity ID
Definition	An identifier for a dwc:MaterialEntity of which this dwc:MaterialEntity is a part.
Notes	A dwc:MaterialEntity was not taken from (derived from) a dwc:MaterialEntity of which it is a part. Recommended best practice is to use a globally unique identifier. The hierarchical relationship supported by this term allows for the atomization of individual parts of a dwc:MaterialEntity, such as a specimen composed of two minerals (Pyrite and Quartz), each with its own characteristics and potential dwc:Assertions.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isSamplingEffortReported
Term IRI	http://rs.tdwg.org/eco/terms/isSamplingEffortReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isSamplingEffortReported-2026-09-17
Label	Is Sampling Effort Reported
Definition	The sampling effort associated with an eco:Survey was reported.
Notes	Typically values of effort would be captured under the terms eco:samplingEffortValue and eco:samplingEffortUnit. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isSurveyTargetFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/isSurveyTargetFullyReported
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/isSurveyTargetFullyReported-2026-05-26
Label	Is Survey Target Fully Reported
Definition	Whether an eco:SurveyTarget can be used to infer absence of detection because all counts of detected dwc:Occurrences matching an eco:SurveyTarget were fully reported.
Notes	Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/. If True (the survey target is fully reported - nothing was left unreported), then this enables inference of absence of detection for everything in that eco:SurveyTarget that is included but that does not appear in the counts (absent counts signify absence of detection).
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:isTaxonomicScopeFullyReported
Term IRI	http://rs.tdwg.org/eco/terms/isTaxonomicScopeFullyReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isTaxonomicScopeFullyReported-2026-09-17
Label	Is Taxonomic Scope Fully Reported
Definition	Every dwc:Occurrence that was included within the taxonomic scope, and was detected during an eco:Survey, was reported.
Notes	This term is only relevant if an eco:Survey used restricted search or open search methods. If all dwc:Occurrences included within the taxonomic scope and detected during an eco:Survey were reported, the value should be 'true'. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:isVegetationCoverReported
Term IRI	http://rs.tdwg.org/eco/terms/isVegetationCoverReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/isVegetationCoverReported-2026-09-17
Label	Is Vegetation Cover Reported
Definition	A vegetation cover metric was reported.
Notes	Typically values or descriptions of vegetation cover would be captured under the term eco:verbatimSiteDescriptions. Recommended best practice is to follow the TDWG Boolean Controlled Vocabulary http://rs.tdwg.org/tag/doc/boolean/.
Examples	`true` `false`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:kingdom
Term IRI	http://rs.tdwg.org/dwc/terms/kingdom
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/kingdom-2023-06-28
Label	Kingdom
Definition	The full scientific name of the kingdom in which the dwc:Taxon is classified.
Examples	`Animalia` `Archaea` `Bacteria` `Chromista` `Fungi` `Plantae` `Protozoa` `Viruses`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = regnum
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dc:language
Term IRI	http://purl.org/dc/elements/1.1/language
Modified	2023-06-28
Term version IRI	http://dublincore.org/usage/terms/history/#language-007
Label	Language
Definition	A language of the resource.
Notes	Recommended best practice is to use a controlled vocabulary such as RFC 5646. This term has an equivalent in the dcterms: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`en` (for English) `es` (for Spanish)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Term Name dcterms:language
Term IRI	http://purl.org/dc/terms/language
Modified	2008-01-14
Term version IRI	http://dublincore.org/usage/terms/history/#languageT-001
Label	Language
Definition	A language of the resource.
Notes	Recommended best practice is to use an IRI from the Library of Congress ISO 639-2 scheme http://id.loc.gov/vocabulary/iso639-2
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Term Name dwc:latestAgeOrHighestStage
Term IRI	http://rs.tdwg.org/dwc/terms/latestAgeOrHighestStage
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/latestAgeOrHighestStage-2023-09-13
Label	Latest Age Or Highest Stage
Definition	The full name of the latest possible geochronologic age or highest chronostratigraphic stage attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Atlantic` `Boreal` `Skullrockian`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name chrono:latestChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/latestChronometricAge
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/latestChronometricAge-2025-06-12
Label	Latest Chronometric Age
Definition	The minimum/latest/youngest possible age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated chrono:latestChronometricAgeReferenceSystem.
Examples	`27`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-ChronostratigraphicAttribution-LowerValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:latestChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/terms/latestChronometricAgeReferenceSystem
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/latestChronometricAgeReferenceSystem-2025-06-12
Label	Latest Chronometric Age Reference System
Definition	The reference system associated with the chrono:latestChronometricAge.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`kya` `mya` `BP` `AD` `BCE` `ka` `Ma` `Ga`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chronoiri:latestChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/iri/latestChronometricAgeReferenceSystem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/latestChronometricAgeReferenceSystem-2026-05-26
Label	Latest Chronometric Age Reference System (IRI)
Definition	The reference system associated with the chrono:latestChronometricAge.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name dwc:LatestDateCollected
Term IRI	http://rs.tdwg.org/dwc/terms/LatestDateCollected
Modified	2009-04-24
Label	Latest Date Collected
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventDate
Definition	The latest date-time in a period during which a event occurred. If the event is recorded as occurring at a single date-time, populate both EarliestDateCollected and LatestDateCollected with the same value. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/ISODateTimeEnd
Type	Property

Term Name dwc:latestEonOrHighestEonothem
Term IRI	http://rs.tdwg.org/dwc/terms/latestEonOrHighestEonothem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/latestEonOrHighestEonothem-2026-05-26
Label	Latest Eon Or Highest Eonothem
Definition	The full name of the latest possible geochronologic eon or highest chronostratigraphic eonothem or the informal name attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Phanerozoic` `Proterozoic` `Precambrian`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:latestEpochOrHighestSeries
Term IRI	http://rs.tdwg.org/dwc/terms/latestEpochOrHighestSeries
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/latestEpochOrHighestSeries-2023-09-13
Label	Latest Epoch Or Highest Series
Definition	The full name of the latest possible geochronologic epoch or highest chronostratigraphic series attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Holocene` `Pleistocene` `Ibexian Series`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:latestEraOrHighestErathem
Term IRI	http://rs.tdwg.org/dwc/terms/latestEraOrHighestErathem
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/latestEraOrHighestErathem-2023-09-13
Label	Latest Era Or Highest Erathem
Definition	The full name of the latest possible geochronologic era or highest chronostratigraphic erathem attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Cenozoic` `Mesozoic`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:latestGeochronologicalEra
Term IRI	http://rs.tdwg.org/dwc/iri/latestGeochronologicalEra
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/iri/version/latestGeochronologicalEra-2023-09-13
Label	Latest Geochronological Era
Definition	Use to link a dwc:GeologicalContext instance to chronostratigraphic time periods at the lowest possible level in a standardized hierarchy. Use this property to point to the latest possible geological time period from which the dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. A "convenience property" that replaces Darwin Core literal-value terms related to geological context. See Section 2.7.6 of the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:latestPeriodOrHighestSystem
Term IRI	http://rs.tdwg.org/dwc/terms/latestPeriodOrHighestSystem
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/latestPeriodOrHighestSystem-2023-09-13
Label	Latest Period Or Highest System
Definition	The full name of the latest possible geochronologic period or highest chronostratigraphic system attributable to the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Neogene` `Tertiary` `Quaternary`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dcterms:license
Term IRI	http://purl.org/dc/terms/license
Modified	2023-06-28
Term version IRI	http://dublincore.org/usage/terms/history/#license-002
Label	License
Definition	A legal document giving official permission to do something with the resource.
Examples	`http://creativecommons.org/publicdomain/zero/1.0/legalcode` `http://creativecommons.org/licenses/by/4.0/legalcode`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-11-06_17
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:lifeStage
Term IRI	http://rs.tdwg.org/dwc/iri/lifeStage
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/lifeStage-2026-05-26
Label	Life Stage (IRI)
Definition	An age class or life stage of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:lifeStage
Term IRI	http://rs.tdwg.org/dwc/terms/lifeStage
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/lifeStage-2026-05-26
Label	Life Stage
Definition	An age class or life stage of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`zygote` `larva` `juvenile` `adult` `seedling` `flowering` `fruiting`
ABCD equivalence	DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalSexualStage or DataSets/DataSet/Units/Unit/MycologicalUnit/MycologicalLiveStages/MycologicalLiveStage or DataSets/DataSet/Units/Unit/ZoologicalUnit/PhasesOrStages/PhaseOrStage
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:lithodemicUnit
Term IRI	http://rs.tdwg.org/dwc/terms/lithodemicUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/lithodemicUnit-2026-09-17
Label	Lithodemic Unit
Definition	A geologic unit that lacks stratification, is primarily comprised of intrusive, deformed, and/or metamorphosed rock, and is characterized by irregularly mixed lithology or highly complicated structural relations.
Notes	Due to the unstructured nature of complexes, both named units and lithological descriptive terms are acceptable values.
Examples	`Catalina Core Complex` `injection complex` `New England Plutonic Suite` `Sierra Nevada batholith`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:lithostratigraphicTerms
Term IRI	http://rs.tdwg.org/dwc/terms/lithostratigraphicTerms
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/lithostratigraphicTerms-2025-06-12
Label	Lithostratigraphic Terms
Definition	The combination of all lithostratigraphic names for the rock from which the dwc:MaterialEntity was collected.
Examples	`Pleistocene-Weichselien`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Stratigraphy/LithostratigraphicTerms
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:LivingSpecimen
Term IRI	http://rs.tdwg.org/dwc/terms/LivingSpecimen
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/LivingSpecimen-2023-09-18
Label	Living Specimen
Definition	A specimen that is alive.
Examples	`a living plant in a botanical garden` `a living animal in a zoo`
ABCD equivalence	RecordBasisEnum/LivingSpecimen
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwc:locality
Term IRI	http://rs.tdwg.org/dwc/terms/locality
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/locality-2023-06-28
Label	Locality
Definition	The specific description of the place.
Notes	Less specific geographic information can be provided in other geographic terms (dwc:higherGeography, dwc:continent, dwc:country, dwc:stateProvince, dwc:county, dwc:municipality, dwc:waterBody, dwc:island, dwc:islandGroup). This term may contain information modified from the original to correct perceived errors or standardize the description.
Examples	`Bariloche, 25 km NNE via Ruta Nacional 40 (=Ruta 237)` `Queets Rainforest, Olympic National Park`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dcterms:Location
Term IRI	http://purl.org/dc/terms/Location
Modified	2023-09-18
Term version IRI	http://dublincore.org/usage/terms/history/#Location-001
Label	Location
Definition	A spatial region or named place.
Examples	`the municipality of San Carlos de Bariloche, Río Negro, Argentina` `the place defined by a georeference`
ABCD equivalence	not in ABCD
Type	Class

Term Name dwc:locationAccordingTo
Term IRI	http://rs.tdwg.org/dwc/terms/locationAccordingTo
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/locationAccordingTo-2023-06-28
Label	Location According To
Definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Getty Thesaurus of Geographic Names` `GADM`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:locationAccordingTo
Term IRI	http://rs.tdwg.org/dwc/iri/locationAccordingTo
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/locationAccordingTo-2025-07-10
Label	Location According To (IRI)
Definition	Information about the source of this dcterms:Location information. Could be a publication (gazetteer), institution, or team of individuals.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:locationAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/locationAttributes
Modified	2014-10-23
Label	Location Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the location.
Notes	Example: "aspectheading=277; slopeindegrees=6"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:locationID
Term IRI	http://rs.tdwg.org/dwc/terms/locationID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/locationID-2026-05-26
Label	Location ID
Definition	An identifier for a dcterms:Location.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`https://opencontext.org/subjects/768A875F-E205-4D0B-DE55-BAB7598D0FD1`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:locationRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/locationRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/locationRemarks-2023-06-28
Label	Location Remarks
Definition	Comments or notes about the dcterms:Location.
Examples	`under water since 2005`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type	Property

Term Name dwc:lowestBiostratigraphicZone
Term IRI	http://rs.tdwg.org/dwc/terms/lowestBiostratigraphicZone
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/lowestBiostratigraphicZone-2023-09-13
Label	Lowest Biostratigraphic Zone
Definition	The full name of the lowest possible geological biostratigraphic zone of the stratigraphic horizon from which the dwc:MaterialEntity was collected.
Examples	`Maastrichtian`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:MachineObservation
Term IRI	http://rs.tdwg.org/dwc/terms/MachineObservation
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MachineObservation-2023-09-18
Label	Machine Observation
Definition	An output of a machine observation process.
Examples	`a photograph` `a video` `an audio recording` `a remote sensing image` `a dwc:Occurrence record based on telemetry`
ABCD equivalence	RecordBasisEnum/MachineObservation
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwc:MaterialCitation
Term IRI	http://rs.tdwg.org/dwc/terms/MaterialCitation
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MaterialCitation-2023-09-18
Label	Material Citation
Definition	A reference to or citation of one, a part of, or multiple specimens in scholarly publications.
Notes	This class constitutes a new value for the controlled vocabulary in the recommendations for basisOfRecord. When importing Darwin Core Archives of literature-based datasets to GBIF, the basisOfRecord should be changed from "Occurrence", "PreservedSpecimen" or "Literature" to "MaterialCitation".
Examples	`a citation of a physical specimen from a scientific collection in a taxonomic treatment in a scientific publication` `a citation of a group of physical specimens, such as paratypes in a taxonomic treatment in a scientific publication`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Term Name chronoiri:materialDated
Term IRI	http://rs.tdwg.org/chrono/iri/materialDated
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/chrono/iri/version/materialDated-2026-05-26
Label	Material Dated (IRI)
Definition	The material on which the chrono:chronometricAgeProtocol was actually performed.
Notes	Terms in the chronoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_49
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_60

Term Name chrono:materialDated
Term IRI	http://rs.tdwg.org/chrono/terms/materialDated
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/materialDated-2025-06-12
Label	Material Dated
Definition	A description of the material on which the chrono:chronometricAgeProtocol was actually performed, if known.
Notes	This term has an equivalent in the chronoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Double Tuff` `Charcoal found in Stratum V` `charred wood` `tooth`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-MaterialDated
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:materialDatedID
Term IRI	http://rs.tdwg.org/chrono/terms/materialDatedID
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/materialDatedID-2025-06-12
Label	Material Dated ID
Definition	An identifier for the dwc:MaterialEntity on which the chrono:chronometricAgeProtocol was performed, if applicable.
Examples	`dwc:materialEntityID: https://www.ebi.ac.uk/metagenomics/samples/SRS1930158`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name chrono:materialDatedRelationship
Term IRI	http://rs.tdwg.org/chrono/terms/materialDatedRelationship
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/chrono/terms/version/materialDatedRelationship-2025-06-12
Label	Material Dated Relationship
Definition	The relationship of the chrono:materialDated to the subject of the chrono:ChronometricAge record, from which the chrono:ChronometricAge of the subject is inferred.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`sameAs` (cases where the subject material was completely destructively subsampled to get the ChronometricAge) `subsampleOf` (cases where part of the original specimen was extracted as the material used to determine the ChronometricAge) `inContextWith` (cases where the ChronometricAge is inferred from materialDated, such as sediments or cultural objects, in related temporal context) `stratigraphicallyCorrelatedWith` (cases where the ChronometricAge is inferred from materialDated in a stratigraphically correlated context)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_45

Term Name dwc:materialDescription
Term IRI	http://rs.tdwg.org/dwc/terms/materialDescription
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialDescription-2026-09-17
Label	Material Description
Definition	Remarks on the physical characteristics of a dwc:MaterialEntity, particularly those that distinguish it from otherwise similar dwc:MaterialEntities.
Examples	`Showpiece` `Historically valuable` `Extraordinary composition` `Two generations of quartz`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:MaterialEntity
Term IRI	http://rs.tdwg.org/dwc/terms/MaterialEntity
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MaterialEntity-2026-05-26
Label	Material Entity
Definition	An entity that can be identified, exists for some period of time, and consists in whole or in part of physical matter while it exists.
Notes	The term is defined at the most general level to admit descriptions of any subtype of material entity within the scope of Darwin Core. In particular, any kind of material sample, preserved specimen, fossil, or exemplar from living collections is intended to be subsumed under this term. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`the entire contents of a trawl` `a subset of the contents of a trawl` `the body of a fish` `the stomach contents of a fish` `a rock containing fossils` `a fossil within a rock` `an herbarium sheet with its attached plant specimen` `a flower on a plant specimen` `a pollen grain` `a specific water sample` `an isolated molecule of DNA`
ABCD equivalence	not in ABCD (Specimen Unit, when used to denote a class of things, appears to be a broadly construed subclass.)
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:materialEntityCategory
Term IRI	http://rs.tdwg.org/dwc/terms/materialEntityCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialEntityCategory-2026-05-26
Label	Material Entity Category
Definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`liveOrganism`, `deadOrganism`, `partOfOrganism`, `nonMolecularBiologicalExtract`, `molecularBiologicalExtract`, `mineral`, `rock`, `fossil`, `chemical`, `humanArtifactWithBiologicalConstituent`, `humanArtifactWithoutBiologicalConstituent`, and `mixed`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:materialEntityCategory
Term IRI	http://rs.tdwg.org/dwc/iri/materialEntityCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/materialEntityCategory-2026-05-26
Label	Material Entity Category (IRI)
Definition	A high-level, mutually exclusive classification describing the fundamental substance and origin of a dwc:MaterialEntity.
Notes	Recommended best practice is to use a limited, tightly controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:materialEntityID
Term IRI	http://rs.tdwg.org/dwc/terms/materialEntityID
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialEntityID-2023-09-13
Label	Material Entity ID
Definition	An identifier for a particular instance of a dwc:MaterialEntity.
Notes	Values of dwc:materialEntityID are intended to uniquely and persistently identify a particular dwc:MaterialEntity within some context. Examples of context include a particular sample collection, an organization, or the worldwide scale. Recommended best practice is to use a persistent, globally unique identifier. The identifier is bound to a physical object (the dwc:MaterialEntity) as opposed to a particular digital record (representation) of that physical object.
Examples	`06809dc5-f143-459a-be1a-6f03e63fc083`
ABCD equivalence	Unit/UnitGUID or Unit/UnitID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:materialEntityRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/materialEntityRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialEntityRemarks-2026-05-26
Label	Material Entity Remarks
Definition	Comments or notes about a dwc:MaterialEntity.
Examples	`found in association with charred remains` `some original fragments missing`
ABCD equivalence	DataSets/DataSet/Units/Unit/Notes
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:materialEntityType
Term IRI	http://rs.tdwg.org/dwc/terms/materialEntityType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialEntityType-2026-05-26
Label	Material Entity Type
Definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
ABCD equivalence	skos:closeMatch to /DataSets/DataSet/Units/Unit/KindOfUnit. ABCD structural considerations prevent an exactMatch.
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:materialEntityType
Term IRI	http://rs.tdwg.org/dwc/iri/materialEntityType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/materialEntityType-2026-05-26
Label	Material Entity Type (IRI)
Definition	A more generic classification of a dwc:MaterialEntity than dwc:preparations but less broad than dwc:materialCategory.
Notes	A more generic classification of a dwc:MaterialEntity than dwc:preparations. Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:materialProportion
Term IRI	http://rs.tdwg.org/dwc/iri/materialProportion
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/materialProportion-2026-09-17
Label	Material Proportion (IRI)
Definition	The qualitative or quantitative abundance of a dwc:MaterialEntity with respect to another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as http://resource.geosciml.org/classifier/cgi/proportionterm. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:materialProportion
Term IRI	http://rs.tdwg.org/dwc/terms/materialProportion
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialProportion-2026-09-17
Label	Material Proportion
Definition	The qualitative or quantitative abundance of a dwc:MaterialEntity with respect to another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as http://resource.geosciml.org/classifier/cgi/proportionterm. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`20%` `minor` `dominant`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:materialRole
Term IRI	http://rs.tdwg.org/dwc/terms/materialRole
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialRole-2026-09-17
Label	Material Role
Definition	A category that best matches the nature of the relationship between a dwc:MaterialEntity and another dwc:MaterialEntity of which it is a part.
Notes	Roles depend on both the part and the parent object. For instance, a rock (material category) within the parent specimen serves as a clast and depends on both the specimen part and the parent specimen for its existence. Recommended best practice is to use a controlled vocabulary such as IUGS CGI Compound Material Consituent Part, http://resource.geosciml.org/classifier/cgi/compoundmaterialconstituentpartrole. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`matrix` `groundmass` `phenocryst` `xenolith` `vein`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:materialRole
Term IRI	http://rs.tdwg.org/dwc/iri/materialRole
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/materialRole-2026-09-17
Label	Material Role (IRI)
Definition	A category that best matches the nature of the relationship between a dwc:MaterialEntity and another dwc:MaterialEntity of which it is a part.
Notes	Recommended best practice is to use a controlled vocabulary such as IUGS CGI Compound Material Consituent Part, http://resource.geosciml.org/classifier/cgi/compoundmaterialconstituentpartrole. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:MaterialSample
Term IRI	http://rs.tdwg.org/dwc/terms/MaterialSample
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MaterialSample-2026-09-17
Label	Material Sample
Definition	A material entity that represents an entity of interest in whole or in part.
Notes	It is recommended to use dwc:MaterialEntity in place of this term.
Examples	`a whole organism preserved in a collection` `a part of an organism isolated for some purpose` `a soil sample` `a marine microbial sample`
ABCD equivalence	DataSets/DataSet/Units/Unit
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2013-10-09_11
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:materialSampleID
Term IRI	http://rs.tdwg.org/dwc/terms/materialSampleID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/materialSampleID-2026-09-17
Label	Material Sample ID
Definition	An identifier for the dwc:MaterialSample (as opposed to a particular digital record of the dwc:MaterialSample). In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:materialSampleID globally unique.
Notes	It is recommended to use dwc:materialEntityID in place of this term.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2013-10-09_13
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:materialSampleTypes
Term IRI	http://rs.tdwg.org/eco/iri/materialSampleTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/materialSampleTypes-2026-09-17
Label	Material Sample Types
Definition	A material sample type collected during the eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:materialSampleTypes
Term IRI	http://rs.tdwg.org/eco/terms/materialSampleTypes
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/materialSampleTypes-2026-09-17
Label	Material Sample Types
Definition	A list (concatenated and separated) of material sample types collected during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`wholeOrganism` `skeleton` `tissue \| blood \| fecal \| stomachContent`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name chrono:maximumChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/maximumChronometricAge
Modified	2021-01-26
Label	Maximum Chronometric Age
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/chrono/terms/earliestChronometricAge
Definition	Upper limit for the age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated maximumChronometricAgeReferenceSystem.
Examples	`27`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:StratigraphicAttributions-ChronostratigraphicAttribution-UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name chrono:maximumChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/terms/maximumChronometricAgeReferenceSystem
Modified	2021-01-26
Label	Maximum Chronometric Age Reference System
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/chrono/terms/earliestChronometricAgeReferenceSystem
Definition	The reference system associated with the maximumChronometricAge.
Examples	`kya`,`mya`,`BP`,`AD`,`BCE`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-TimeUnit
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name dwc:maximumDepthInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/maximumDepthInMeters
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/maximumDepthInMeters-2026-05-26
Label	Maximum Depth In Meters
Definition	The greatest depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`0` `200`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:maximumDistanceAboveSurfaceInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/maximumDistanceAboveSurfaceInMeters
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/maximumDistanceAboveSurfaceInMeters-2023-06-28
Label	Maximum Distance Above Surface In Meters
Definition	The greater distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Property

Term Name dwc:maximumElevationInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/maximumElevationInMeters
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/maximumElevationInMeters-2026-05-26
Label	Maximum Elevation In Meters
Definition	The greatest elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`-205` `1236`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:measuredChemistry
Term IRI	http://rs.tdwg.org/dwc/terms/measuredChemistry
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measuredChemistry-2026-09-17
Label	Measured Chemistry
Definition	A concise expression of the chemical composition of a mineral that shows the number of atoms of each element in a molecule, their spatial arrangement, and their linkage to each other.
Examples	`SiO2 (65.76)` `TiO2 (32.120)` `Al2O3 (2.21)` `(Mg0.77Fe0.23)2SiO4` `An6.4 Ab73.6 Or20`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:measuredChemistrySource
Term IRI	http://rs.tdwg.org/dwc/terms/measuredChemistrySource
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measuredChemistrySource-2026-09-17
Label	Measured Chemistry Source
Definition	A list (concatenated and separated) of resources associated with the reported measured chemistry described specifically enough to allow anyone in the future to use the same resources.
Notes	Recommended best practice is to use full bibliographic citations, global unique identifiers, or resolvable and persistent IRIs. See the broader concept http://rs.tdwg.org/dwc/terms/associatedReferences. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Novak, G. A., & Gibbs, G. V. (1971). The crystal chemistry of the silicate garnets. American Mineralogist: Journal of Earth and Planetary Materials, 56(5-6), 791-825.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:measuredChemistrySource
Term IRI	http://rs.tdwg.org/dwc/iri/measuredChemistrySource
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measuredChemistrySource-2026-09-17
Label	Measured Chemistry Source (IRI)
Definition	A list (concatenated and separated) of resources associated with the reported measured chemistry described specifically enough to allow anyone in the future to use the same resources.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:measuredMassInGrams
Term IRI	http://rs.tdwg.org/dwc/terms/measuredMassInGrams
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measuredMassInGrams-2026-09-17
Label	Measured Mass In Grams
Definition	Mass of a dwc:MaterialEntity, measured in grams.
Examples	`0.03` `2.34` `56.6`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:measurementAccuracy
Term IRI	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementAccuracy-2023-06-28
Label	Measurement Accuracy
Definition	The description of the potential error associated with the dwc:measurementValue.
Examples	`0.01` `normal distribution with variation of 2 m`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Aspect/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Accuracy or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:measurementDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedBy
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedBy-2023-06-28
Label	Measurement Determined By
Definition	A list (concatenated and separated) of names of people, groups, or organizations who determined the value of the dwc:MeasurementOrFact.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Rob Guralnick` `Peter Desmet \| Stijn Van Hoey`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasuredBy
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwciri:measurementDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/iri/measurementDeterminedBy
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measurementDeterminedBy-2025-07-10
Label	Measurement Determined By (IRI)
Definition	A person, group, or organization who determined the value of the dwc:MeasurementOrFact.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:measurementDeterminedDate
Term IRI	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementDeterminedDate-2025-06-12
Label	Measurement Determined Date
Definition	The date on which the dwc:MeasurementOrFact was made.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:measurementID
Term IRI	http://rs.tdwg.org/dwc/terms/measurementID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementID-2023-06-28
Label	Measurement ID
Definition	An identifier for the dwc:MeasurementOrFact (information pertaining to measurements, facts, characteristics, or assertions). May be a global unique identifier or an identifier specific to the data set.
Examples	`9c752d22-b09a-11e8-96f8-529269fb1459`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:measurementMethod
Term IRI	http://rs.tdwg.org/dwc/iri/measurementMethod
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measurementMethod-2025-07-10
Label	Measurement Method (IRI)
Definition	The method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:measurementMethod
Term IRI	http://rs.tdwg.org/dwc/terms/measurementMethod
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementMethod-2023-06-28
Label	Measurement Method
Definition	A description of or reference to (publication, URI) the method or protocol used to determine the measurement, fact, characteristic, or assertion.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minimum convex polygon around burrow entrances` (for a home range area) `barometric altimeter` (for an elevation)
ABCD equivalence	/DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/Method or /DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/Method
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:MeasurementOrFact
Term IRI	http://rs.tdwg.org/dwc/terms/MeasurementOrFact
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MeasurementOrFact-2023-09-13
Label	Measurement Or Fact
Definition	A measurement of or fact about an rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource).
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`the weight of a dwc:Organism in grams` `the number of placental scars` `surface water temperature in Celsius`
ABCD equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:measurementRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/measurementRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementRemarks-2023-06-28
Label	Measurement Remarks
Definition	Comments or notes accompanying the dwc:MeasurementOrFact.
Examples	`tip of tail missing`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:measurementType
Term IRI	http://rs.tdwg.org/dwc/terms/measurementType
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementType-2023-06-28
Label	Measurement Type
Definition	The nature of the measurement, fact, characteristic, or assertion.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tail length` `temperature` `trap line length` `survey area` `trap type`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:measurementType
Term IRI	http://rs.tdwg.org/dwc/iri/measurementType
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measurementType-2025-07-10
Label	Measurement Type (IRI)
Definition	The nature of the measurement, fact, characteristic, or assertion.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:measurementUnit
Term IRI	http://rs.tdwg.org/dwc/terms/measurementUnit
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementUnit-2023-06-28
Label	Measurement Unit
Definition	The units associated with the dwc:measurementValue.
Notes	Recommended best practice is to use the International System of Units (SI). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`m` `g` `l` `°C` `mm` `km²` `%` `hh:mm:ss`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwciri:measurementUnit
Term IRI	http://rs.tdwg.org/dwc/iri/measurementUnit
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measurementUnit-2023-06-28
Label	Measurement Unit (IRI)
Definition	The units associated with the dwc:measurementValue.
Notes	Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:measurementValue
Term IRI	http://rs.tdwg.org/dwc/iri/measurementValue
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/measurementValue-2025-07-10
Label	Measurement Value (IRI)
Definition	The value of the measurement, fact, characteristic, or assertion.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://vocab.nerc.ac.uk/collection/L22/current/TOOL0960/`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:measurementValue
Term IRI	http://rs.tdwg.org/dwc/terms/measurementValue
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/measurementValue-2023-06-28
Label	Measurement Value
Definition	The value of the measurement, fact, characteristic, or assertion.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`45` `20` `1` `14.5` `UV-light`
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/SiteMeasurementOrFact/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Biotope/MeasurementsOrFacts/MeasurementOrFactAtomised/UpperValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/UpperValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name ac:Media
Term IRI	http://rs.tdwg.org/ac/terms/Media
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/ac/terms/version/Media-2026-02-24
Label	Media Entity
Definition	A digital or physical media resource.
Notes	An instance of digital textual media may be better represented as a dcterms:BibliographicResource.
Examples	`dcmi:Sound` `dcmi:StillImage` `dcmi:MovingImage` `dcmi:InteractiveResource` `ac:Digital3DResource`
ABCD equivalence	This term is equivalent to the ABCD term http://rs.tdwg.org/abcd/terms/MultimediaObject .
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:member
Term IRI	http://rs.tdwg.org/dwc/terms/member
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/member-2023-09-13
Label	Member
Definition	The full name of the lithostratigraphic member from which the dwc:MaterialEntity was collected.
Examples	`Lava Dam Member` `Hellnmaria Member`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:mineralogicalAnalysisProtocol
Term IRI	http://rs.tdwg.org/dwc/terms/mineralogicalAnalysisProtocol
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/mineralogicalAnalysisProtocol-2026-09-17
Label	Mineralogical Analysis Protocol
Definition	A technique used to determine the chemical composition or crystallography of a mineral.
Notes	Acronyms should be avoided even for widely recognized annotations. Recommended best practice is to use a controlled vocabulary such as https://vocabs.ardc.edu.au/viewById/650. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Wet Chemistry` `X-ray fluorescence` `Electron probe microanalysis` `Scanning electron microscopy with energy-dispersive X-ray spectroscopy` `X-ray diffraction`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:mineralogicalAnalysisProtocol
Term IRI	http://rs.tdwg.org/dwc/iri/mineralogicalAnalysisProtocol
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/mineralogicalAnalysisProtocol-2026-09-17
Label	Mineralogical Analysis Protocol (IRI)
Definition	A technique used to determine the chemical composition or crystallography of a mineral.
Notes	Recommended best practice is to use a controlled vocabulary such as https://vocabs.ardc.edu.au/viewById/650. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:mineralSequence
Term IRI	http://rs.tdwg.org/dwc/terms/mineralSequence
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/mineralSequence-2026-09-17
Label	Mineral Sequence
Definition	A list (concatenated and separated) of minerals in a dwc:GeologicalMaterial, ordered in a manner that illustrates the relative timing of mineral formation.
Notes	The list should only contain minerals that belong to a readily identifiable sequence of formation. Therefore, a list may contain a subset of the minerals in a specimen. Minerals that formed in-situ with one another are separated by a plus. Minerals that formed in the sequence are separated by a greater than (' > ') symbol.
Examples	`Sphalerite > Quartz > Pyrite` `Calcite > Quartz > Sphalerite > Pyrite`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name chrono:minimumChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/minimumChronometricAge
Modified	2021-01-26
Label	Minimum Chronometric Age
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/chrono/terms/latestChronometricAge
Definition	Lower limit for the age of a specimen as determined by a dating method.
Notes	The expected unit for this field is years. This field, if populated, must have an associated maximumChronometricAgeReferenceSystem.
Examples	`100`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-ChronostratigraphicAttribution-LowerValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name chrono:minimumChronometricAgeReferenceSystem
Term IRI	http://rs.tdwg.org/chrono/terms/minimumChronometricAgeReferenceSystem
Modified	2021-01-26
Label	Minimum Chronometric Age Reference System
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/chrono/terms/latestChronometricAgeReferenceSystem
Definition	The reference system associated with the minimumChronometricAge.
Examples	`kya`,`mya`,`BP`,`AD`,`BCE`
ABCD equivalence	https://terms.tdwg.org/wiki/abcd-efg:UnitStratigraphicDetermination-TimeUnit
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name dwc:minimumDepthInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/minimumDepthInMeters
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/minimumDepthInMeters-2026-05-26
Label	Minimum Depth In Meters
Definition	The least depth within a range of depths, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`0` `100`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactAtomised/LowerValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:minimumDistanceAboveSurfaceInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/minimumDistanceAboveSurfaceInMeters
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/minimumDistanceAboveSurfaceInMeters-2023-06-28
Label	Minimum Distance Above Surface In Meters
Definition	The lesser distance in a range of distance from a reference surface in the vertical direction, in meters. Use positive values for locations above the surface, negative values for locations below. If depth measures are given, the reference surface is the location given by the depth, otherwise the reference surface is the location given by the elevation.
Examples	`-1.5` (below the surface) `4.2` (above the surface) For a 1.5 meter sediment core from the bottom of a lake (at depth 20m) at 300m elevation: verbatimElevation: `300m` minimumElevationInMeters: `300`, maximumElevationInMeters: `300`, verbatimDepth: `20m`, minimumDepthInMeters: `20`, maximumDepthInMeters: `20`, minimumDistanceAboveSurfaceInMeters: `0`, maximumDistanceAboveSurfaceInMeters: `-1.5`.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Height/MeasurementOrFactAtomised/LowerValue
Type	Property

Term Name dwc:minimumElevationInMeters
Term IRI	http://rs.tdwg.org/dwc/terms/minimumElevationInMeters
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/minimumElevationInMeters-2026-05-26
Label	Minimum Elevation In Meters
Definition	The least elevation within a range of elevations, measured relative to the vertical reference surface indicated by the value of dwc:verticalDatum.
Notes	See https://docs.gbif.org/georeferencing-best-practices/1.0/en/#img-depth-elevation-distance-above-surface.
Examples	`-100` `802`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactAtomised/LowerValue
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dcterms:modified
Term IRI	http://purl.org/dc/terms/modified
Modified	2025-06-12
Term version IRI	http://dublincore.org/usage/terms/history/#modified-003
Label	Date Modified
Definition	Date on which the resource was changed.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55

Term Name dwc:MolecularProtocol
Term IRI	http://rs.tdwg.org/dwc/terms/MolecularProtocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/MolecularProtocol-2026-05-26
Label	Molecular Protocol
Definition	A protocol used to perform a dwc:NucleotideAnalysis and potentially derive a dwc:NucleotideSequence from a dwc:MaterialEntity.
Examples	`a standard DNA barcoding workflow using Sanger sequencing` `a shotgun metagenomics pipeline for microbial community profiling` `a high-throughput amplicon sequencing protocol targeting 16S rRNA`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:molecularProtocolID
Term IRI	http://rs.tdwg.org/dwc/terms/molecularProtocolID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/molecularProtocolID-2026-05-26
Label	Molecular Protocol ID
Definition	An identifier for a dwc:MolecularProtocol.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:month
Term IRI	http://rs.tdwg.org/dwc/terms/month
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/month-2023-06-28
Label	Month
Definition	The integer month in which the dwc:Event occurred.
Examples	`1` (January) `10` (October)
ABCD equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Property

Term Name dwc:municipality
Term IRI	http://rs.tdwg.org/dwc/terms/municipality
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/municipality-2023-06-28
Label	Third Order Division
Definition	The full, unabbreviated name of the next smaller administrative region than county (city, municipality, etc.) in which the dcterms:Location occurs. Do not use this term for a nearby named place that does not contain the actual dcterms:Location.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Holzminden` `Araçatuba` `Ga-Segonyana`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:nameAccordingTo
Term IRI	http://rs.tdwg.org/dwc/terms/nameAccordingTo
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/nameAccordingTo-2026-05-26
Label	Name According To
Definition	The reference to the source in which the specific taxon concept circumscription is defined or implied - traditionally signified by the Latin "sensu" or "sec." (from secundum, meaning "according to"). For taxa that result from identifications, a reference to the keys, monographs, experts and other sources should be given.
Notes	This term provides context to the dwc:scientificName. Together with the dwc:scientificName, separated by `sensu` or `sec.`, it forms the taxon concept label, which may be seen as having the same relationship to dwc:taxonConceptID as, for example, dwc:acceptedNameUsage has to dwc:acceptedNameUsageID. When not provided, in Taxon Core data sets the dwc:nameAccordingTo can be taken to be the data set. In this case the data set mostly provides sufficient context to infer the delimitation of the taxon and its relationship with other taxa. In Occurrence Core data sets, when not provided, dwc:nameAccordingTo can be an underlying taxonomy of the data set, e.g., Plants of the World Online (http://powo.science.kew.org/) for vascular plant records in iNaturalist (in which case it should be provided), or, which is the case for most dwc:PreservedSpecimen data sets, the dwc:Identification, in which case there is no further context.
Examples	`Franz NM, Cardona-Duque J (2013) Description of two new species and phylogenetic reassessment of Perelleschus Wibmer & O’Brien, 1986 (Coleoptera: Curculionidae), with a complete taxonomic concept history of Perelleschus sec. Franz & Cardona-Duque, 2013. Syst Biodivers. 11: 209–236.` (as the full citation of the Franz & Cardona-Duque (2013) in Perelleschus splendida sec. Franz & Cardona-Duque (2013))
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:nameAccordingToID
Term IRI	http://rs.tdwg.org/dwc/terms/nameAccordingToID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/nameAccordingToID-2023-06-28
Label	Name According To ID
Definition	An identifier for the source in which the specific taxon concept circumscription is defined or implied. See dwc:nameAccordingTo.
Examples	`https://doi.org/10.1016/S0269-915X(97)80026-2`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:namedPlace
Term IRI	http://rs.tdwg.org/dwc/terms/namedPlace
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/namedPlace-2026-09-17
Label	Named Place
Definition	The full, unabbreviated name of a geographic location not otherwise categorized by a dcterms:Location property that is naturally occurring or anthropogenic in origin within a historical, administrative, or cultural context in which a dcterms:Location occurs.
Notes	Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities or may be in multiple possible entities that meet the term definition. For named places represented as URIs or global unique identifiers, please use dwc:locationID.
Examples	`11th Level, Bergwerksglücker Lode, Wiemannsbucht Mine` `Craigleith Quarry` `Red Cloud Mine` `NEON Niwot Ridge Mountain Research Station (NIWO)` `Hagerman Fossil Beds` `Mauna Kea`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:namePublicationID
Term IRI	http://rs.tdwg.org/dwc/terms/namePublicationID
Modified	2009-09-21
Label	Name Publication ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/namePublishedInID
Definition	A resolvable globally unique identifier for the original publication of the scientificName.
Notes	Example: "http://hdl.handle.net/10199/7"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:namePublishedIn
Term IRI	http://rs.tdwg.org/dwc/terms/namePublishedIn
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/namePublishedIn-2023-06-28
Label	Name Published In
Definition	A reference for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedIn should be empty.
Examples	`Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `Forel, Auguste, Diagnosies provisoires de quelques espèces nouvelles de fourmis de Madagascar, récoltées par M. Grandidier., Annales de la Societe Entomologique de Belgique, Comptes-rendus des Seances 30, 1886`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:namePublishedInID
Term IRI	http://rs.tdwg.org/dwc/terms/namePublishedInID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/namePublishedInID-2023-06-28
Label	Name Published In ID
Definition	An identifier for the publication in which the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	A citation of the first publication of the name in its given combination, not the basionym / original name. Recombinations are often not published in zoology, in which case dwc:namePublishedInID should be empty.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Term Name dwc:namePublishedInYear
Term IRI	http://rs.tdwg.org/dwc/terms/namePublishedInYear
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/namePublishedInYear-2023-06-28
Label	Name Published In Year
Definition	The four-digit year in which the dwc:scientificName was published.
Examples	`1915` `2008`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2011-10-16_8
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:nomenclaturalCode
Term IRI	http://rs.tdwg.org/dwc/terms/nomenclaturalCode
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/nomenclaturalCode-2023-06-28
Label	Nomenclatural Code
Definition	The nomenclatural code (or codes in the case of an ambiregnal name) under which the dwc:scientificName is constructed.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`ICN` `ICZN` `BC` `ICNCP` `BioCode`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/Code
Type	Property

Term Name dwc:nomenclaturalStatus
Term IRI	http://rs.tdwg.org/dwc/terms/nomenclaturalStatus
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/nomenclaturalStatus-2023-06-28
Label	Nomenclatural Status
Definition	The status related to the original publication of the name and its conformance to the relevant rules of nomenclature. It is based essentially on an algorithm according to the business rules of the code. It requires no taxonomic opinion.
Examples	`nom. ambig.` `nom. illeg.` `nom. subnud.`
ABCD equivalence	(DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/NomenclaturalReference/TitleCitation) pro parte
Type	Property

Term Name eco:nonTargetTaxa
Term IRI	http://rs.tdwg.org/eco/terms/nonTargetTaxa
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/nonTargetTaxa-2026-09-17
Label	Non-target Taxa
Definition	A list (concatenated and separated) of taxa reported during an eco:Survey that are outside of the target taxonomic scope (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope).
Notes	This term is meant to allow the full list of taxa that are considered outside of the taxonomic scope and yet were reported in an eco:Survey. This term is relevant only if a target taxonomic scope is declared and eco:hasNonTargetTaxa is ‘true’. Taxonomic scope is based on the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope. Non-target taxa (in some disciplines called “bycatch”) can be reported at any taxonomic level. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Parabuteo unicinctus \| Geranoaetus melanoleucus` `Cetoniinae \| Aclopinae \| Cyclocephala modesta`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:nonTargetTaxa
Term IRI	http://rs.tdwg.org/eco/iri/nonTargetTaxa
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/nonTargetTaxa-2026-09-17
Label	Non-target Taxa
Definition	A taxon reported during the dwc:Survey that is outside of the target taxonomic scope (the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope).
Notes	This term is meant to allow a taxon that is considered outside of the taxonomic scope and yet was reported in the dataset to be shared. This term is relevant only if a target taxonomic scope is declared and eco:hasNonTargetTaxa is ‘true’. Taxonomic scope is based on the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope. Non-target taxa (in some disciplines called “bycatch”) can be reported at any taxonomic level. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:NucleotideAnalysis
Term IRI	http://rs.tdwg.org/dwc/terms/NucleotideAnalysis
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/NucleotideAnalysis-2026-05-26
Label	Nucleotide Analysis
Definition	A link between a dwc:NucleotideSequence or a dwc:Identification and a dwc:Event and a dwc:MaterialEntity from which it was derived, using a specified dwc:Protocol.
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:NucleotideSequence
Term IRI	http://rs.tdwg.org/dwc/terms/NucleotideSequence
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/NucleotideSequence-2026-05-26
Label	Nucleotide Sequence
Definition	A digital representation of a nucleotide sequence.
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:nucleotideSequenceRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/nucleotideSequenceRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/nucleotideSequenceRemarks-2026-05-26
Label	Nucleotide Sequence Remarks
Definition	Comments or notes about a dwc:NucleotideSequence.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:objectQuantity
Term IRI	http://rs.tdwg.org/dwc/terms/objectQuantity
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/objectQuantity-2026-05-26
Label	Object Quantity
Definition	A number or enumeration value for the quantity of differentiable dwc:MaterialEntities comprising this dwc:MaterialEntity.
Notes	An dwc:objectQuantity must have a corresponding dwc:objectQuantityType.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:objectQuantityType
Term IRI	http://rs.tdwg.org/dwc/terms/objectQuantityType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/objectQuantityType-2026-05-26
Label	Object Quantity Type
Definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`27` (objectQuantity) with `individuals` (objectQuantityType) `many` (objectQuantity) with `individuals` (objectQuantityType) `3` (objectQuantity) with `legs` (objectQuantityType)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:objectQuantityType
Term IRI	http://rs.tdwg.org/dwc/iri/objectQuantityType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/objectQuantityType-2026-05-26
Label	Object Quantity Type (IRI)
Definition	The type of quantification system used for the quantity of dwc:MaterialEntities.
Notes	An dwc:objectQuantityType must have a corresponding dwc:objectQuantity. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:Occurrence
Term IRI	http://rs.tdwg.org/dwc/terms/Occurrence
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Occurrence-2026-05-26
Label	Occurrence
Definition	A dwc:Event that establishes the state of a dwc:Organism at a particular place and time.
Notes	In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`a wolf pack on the shore of Kluane Lake in 1988` `a virus in a plant leaf in the New York Botanical Garden at 15:29 on 2014-10-23` `a fungus in Central Park in the summer of 1929` `a male lance-tailed manakin in a courtship display on Isla Boca Brava`
ABCD equivalence	DataSets/DataSet/Units/Unit
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:occurrenceAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceAttributes
Modified	2009-10-09
Label	Occurrence Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the Occurrence.
Notes	Examples: "Tragus length: 14mm; Weight: 120g", "Height: 1-1.5 meters tall; flowers yellow; uncommon".
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts
Type	Property

Term Name dwc:occurrenceDetails
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceDetails
Modified	2009-10-09
Label	Occurrence Details
	This term is deprecated and should no longer be used.
Definition	A reference (publication, URI) to the most detailed information available about the Occurrence.
Notes	Example: "http://mvzarctos.berkeley.edu/guid/MVZ:Mamm:165861"
ABCD equivalence	DataSets/DataSet/Units/Unit/RecordURI
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2011-10-16_7

Term Name dwc:occurrenceID
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/occurrenceID-2026-05-26
Label	Occurrence ID
Definition	An identifier for a dwc:Occurrence (as opposed to a particular digital record of a dwc:Occurrence).
Notes	In the absence of a persistent global unique identifier, construct one from a combination of identifiers in the record that will most closely make the dwc:occurrenceID globally unique.
Examples	`https://arctos.database.museum/guid/MSB:Mamm:231731?seid=966527` `3854b337a-da0b-483f-a1c7-107403bdbb40` `http://n2t.net/ark:/65665/3854b337a-da0b-483f-a1c7-107403bdbb40`
ABCD equivalence	DataSets/DataSet/Units/Unit/UnitGUID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:OccurrenceMeasurement
Term IRI	http://rs.tdwg.org/dwc/terms/OccurrenceMeasurement
Modified	2009-10-09
Label	Occurrence Measurement
	This term is deprecated and should no longer be used.
Definition	The category of information pertaining to measurements accociated with an occurrence.
ABCD equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type	Class

Term Name dwc:occurrenceMeasurementAccuracy
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Modified	2009-10-09
Label	Occurrence Measurement Accuracy
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementAccuracy
Definition	The description of the error associated with the occurrenceAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property

Term Name dwc:occurrenceMeasurementDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Modified	2009-10-09
Label	Occurrence Measurement Determined By
	This term is deprecated and should no longer be used.
Definition	The agent responsible for having determined the value of the measurement or characteristic of the occurrence.
Notes	Example: "Javier de la Torre"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type	Property

Term Name dwc:occurrenceMeasurementDeterminedDate
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Modified	2009-10-09
Label	Occurrence Measurement Determined Date
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementDeterminedDate
Definition	The date on which the the measurement or characteristic of the occurrence was made. Recommended best practice is to use an encoding scheme, such as ISO 8601:2004(E).
Notes	Examples: "1963-03-08T14:07-0600" is 8 Mar 1963 2:07pm in the time zone six hours earlier than UTC, "2009-02-20T08:40Z" is 20 Feb 2009 8:40am UTC, "1809-02-12" is 12 Feb 1809, "1906-06" is Jun 1906, "1971" is just that year, "2007-03-01T13:00:00Z/2008-05-11T15:30:00Z" is the interval between 1 Mar 2007 1pm UTC and 11 May 2008 3:30pm UTC, "2007-11-13/15" is the interval between 13 Nov 2007 and 15 Nov 2007.
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property

Term Name dwc:occurrenceMeasurementID
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementID
Modified	2009-10-09
Label	Occurrence Measurement ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementID
Definition	An identifier for the occurrence attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:occurrenceMeasurementRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementRemarks
Modified	2009-10-09
Label	Occurrence Measurement Remarks
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementRemarks
Definition	Comments or notes accompanying the measurement or characteristic of the occurrence.
Notes	Example: "tip of tail missing"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:occurrenceMeasurementType
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementType
Modified	2009-10-09
Label	Occurrence Measurement Type
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementType
Definition	The nature of the measurement or characteristic of the occurrence. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "tail length"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property

Term Name dwc:occurrenceMeasurementUnit
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Modified	2009-10-09
Label	Occurrence Measurement Unit
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementUnit
Definition	The units for the value of the measurement or characteristic of the occurrence. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "mm"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property

Term Name dwc:occurrenceMeasurementValue
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Modified	2009-10-09
Label	Occurrence Measurement Value
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/measurementValue
Definition	The value of the measurement or characteristic of the occurrence.
Notes	Example: "45"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type	Property

Term Name dwc:occurrenceRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/occurrenceRemarks-2023-06-28
Label	Occurrence Remarks
Definition	Comments or notes about the dwc:Occurrence.
Examples	`found dead on road`
ABCD equivalence	DataSets/DataSet/Units/Unit/Notes
Type	Property

Term Name dwc:occurrenceStatus
Term IRI	http://rs.tdwg.org/dwc/terms/occurrenceStatus
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/occurrenceStatus-2026-05-26
Label	Occurrence Status
Definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	For dwc:Occurrences, the default vocabulary is recommended to consist of detected and notDetected, but can be extended by implementers with good justification. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`detected` `notDetected`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:occurrenceStatus
Term IRI	http://rs.tdwg.org/dwc/iri/occurrenceStatus
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/occurrenceStatus-2026-05-26
Label	Occurrence Status (IRI)
Definition	A statement about the detection or non-detection of a dwc:Organism during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:order
Term IRI	http://rs.tdwg.org/dwc/terms/order
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/order-2023-06-28
Label	Order
Definition	The full scientific name of the order in which the dwc:Taxon is classified.
Examples	`Carnivora` `Monocleales`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = ordo
Type	Property

Term Name dwc:Organism
Term IRI	http://rs.tdwg.org/dwc/terms/Organism
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Organism-2026-05-26
Label	Organism
Definition	A particular organism or defined group of organisms considered to be taxonomically homogeneous.
Notes	Instances of the dwc:Organism class are intended to facilitate linking one or more dwc:Identification instances to one or more dwc:Occurrence instances. Therefore, things that are typically assigned scientific names (such as viruses, hybrids, and lichens) and aggregates whose dwc:Occurrences are typically recorded (such as packs, clones, and colonies) are included in the scope of this class. In Darwin Core, dwc:Organism, dwc:Occurrence, and dwc:MaterialEntity are related, but distinct concepts. A dwc:Organism is a biological individual or group with an identity and life history that persists independently of the particular dwc:MaterialEntities through which it is manifested. A dwc:Occurrence is a dwc:Event that represents the presence or state of a dwc:Organism at a place during an interval of time, with no explicit dependency on any dwc:MaterialEntity. A dwc:MaterialEntity represents physical matter, including whole bodies, parts, or derivatives of dwc:Organisms, that may directly or indirectly serve as evidence of a dwc:Occurrence.
Examples	`a specific bird` `a specific wolf pack` `a specific instance of a bacterial culture` `a particular plant gathered in the wild, transplanted to a botanical garden, and preserved as a specimen in a collection`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:organismID
Term IRI	http://rs.tdwg.org/dwc/terms/organismID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismID-2023-06-28
Label	Organism ID
Definition	An identifier for the dwc:Organism instance (as opposed to a particular digital record of the dwc:Organism). May be a globally unique identifier or an identifier specific to the data set.
Examples	`http://arctos.database.museum/guid/WNMU:Mamm:1249`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Term Name dwc:OrganismInteraction
Term IRI	http://rs.tdwg.org/dwc/terms/OrganismInteraction
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/OrganismInteraction-2026-05-26
Label	Organism Interaction
Definition	An interaction between two dwc:Organisms during a dwc:Event.
Notes	Supports only primary observed interactions, not habitual or derived taxon-level interactions. Pairwise interactions must be used to represent multi-organism interactions. When possible, typify the action rather than the state from which an action is inferred, with the actor as the subject dwc:Occurrence and the acted-upon as the related dwc:Occurrence. Only one direction of a two-way interaction is necessary, though both are permissible as distinct OrganismInteractions with distinct subject dwc:Occurrences.
Examples	`a bee visiting a flower` `a Mallophora ruficauda hunting an Apis mellifera in flight` `a viral infection in a plant` `a female spider mating with a male spider` `a lion cub nursing from its mother` `a mosquito sucking blood from a chimpanzee's arm` `a slug eating a fungus growing on decomposing stump (2 interactions)`
ABCD equivalence	/abcd:DataSets/abcd:DataSet/abcd:Units/abcd:Unit/abcd:Associations/abcd:UnitAssociation
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:organismInteractionDescription
Term IRI	http://rs.tdwg.org/dwc/terms/organismInteractionDescription
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismInteractionDescription-2026-05-26
Label	Organism Interaction Description
Definition	A verbatim description of a dwc:OrganismInteraction.
Examples	`Mallophora ruficauda captured an Apis mellifera worker in flight.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:organismInteractionID
Term IRI	http://rs.tdwg.org/dwc/terms/organismInteractionID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismInteractionID-2026-05-26
Label	Organism Interaction ID
Definition	An identifier for a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:organismInteractionType
Term IRI	http://rs.tdwg.org/dwc/terms/organismInteractionType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismInteractionType-2026-05-26
Label	Organism Interaction Type
Definition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`visitedFlowerOf` `parasitized` `matedWith` `wasAttachedTo`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:organismInteractionType
Term IRI	http://rs.tdwg.org/dwc/iri/organismInteractionType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/organismInteractionType-2026-05-26
Label	Organism Interaction Type (IRI)
Definition	A category that best matches the nature of a dwc:OrganismInteraction.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:organismName
Term IRI	http://rs.tdwg.org/dwc/terms/organismName
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismName-2023-06-28
Label	Organism Name
Definition	A textual name or label assigned to a dwc:Organism instance.
Examples	`Huberta` `Boab Prison Tree` `J pod`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Term Name dwc:organismPart
Term IRI	http://rs.tdwg.org/dwc/terms/organismPart
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismPart-2026-09-17
Label	Organism Part
Definition	An anatomical part of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary such as the controlled vocabulary for ac:subjectPart (http://rs.tdwg.org/ac/doc/part/). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`leaf` `stomach` `stamen` `leg`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:organismPart
Term IRI	http://rs.tdwg.org/dwc/iri/organismPart
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/organismPart-2026-09-17
Label	Organism Part (IRI)
Definition	An anatomical part of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary such as the controlled vocabulary for ac:subjectPart (http://rs.tdwg.org/ac/doc/part/). Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:organismQuantity
Term IRI	http://rs.tdwg.org/dwc/terms/organismQuantity
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismQuantity-2023-06-28
Label	Organism Quantity
Definition	A number or enumeration value for the quantity of dwc:Organisms.
Notes	A dwc:organismQuantity must have a corresponding dwc:organismQuantityType.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Term Name dwciri:organismQuantityType
Term IRI	http://rs.tdwg.org/dwc/iri/organismQuantityType
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/organismQuantityType-2015-03-27
Label	Organism Quantity Type (IRI)
Definition	The type of quantification system used for the quantity of organisms.
Notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:organismQuantityType
Term IRI	http://rs.tdwg.org/dwc/terms/organismQuantityType
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismQuantityType-2023-06-28
Label	Organism Quantity Type
Definition	The type of quantification system used for the quantity of dwc:Organisms.
Notes	A dwc:organismQuantityType must have a corresponding dwc:organismQuantity. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`27` (organismQuantity) with `individuals` (organismQuantityType) `12.5` (organismQuantity) with `% biomass` (organismQuantityType) `r` (organismQuantity) with `Braun-Blanquet Scale` (organismQuantityType) `many` (organismQuantity) with `individuals` (organismQuantityType)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Term Name dwc:organismRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/organismRemarks
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismRemarks-2023-06-28
Label	Organism Remarks
Definition	Comments or notes about the dwc:Organism instance.
Examples	`One of a litter of six`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14

Term Name dwciri:organismScope
Term IRI	http://rs.tdwg.org/dwc/iri/organismScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/organismScope-2026-09-17
Label	Organism Scope (IRI)
Definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:organismScope
Term IRI	http://rs.tdwg.org/dwc/terms/organismScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/organismScope-2026-09-17
Label	Organism Scope
Definition	A description of the kind of dwc:Organism instance. Can be used to indicate whether the dwc:Organism instance represents a discrete organism or if it represents a particular type of aggregation.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`multicellular organism` `virus` `clone` `pack` `colony`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:originalNameUsage
Term IRI	http://rs.tdwg.org/dwc/terms/originalNameUsage
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/originalNameUsage-2023-06-28
Label	Original Name Usage
Definition	The taxon name, with authorship and date information if known, as it originally appeared when first established under the rules of the associated dwc:nomenclaturalCode. The basionym (botany) or basonym (bacteriology) of the dwc:scientificName or the senior/earlier homonym for replaced names.
Notes	The full scientific name, with authorship and date information if known, of the name usage in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would indicate the basionym of a record representing a subsequent combination. Unlike basionyms, however, this term can apply to scientific names at all ranks.
Examples	`Pinus abies` `Gasterosteus saltatrix Linnaeus 1768`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:originalNameUsageID
Term IRI	http://rs.tdwg.org/dwc/terms/originalNameUsageID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/originalNameUsageID-2023-06-28
Label	Original Name Usage ID
Definition	An identifier for the name usage (documented meaning of the name according to a source) in which the terminal element of the dwc:scientificName was originally established under the rules of the associated dwc:nomenclaturalCode.
Notes	This term should be used to refer to the dwc:taxonID of a dwc:Taxon record that represents the usage of the terminal element of the dwc:scientificName as originally established under the rules of the associated dwc:nomenclaturalCode. For example, for names governed by the ICNafp, this term would establish the relationship between a record representing a subsequent combination and the record for its corresponding basionym. Unlike basionyms, however, this term can apply to scientific names at all ranks. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41107` (ITIS) `urn:lsid:ipni.org:names:320035-2` (IPNI) `2704179` (GBIF) `6W3C4` (COL)
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:otherCatalogNumbers
Term IRI	http://rs.tdwg.org/dwc/terms/otherCatalogNumbers
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/otherCatalogNumbers-2026-05-26
Label	Other Catalog Numbers
Definition	A list (concatenated and separated) of previous or alternate fully qualified catalog numbers or other human-used identifiers for the same dwc:MaterialEntity, whether in the current or any other data set or collection.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`FMNH:Mammal:1234` `NPS YELLO6778 \| MBG 33424`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/History/PreviousUnitsText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:ownerInstitutionCode
Term IRI	http://rs.tdwg.org/dwc/terms/ownerInstitutionCode
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/ownerInstitutionCode-2026-05-26
Label	Owner Institution Code
Definition	A name (or acronym) in use by an institution having ownership of a resource.
Examples	`NPS` `APN` `InBio`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:parentEventID
Term IRI	http://rs.tdwg.org/dwc/terms/parentEventID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/parentEventID-2026-05-26
Label	Parent Event ID
Definition	An identifier for a broader dwc:Event that contains this and potentially other dwc:Events.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`A1` (parentEventID to identify the main Whittaker Plot in nested samples, each with its own eventID - `A1:1`, `A1:2`).
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:parentMeasurementID
Term IRI	http://rs.tdwg.org/dwc/terms/parentMeasurementID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/parentMeasurementID-2023-06-28
Label	Parent Measurement ID
Definition	An identifier for a broader dwc:MeasurementOrFact that groups this and potentially other dwc:MeasurementOrFacts.
Notes	May be a globally unique identifier or an identifier specific to the data set.
Examples	`9c752d22-b09a-11e8-96f8-529269fb1459` `E1_E1_O1_M1`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Term Name dwc:parentNameUsage
Term IRI	http://rs.tdwg.org/dwc/terms/parentNameUsage
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/parentNameUsage-2023-06-28
Label	Parent Name Usage
Definition	The full name, with authorship and date information if known, of the direct, most proximate higher-rank parent dwc:Taxon (in a classification) of the most specific element of the dwc:scientificName.
Examples	`Rubiaceae` `Gruiformes` `Testudinae`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName
Type	Property

Term Name dwc:parentNameUsageID
Term IRI	http://rs.tdwg.org/dwc/terms/parentNameUsageID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/parentNameUsageID-2023-06-28
Label	Parent Name Usage ID
Definition	An identifier for the name usage (documented meaning of the name according to a source) of the direct, most proximate higher-rank parent taxon (in a classification) of the most specific element of the dwc:scientificName.
Notes	This term should be used for accepted names to refer to the dwc:taxonID of a dwc:Taxon record that represents the next higher taxon rank in the same taxonomic classification. For Darwin Core Archives the related record should be present locally in the same archive.
Examples	`tsn:41074` (ITIS) `urn:lsid:ipni.org:names:30001404-2` (IPNI) `2704173` (GBIF) `6T8N` (COL)
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:pathway
Term IRI	http://rs.tdwg.org/dwc/iri/pathway
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/pathway-2025-07-10
Label	Pathway (IRI)
Definition	The process by which a dwc:Organism came to be in a given place at a given time.
Notes	Recommended best practice is to use IRIs from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcpw/values/p002` `http://rs.tdwg.org/dwcpw/values/p046`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_23
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:pathway
Term IRI	http://rs.tdwg.org/dwc/terms/pathway
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/pathway-2023-06-28
Label	Pathway
Definition	The process by which a dwc:Organism came to be in a given place at a given time.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/pw/. For details, refer to https://doi.org/10.3897/biss.3.38084. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`releasedForUse` `otherEscape` `transportContaminant` `transportStowaway` `corridor` `unaided`
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2020-10-13_23

Term Name dwc:phylum
Term IRI	http://rs.tdwg.org/dwc/terms/phylum
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/phylum-2023-06-28
Label	Phylum
Definition	The full scientific name of the phylum or division in which the dwc:Taxon is classified.
Examples	`Chordata` (phylum) `Bryophyta` (division)
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName with HigherTaxa/HigherTaxon/HigherTaxonRank = phylum
Type	Property

Term Name dwc:pointRadiusSpatialFit
Term IRI	http://rs.tdwg.org/dwc/terms/pointRadiusSpatialFit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/pointRadiusSpatialFit-2026-05-26
Label	Point Radius Spatial Fit
Definition	A ratio of the area of a point-radius (dwc:decimalLatitude, dwc:decimalLongitude, dwc:coordinateUncertaintyInMeters) to the area of a true (original, or most specific) spatial representation of a dcterms:Location.
Notes	Legal values are 0, greater than or equal to 1, or undefined. A value of 1 is an exact match or 100% overlap. A value of 0 should be used if the given point-radius does not completely contain the original representation. The pointRadiusSpatialFit is undefined (and should be left empty) if the original representation is any geometry without area (e.g., a point or polyline) and without uncertainty and the given georeference is not that same geometry (without uncertainty). If both the original and the given georeference are the same point, the pointRadiusSpatialFit is 1. Detailed explanations with graphical examples can be found in the Georeferencing Best Practices, Chapman and Wieczorek, 2020 (https://doi.org/10.15468/doc-gg7h-s853).
Examples	`0` `1` `1.5708`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/PointRadiusSpatialFit
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:preferredSpatialRepresentation
Term IRI	http://rs.tdwg.org/dwc/iri/preferredSpatialRepresentation
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/preferredSpatialRepresentation-2026-05-26
Label	Preferred Spatial Representation (IRI)
Definition	An indication of which spatial representation best represents the dcterms:Location.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:preferredSpatialRepresentation
Term IRI	http://rs.tdwg.org/dwc/terms/preferredSpatialRepresentation
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/preferredSpatialRepresentation-2026-05-26
Label	Preferred Spatial Representation
Definition	An indication of which spatial representation best represents the dcterms:Location.
Examples	`point-radius` `footprint`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:preparations
Term IRI	http://rs.tdwg.org/dwc/terms/preparations
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/preparations-2026-05-26
Label	Preparations
Definition	A list (concatenated and separated) of preparations and preservation methods for a dwc:MaterialEntity.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`fossil` `cast` `photograph` `DNA extract` `skin \| skull \| skeleton` `whole animal (EtOH) \| tissue (EDTA)`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/Preparations/PreparationsText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:preparations
Term IRI	http://rs.tdwg.org/dwc/iri/preparations
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/preparations-2025-07-10
Label	Preparations (IRI)
Definition	A preparation or preservation method for a specimen.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:PreservedSpecimen
Term IRI	http://rs.tdwg.org/dwc/terms/PreservedSpecimen
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/PreservedSpecimen-2023-09-18
Label	Preserved Specimen
Definition	A specimen that has been preserved.
Examples	`a plant on an herbarium sheet` `a cataloged lot of fish in a jar`
ABCD equivalence	RecordBasisEnum/PreservedSpecimen
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwc:previousIdentifications
Term IRI	http://rs.tdwg.org/dwc/terms/previousIdentifications
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/previousIdentifications-2023-06-28
Label	Previous Identifications
Definition	A list (concatenated and separated) of previous assignments of names to the dwc:Organism.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Chalepidae` `Pinus abies` `Anthus sp., field ID by G. Iglesias \| Anthus correndera, expert ID by C. Cicero 2009-02-12 based on morphology`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_14
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:PreviousIdentifications
Term IRI	http://rs.tdwg.org/dwc/terms/PreviousIdentifications
Modified	2009-04-24
Label	Previous Identifications
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/previousIdentifications
Definition	A list (concatenated and separated) of previous ScientificNames to which the sample was identified.
Notes	Example: "Anthus correndera".
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification with PreferredFlag = false
Type	Property

Term Name dwc:processedTotalReadCount
Term IRI	http://rs.tdwg.org/dwc/terms/processedTotalReadCount
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/processedTotalReadCount-2026-09-17
Label	Processed Total Read Count
Definition	The total number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Examples	`50638` `345987` `764032`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:projectID
Term IRI	http://rs.tdwg.org/dwc/terms/projectID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/projectID-2026-05-26
Label	Project ID
Definition	A list (concatenated and separated) of identifiers for projects that contributed to a dwc:Event.
Notes	A projectID may be shared in multiple distinct datasets. The nature of the association can be described in the metadata project description element. This term should be used to provide a globally unique identifier (GUID) for a project, if available. This could be a DOI, URI, or any other persistent identifier that ensures a project can be uniquely distinguished from others. The Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://arvenetternansen.com/` `https://doi.org/10.26259/3b15eca7` `https://doi.org/10.3030/101180559` `OC202405` `RCN276730` `RCN276730 \| Artsproject_7-24`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:projectTitle
Term IRI	http://rs.tdwg.org/dwc/terms/projectTitle
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/projectTitle-2026-05-26
Label	Project Title
Definition	A list (concatenated and separated) of titles or names for projects that contributed to a dwc:Event.
Notes	Use this term to provide the official name or title of a project as it is commonly known and cited. Avoid abbreviations unless they are widely understood. The recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`Arctic Deep` `Scalidophora i Noreg` `The Nansen Legacy` `Underwater Oases of the Mar del Plata Canyon: Talud Continental IV`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Project/ProjectTitle
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:Protocol
Term IRI	http://rs.tdwg.org/dwc/terms/Protocol
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Protocol-2026-05-26
Label	Protocol
Definition	A method used during an action.
Examples	`a pitfall trap method for sampling ground-dwelling arthropods` `a point-radius georeferencing method` `a linear regression model to estimate body mass from skeletal measurements` `a Bayesian phylogenetic inference method`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:protocolDescription
Term IRI	http://rs.tdwg.org/dwc/terms/protocolDescription
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/protocolDescription-2026-05-26
Label	Protocol Description
Definition	A detailed description of a dwc:Protocol.
Examples	`Georeference following Zermoglio et al. 2020 (https://doi.org/10.35035/e09p-h128), using GeoPick (https://geopick.gbif.org/) for named place determinations and Georeferencing Calculator (https://github.com/VertNet/georefcalculator) for complex uncertainties.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:protocolDescriptions
Term IRI	http://rs.tdwg.org/eco/terms/protocolDescriptions
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/protocolDescriptions-2026-09-17
Label	Protocol Descriptions
Definition	A detailed description of the methods used during an eco:Survey.
Notes	This description should be associated with protocols provided in eco:protocolNames. The description may include deviations from a protocol referred to in eco:protocolReferences. Recommended good practice is to provide information about instruments used, calibration, etc. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Three conventional harp traps (3.2m ht x 2.2m w) were established in flight path zones for a period of 4 hrs at dawn and dusk for a total of 10 trap nights. Traps were visited on an hourly basis during each deployment period and the trap catch recorded for species, size, weight, sex, age and maternal status.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:protocolID
Term IRI	http://rs.tdwg.org/dwc/terms/protocolID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/protocolID-2026-05-26
Label	Protocol ID
Definition	An identifier for a dwc:Protocol.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:protocolNames
Term IRI	http://rs.tdwg.org/eco/terms/protocolNames
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/protocolNames-2026-09-17
Label	Protocol Names
Definition	Categorical descriptive names for the methods used during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`boxTrapping` `floraInventory` `boxTrapping \| funnelTrapping`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:protocolNames
Term IRI	http://rs.tdwg.org/eco/iri/protocolNames
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/protocolNames-2026-09-17
Label	Protocol Names
Definition	An IRI identifying a categorical descriptive name for the methods used during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:protocolReferences
Term IRI	http://rs.tdwg.org/eco/terms/protocolReferences
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/protocolReferences-2026-09-17
Label	Protocol References
Definition	The references to the methods used during an eco:Survey.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:protocolReferences
Term IRI	http://rs.tdwg.org/dwc/terms/protocolReferences
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/protocolReferences-2026-05-26
Label	Protocol References
Definition	A list (concatenated and separated) of dcterms:BibliographicResources used in a dwc:Protocol.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
Examples	`Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:protocolRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/protocolRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/protocolRemarks-2026-05-26
Label	Protocol Remarks
Definition	Comments or notes about a dwc:Protocol.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:protocolType
Term IRI	http://rs.tdwg.org/dwc/terms/protocolType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/protocolType-2026-05-26
Label	Protocol Type
Definition	A category that best matches the nature of a dwc:Protocol.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`measurement` `georeference` `chronometricAge` `chronometricAgeConversion` `samplingEffort`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:protocolType
Term IRI	http://rs.tdwg.org/dwc/iri/protocolType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/protocolType-2026-05-26
Label	Protocol Type (IRI)
Definition	A category that best matches the nature of a dwc:Protocol.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:Provenance
Term IRI	http://rs.tdwg.org/dwc/terms/Provenance
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Provenance-2026-05-26
Label	Provenance
Definition	Information about an entity’s origins.
Notes	This is a convenience class to group related properties.
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:provenanceID
Term IRI	http://rs.tdwg.org/dwc/terms/provenanceID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/provenanceID-2026-09-17
Label	Provenance ID
Definition	An identifier for a dwc:Provenance.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:rawTotalReadCount
Term IRI	http://rs.tdwg.org/dwc/terms/rawTotalReadCount
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/rawTotalReadCount-2026-09-17
Label	Raw Total Read Count
Definition	A total number of raw, unprocessed reads from a dwc:NucleotideAnalysis.
Examples	`70463` `150456` `586031`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:readCount
Term IRI	http://rs.tdwg.org/dwc/terms/readCount
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/readCount-2026-05-26
Label	Read Count
Definition	The number of reads obtained for a processed dwc:NucleotideSequence during a dwc:NucleotideAnalysis.
Examples	`325` `73591` `8302`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:recordedBy
Term IRI	http://rs.tdwg.org/dwc/iri/recordedBy
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/recordedBy-2026-09-17
Label	Recorded By (IRI)
Definition	An IRI identifying a dcterms:Agent responsible for recording a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:recordedBy
Term IRI	http://rs.tdwg.org/dwc/terms/recordedBy
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/recordedBy-2026-09-17
Label	Recorded By
Definition	A name for a dcterms:Agent responsible for recording a dwc:Event.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`José E. Crespo` `Oliver P. Pearson \| Anita K. Pearson` `Megatherium Club` `The Natural History Society of Northumbria` `ROV SuBastian`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/GatheringAgents/GatheringAgentsText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:recordedByID
Term IRI	http://rs.tdwg.org/dwc/terms/recordedByID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/recordedByID-2026-09-17
Label	Recorded By ID
Definition	An identifier for a dcterms:Agent responsible for recording a dwc:Event.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0002-1825-0097` (for an individual) `https://orcid.org/0000-0002-1825-0097 \| https://orcid.org/0000-0002-1825-0098` (for a list of people)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:recordNumber
Term IRI	http://rs.tdwg.org/dwc/terms/recordNumber
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/recordNumber-2026-09-17
Label	Record Number
Definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:MaterialEntity record, such as a specimen collector's number.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`OPP 7101`
ABCD equivalence	DataSets/DataSet/Units/Unit/CollectorsFieldNumber
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:recordNumber
Term IRI	http://rs.tdwg.org/dwc/iri/recordNumber
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/recordNumber-2026-09-17
Label	Record Number (IRI)
Definition	An identifier given to the dwc:Occurrence at the time it was recorded. Often serves as a link between field notes and a dwc:MaterialEntity record, such as a specimen collector's number.
Notes	The subject is a dwc:Occurrence and the object is a (possibly IRI-identified) resource that is the field notes.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:referenceID
Term IRI	http://rs.tdwg.org/dwc/terms/referenceID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/referenceID-2026-05-26
Label	Reference ID
Definition	An identifier for a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:referenceRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/referenceRemarks
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/referenceRemarks-2026-05-26
Label	Reference Remarks
Definition	Comments or notes about a dcterms:BibliographicResource.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dcterms:references
Term IRI	http://purl.org/dc/terms/references
Modified	2026-05-26
Term version IRI	http://dublincore.org/usage/terms/history/#references-003
Label	References
Definition	A related resource that is referenced, cited, or otherwise pointed to by the described resource.
Notes	From Dublin Core, "This property is intended to be used with non-literal values. This property is an inverse property of Is Referenced By." The intended usage of this term in Darwin Core is to point to the definitive source representation of the resource (e.g., dwc:Taxon, dwc:Occurrence, dwc:Event), if one is available. Note that the intended usage of dcterms:bibliographicCitation in Darwin Core, by contrast, is to provide the preferred way to cite the resource itself.
Examples	`http://arctos.database.museum/guid/MVZ:Mamm:165861` (MaterialEntity example) `https://www.catalogueoflife.org/data/taxon/32664 (Taxon example)`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2011-10-16_7
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:referenceType
Term IRI	http://rs.tdwg.org/dwc/terms/referenceType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/referenceType-2026-05-26
Label	Reference Type
Definition	A category that best matches the nature of a dcterms:BibliographicResource.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`book`, `bookSection`, `journalArticle`, `thesis` `proceedingsPaper` `report` `poster` `fieldNotebook` `log` `oralCommunication`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:RelatedBasisOfRecord
Term IRI	http://rs.tdwg.org/dwc/terms/RelatedBasisOfRecord
Modified	2009-01-26
Label	Related Basis of Record
	This term is deprecated and should no longer be used.
Definition	The nature of the related resource. Recommended best practice is to use the same controlled vocabulary as for basisOfRecord.
Notes	Example: "PreservedSpecimen"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:relatedResourceID
Term IRI	http://rs.tdwg.org/dwc/terms/relatedResourceID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relatedResourceID-2026-05-26
Label	Related Resource ID
Definition	An identifier for the related resource (the object) of a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
Examples	`dc609808-b09b-11e8-96f8-529269fb1459`
ABCD equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceInstitutionCode + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitSourceName + DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociatedUnitID
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:relatedResourceType
Term IRI	http://rs.tdwg.org/dwc/terms/relatedResourceType
Modified	2009-10-09
Label	Related Resource Type
	This term is deprecated and should no longer be used.
Definition	The type of the related resource. Recommended best practice is to use a controlled vocabulary.
Notes	Examples: "StillImage", "MovingImage", "Sound", PhysicalObject", "PreservedSpecimen", FossilSpecimen", LivingSpecimen", "HumanObservation", "MachineObservation", "Location", "Taxonomy", "NomeclaturalChecklist", "Publication"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:relationshipAccordingTo
Term IRI	http://rs.tdwg.org/dwc/terms/relationshipAccordingTo
Modified	2018-09-06
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relationshipAccordingTo-2018-09-06
Label	Relationship According To
Definition	The source (person, organization, publication, reference) establishing the relationship between the two resources.
Examples	`Julie Woodruff`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:relationshipEstablishedDate
Term IRI	http://rs.tdwg.org/dwc/terms/relationshipEstablishedDate
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relationshipEstablishedDate-2026-09-17
Label	Relationship Established Date
Definition	A date-time or time interval during which a dwc:ResourceRelationship was established.
Notes	Recommended best practice is to use a date that conforms to ISO 8601-1:2019.
Examples	`1963-03-08T14:07-06:00` (8 Mar 1963 at or after 2:07pm and before 2:08pm in the time zone six hours earlier than UTC) `2009-02-20T08:40Z` (20 February 2009 at or after 8:40am and before 8:41 UTC) `2018-08-29T15:19` (29 August 2018 at or after 3:19pm and before 3:20pm local time) `1809-02-12` (within the day 12 February 1809) `1906-06` (in the month of June 1906) `1971` (in the year 1971) `2007-03-01T13:00:00Z/2008-05-11T15:30:00Z` (some time within the interval beginning 1 March 2007 at 1pm UTC and before 11 May 2008 at 3:30pm UTC) `1900/1909` (some time within the interval between the beginning of the year 1900 and before the year 1909) `2007-11-13/15` (some time in the interval between the beginning of 13 November 2007 and before 15 November 2007)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:relationshipOfResource
Term IRI	http://rs.tdwg.org/dwc/terms/relationshipOfResource
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relationshipOfResource-2023-06-28
Label	Relationship Of Resource
Definition	The relationship of the subject (identified by dwc:resourceID) to the object (identified by dwc:relatedResourceID).
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`same as` `duplicate of` `mother of` `offspring of` `sibling of` `parasite of` `host of` `valid synonym of` `located within` `pollinator of members of taxon` `pollinated specific plant` `pollinated by members of taxon` `on slab with`
ABCD equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/AssociationType
Type	Property

Term Name dwc:relationshipOfResourceID
Term IRI	http://rs.tdwg.org/dwc/terms/relationshipOfResourceID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relationshipOfResourceID-2023-06-28
Label	Relationship Of Resource ID
Definition	An identifier for the relationship type (predicate) that connects the subject identified by dwc:resourceID to its object identified by dwc:relatedResourceID.
Notes	Recommended best practice is to use the identifiers of the terms in a controlled vocabulary, such as the OBO Relation Ontology.
Examples	`http://purl.obolibrary.org/obo/RO_0002456` (for the relation `pollinated by`) `http://purl.obolibrary.org/obo/RO_0002455` (for the relation `pollinates`) `https://www.inaturalist.org/observation_fields/879` (for the relation `eaten by`)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Term Name dwc:relationshipRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/relationshipRemarks
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/relationshipRemarks-2026-09-17
Label	Relationship Remarks
Definition	Comments or notes about a dwc:ResourceRelationship.
Examples	`mother and offspring collected from the same nest` `pollinator captured in the act`
ABCD equivalence	DataSets/DataSet/Units/Unit/Associations/UnitAssociation/Comments
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:reportedExtremeConditions
Term IRI	http://rs.tdwg.org/eco/terms/reportedExtremeConditions
Modified	2024-02-28
Term version IRI	http://rs.tdwg.org/eco/terms/version/reportedExtremeConditions-2024-02-28
Label	Reported Extreme Conditions
Definition	A description of any extreme weather or environmental conditions that may have affected the dwc:Event.
Examples	`flooding during week 3 of surveys` `rockslide at site 2`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42

Term Name eco:reportedWeather
Term IRI	http://rs.tdwg.org/eco/terms/reportedWeather
Modified	2024-02-28
Term version IRI	http://rs.tdwg.org/eco/terms/version/reportedWeather-2024-02-28
Label	Reported Weather
Definition	A list of weather or climatic conditions present during the dwc:Event.
Notes	Recommended best practice is to use a key:value encoding schema for a data interchange format such as JSON.
Examples	`{"minimumTemperatureInDegreesFahrenheit": 18, "maximumTemperatureInDegreesFahrenheit": 32}`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42

Term Name dwc:reproductiveCondition
Term IRI	http://rs.tdwg.org/dwc/terms/reproductiveCondition
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/reproductiveCondition-2026-05-26
Label	Reproductive Condition
Definition	A reproductive condition of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`non-reproductive` `pregnant` `in bloom` `fruit-bearing`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:reproductiveCondition
Term IRI	http://rs.tdwg.org/dwc/iri/reproductiveCondition
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/reproductiveCondition-2026-05-26
Label	Reproductive Condition (IRI)
Definition	A reproductive condition of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:resourceID
Term IRI	http://rs.tdwg.org/dwc/terms/resourceID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/resourceID-2026-09-17
Label	Resource ID
Definition	An identifier for the subject of a dwc:ResourceRelationship.
Examples	`f809b9e0-b09b-11e8-96f8-529269fb1459`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:ResourceRelationship
Term IRI	http://rs.tdwg.org/dwc/terms/ResourceRelationship
Modified	2023-09-13
Term version IRI	http://rs.tdwg.org/dwc/terms/version/ResourceRelationship-2023-09-13
Label	Resource Relationship
Definition	A relationship of one rdfs:Resource (http://www.w3.org/2000/01/rdf-schema#Resource) to another.
Notes	Resources can be thought of as identifiable records or instances of classes and may include, but need not be limited to instances of dwc:Occurrence, dwc:Organism, dwc:MaterialEntity, dwc:Event, dcterms:Location, dwc:GeologicalContext, dwc:Identification, or dwc:Taxon.
Examples	`an instance of a dwc:Organism is the mother of another instance of a dwc:Organism` `a uniquely identified dwc:Occurrence represents the same dwc:Occurrence as another uniquely identified dwc:Occurrence` `a dwc:MaterialEntity is a subsample of another dwc:MaterialEntity`
ABCD equivalence	DataSets/DataSet/Units/Unit/Associations
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41

Term Name dwc:resourceRelationshipID
Term IRI	http://rs.tdwg.org/dwc/terms/resourceRelationshipID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/resourceRelationshipID-2026-05-26
Label	Resource Relationship ID
Definition	An identifier for a dwc:ResourceRelationship.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dcterms:rights
Term IRI	http://purl.org/dc/terms/rights
Modified	2008-01-14
Label	Rights
	This term is deprecated and should no longer be used.
Is replaced by	http://purl.org/dc/terms/license
Definition	Information about rights held in and over the resource.
Notes	Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-11-06_17
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dcterms:rightsHolder
Term IRI	http://purl.org/dc/terms/rightsHolder
Modified	2008-01-14
Term version IRI	http://dublincore.org/usage/terms/history/#rightsHolder-002
Label	Rights Holder
Definition	A person or organization owning or managing rights over the resource.
Examples	`The Regents of the University of California`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:Sample
Term IRI	http://rs.tdwg.org/dwc/terms/Sample
Modified	2009-04-29
Label	Sample
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/Occurrence
Definition	Container class for information about the results of a sampling event (specimen, observation, etc.)
ABCD equivalence	DataSets/DataSet/Units/Unit
Type	Class

Term Name dwc:SampleAttribute
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttribute
Modified	2009-04-29
Label	Sample Attribute
	This term is deprecated and should no longer be used.
Definition	Container class for information about attributes related to a given sample.
ABCD equivalence	Datasets/Dataset/Units/Unit/MeasurementsOrFacts
Type	Class

Term Name dwc:SampleAttributeAccuracy
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeAccuracy
Modified	2009-04-29
Label	Sample Attribute Accuracy
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementAccuracy
Definition	The description of the error associated with the SampleAttributeValue.
Notes	Example: "0.01", "normal distribution with variation of 2 m"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Accuracy
Type	Property

Term Name dwc:SampleAttributeDeterminedBy
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedBy
Modified	2009-04-29
Label	Sample Attribute Determined By
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedBy
Definition	The agent responsible for having determined the value of the measurement or characteristic of the sample.
Notes	Example: "Javier de la Torre"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasuredBy
Type	Property

Term Name dwc:SampleAttributeDeterminedDate
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeDeterminedDate
Modified	2009-04-29
Label	Sample Attribute Determined Date
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementDeterminedDate
Definition	The date on which the the measurement or characteristic of the sample was made.
Notes	Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/MeasurementDateTime
Type	Property

Term Name dwc:SampleAttributeRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeRemarks
Modified	2009-04-29
Label	Sample Attribute Remarks
	This term is deprecated and should no longer be used.
Definition	Comments or notes accompanying the measurement or characteristic of the sample.
Notes	Example: "tip of tail missing"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:SampleAttributeUnit
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeUnit
Modified	2009-04-29
Label	Sample Attribute Unit
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementUnit
Definition	The units for the value of the measurement or characteristic of the sample. Recommended best practice is to use International System of Units (SI) units.
Notes	Example: "mm"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UnitOfMeasurement
Type	Property

Term Name dwc:SampleAttributeValue
Term IRI	http://rs.tdwg.org/dwc/terms/SampleAttributeValue
Modified	2009-04-29
Label	Sample Attribute Value
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceMeasurementValue
Definition	The value of the measurement or characteristic of the sample.
Notes	Example: "45"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/LowerValue or DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/UpperValue
Type	Property

Term Name dwciri:sampledFeatureType
Term IRI	http://rs.tdwg.org/dwc/iri/sampledFeatureType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/sampledFeatureType-2026-09-17
Label	Sampled Feature Type (IRI)
Definition	The type of naturally occurring or anthropogenic physical feature from which a dwc:MaterialEntity was sampled.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:sampledFeatureType
Term IRI	http://rs.tdwg.org/dwc/terms/sampledFeatureType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sampledFeatureType-2026-09-17
Label	Sampled Feature Type
Definition	The type of naturally occurring or anthropogenic physical feature from which a dwc:MaterialEntity was sampled.
Notes	This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`float` `mine dump` `mine/quarry pit` `outcrop` `erratic boulder`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:sampledSubstrateCategory
Term IRI	http://rs.tdwg.org/dwc/terms/sampledSubstrateCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateCategory-2026-05-26
Label	Sampled Substrate Category
Definition	A category or type of substrate sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`vegetation` `soil` `ocean`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:sampledSubstrateCategory
Term IRI	http://rs.tdwg.org/dwc/iri/sampledSubstrateCategory
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateCategory-2026-05-26
Label	Sampled Substrate Category (IRI)
Definition	A category or type of substrate sampled during a dwc:Event.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:sampledSubstrateLayer
Term IRI	http://rs.tdwg.org/dwc/terms/sampledSubstrateLayer
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sampledSubstrateLayer-2026-05-26
Label	Sampled Substrate Layer
Definition	A list (concatenated and separated) of substrate layers sampled during a dwc:Event.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`forest floor` `herbaceous \| shrub` `understory` `canopy` `organic (O)` `surface (A)` `eluviated (E)` `subsoil (B)` `parent material (C)` `bedrock (R)` `epipelagic \| mesopelagic` `bathypelagic` `abysopelagic` `hadalpelagic`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:sampledSubstrateLayer
Term IRI	http://rs.tdwg.org/dwc/iri/sampledSubstrateLayer
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/sampledSubstrateLayer-2026-05-26
Label	Sampled Substrate Layer (IRI)
Definition	An IRI identifying a substrate layer sampled during a dwc:Event.
Notes	Recommended best practice is describe a dwc:Event with no more than one sampled substrate layer. In the case of a dwc:Event that cannot be attributed to a specific layer, the recommended best practice is to repeat the property for each IRI that denotes a different layer that applies to the dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:SampleRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/SampleRemarks
Modified	2009-04-29
Label	Sample Remarks
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/occurrenceRemarks
Definition	Comments or notes about the sample or record.
Notes	Example: "found dead on road"
ABCD equivalence	DataSets/DataSet/Units/Unit/Notes
Type	Property

Term Name dwc:sampleSizeUnit
Term IRI	http://rs.tdwg.org/dwc/terms/sampleSizeUnit
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sampleSizeUnit-2023-06-28
Label	Sample Size Unit
Definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwc:sampleSizeUnit must have a corresponding dwc:sampleSizeValue, e.g., `5` for dwc:sampleSizeValue with `m` for dwc:sampleSizeUnit. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`minute` `hour` `day` `metre` `square metre` `cubic metre`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Term Name dwciri:sampleSizeUnit
Term IRI	http://rs.tdwg.org/dwc/iri/sampleSizeUnit
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/sampleSizeUnit-2025-07-10
Label	Sampling Size Unit (IRI)
Definition	The unit of measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwciri:sampleSizeUnit must have a corresponding dwc:sampleSizeValue. Recommended best practice is to use a controlled vocabulary such as the Ontology of Units of Measure http://www.wurvoc.org/vocabularies/om-1.8/ of SI units, derived units, or other non-SI units accepted for use within the SI.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:sampleSizeValue
Term IRI	http://rs.tdwg.org/dwc/terms/sampleSizeValue
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sampleSizeValue-2023-06-28
Label	Sample Size Value
Definition	A numeric value for a measurement of the size (time duration, length, area, or volume) of a sample in a sampling dwc:Event.
Notes	A dwc:sampleSizeValue must have a corresponding dwc:sampleSizeUnit.
Examples	`5` (sampleSizeValue) with `metre` (sampleSizeUnit)
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2015-03-19_18

Term Name dwc:SamplingAttributeID
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingAttributeID
Modified	2009-04-29
Label	Sample Attribute ID
	This term is deprecated and should no longer be used.
Definition	An identifier for the sampling attribute. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:SamplingAttributeType
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingAttributeType
Modified	2009-04-29
Label	Sample Attribute Type
	This term is deprecated and should no longer be used.
Definition	The nature of the measurement or characteristic of the sample. Recommended best practice is to use a controlled vocabulary.
Notes	Example: "tail length"
ABCD equivalence	DataSets/DataSet/Units/Unit/MeasurementsOrFacts/MeasurementOrFact/MeasurementOrFactAtomised/Parameter
Type	Property

Term Name dwc:samplingEffort
Term IRI	http://rs.tdwg.org/dwc/terms/samplingEffort
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/samplingEffort-2026-09-17
Label	Sampling Effort
Definition	The amount of effort expended during an eco:Survey.
Examples	`40 trap-nights` `10 observer-hours` `10 km by foot` `30 km by car`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:samplingEffortProtocol
Term IRI	http://rs.tdwg.org/eco/iri/samplingEffortProtocol
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/eco/iri/version/samplingEffortProtocol-2025-07-10
Label	Sampling Effort Protocol (IRI)
Definition	A method or protocol used to determine the sampling effort, denoted by an IRI.
Notes	This protocol should be associated with the values reported in eco:samplingEffortValue and eco:samplingEffortUnit. This is a specialization of eco:protocolDescriptions focused on effort, distinct from the survey method. The effort relates to the intensity of sampling and therefore can assist in interpreting estimates of completeness. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_46
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51

Term Name eco:samplingEffortProtocol
Term IRI	http://rs.tdwg.org/eco/terms/samplingEffortProtocol
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/samplingEffortProtocol-2026-09-17
Label	Sampling Effort Protocol
Definition
Type
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_46
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:samplingEffortUnit
Term IRI	http://rs.tdwg.org/eco/iri/samplingEffortUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/samplingEffortUnit-2026-09-17
Label	Sampling Effort Unit
Definition	The units associated with an eco:samplingEffortValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:samplingEffortUnit
Term IRI	http://rs.tdwg.org/eco/terms/samplingEffortUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/samplingEffortUnit-2026-09-17
Label	Sampling Effort Unit
Definition	The units associated with an eco:samplingEffortValue.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`trapHours` `personHours` `trapDays`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:samplingEffortValue
Term IRI	http://rs.tdwg.org/eco/terms/samplingEffortValue
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/samplingEffortValue-2026-09-17
Label	Sampling Effort Value
Definition	The numeric value for the sampling effort expended during an eco:Survey.
Notes	This term is meant to capture the total sampling effort value. To express details of how the effort was determined use eco:samplingEffortProtocol. For compilations it is recommend not to infer effort. An eco:samplingEffortValue must have a corresponding eco:samplingEffortUnit.
Examples	`1900` `40` `5.5`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:SamplingEvent
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingEvent
Modified	2009-04-29
Label	Sampling Event
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/Event
Definition	Container class for information about the conditions and methods of acquisition of samples.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering
Type	Class

Term Name dwc:SamplingEventAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingEventAttributes
Modified	2009-04-29
Label	Sampling Event Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements or characteristics of the sampling event.
Notes	Example: "Relative humidity: 28 %; Temperature: 22 C; Sample size: 10 kg"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteMeasurementsOrFacts
Type	Property

Term Name dwc:SamplingEventID
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingEventID
Modified	2009-04-29
Label	Sampling Event ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventID
Definition	An identifier for the sampling event. May be a global unique identifier or an identifier specific to the data set.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Code
Type	Property

Term Name dwc:SamplingEventRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingEventRemarks
Modified	2009-04-29
Label	Sampling Event Remarks
	This term is deprecated and should no longer be used.
Definition	Comments or notes about the sampling event.
Notes	Example: "found dead on road"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:SamplingLocation
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingLocation
Modified	2009-04-29
Label	Sampling Location
	This term is deprecated and should no longer be used.
Definition	Container class for information about the location where a sampling event occurred.
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type	Class

Term Name dwc:SamplingLocationID
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingLocationID
Modified	2009-04-29
Label	Sampling Location ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/locationID
Definition	An identifier for the sampling location. May be a global unique identifier or an identifier specific to the data set.
Notes	Example: "MVZ:LocID:12345"
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:SamplingLocationRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/SamplingLocationRemarks
Modified	2009-04-29
Label	Sampling Location Remarks
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/locationRemarks
Definition	Comments or notes about the sampling location.
Notes	Example: "under water since 2005"
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/AreaDetail
Type	Property

Term Name eco:samplingPerformedBy
Term IRI	http://rs.tdwg.org/eco/terms/samplingPerformedBy
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/samplingPerformedBy-2026-09-17
Label	Sampling Performed By
Definition	A person, group, or organization responsible for recording an eco:Survey.
Notes	An eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`North American Butterfly Association` `KK Wall`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_46
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:samplingPerformedBy
Term IRI	http://rs.tdwg.org/eco/iri/samplingPerformedBy
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/samplingPerformedBy-2026-09-17
Label	Sampling Performed By
Definition	A person, group, or organization responsible for recording an eco:Survey.
Notes	An eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:samplingPerformedByID
Term IRI	http://rs.tdwg.org/eco/terms/samplingPerformedByID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/samplingPerformedByID-2026-09-17
Label	Sampling Performed By ID
Definition	An identifier for a dcterms:Agent responsible for sampling.
Notes	The sampling eco:Survey could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all the organizations or people involved in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( `\|` ).
Examples	`https://orcid.org/0000-0003-0243-2379` `http://orcid.org/0000-0002-0786-4069 \| http://orcid.org/0000-0003-4639-823X`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:samplingProtocol
Term IRI	http://rs.tdwg.org/dwc/iri/samplingProtocol
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/samplingProtocol-2026-09-17
Label	Sampling Protocol (IRI)
Definition	The methods or protocols used during an eco:Survey, denoted by an IRI.
Notes	Recommended best practice is to describe an eco:Survey with no more than one sampling protocol. In the case of a summary eco:Survey in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to repeat the property for each IRI that denotes a different sampling protocol that applies to the dwc:Occurrence.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:samplingProtocol
Term IRI	http://rs.tdwg.org/dwc/terms/samplingProtocol
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/samplingProtocol-2026-09-17
Label	Sampling Protocol
Definition	The names of, references to, or descriptions of the methods or protocols used during an eco:Survey.
Notes	Recommended best practice is to describe an eco:Survey with no more than one sampling protocol. In the case of a summary eco:Survey with multiple protocols, in which a specific protocol can not be attributed to specific dwc:Occurrences, the recommended best practice is to separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`UV light trap` `mist net` `bottom trawl` `ad hoc observation \| point count` `Penguins from space: faecal stains reveal the location of emperor penguin colonies, https://doi.org/10.1111/j.1466-8238.2009.00467.x` `Takats et al. 2001. Guidelines for Nocturnal Owl Monitoring in North America. Beaverhill Bird Observatory and Bird Studies Canada, Edmonton, Alberta. 32 pp., http://www.bsc-eoc.org/download/Owl.pdf`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:scientificName
Term IRI	http://rs.tdwg.org/dwc/terms/scientificName
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/scientificName-2026-05-26
Label	Scientific Name
Definition	The full scientific name, with authorship and date information if known. When forming part of a dwc:Identification, this should be the name in lowest level taxonomic rank that can be determined.
Notes	This term should not contain identification qualifications, which should instead be supplied in the IdentificationQualifier term. When applied to an Organism or Occurrence, this term should be used to represent the scientific name that was applied to the associated Organism in accordance with the Taxon to which it was or is currently identified. Names should be compliant to the most recent nomenclatural code. For example, names of hybrids for algae, fungi and plants should follow the rules of the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H.1, H.2 and H.3). Thus, use the multiplication sign `×` (Unicode `U+00D7`, HTML `×`) to identify a hybrid, not `x` or `X`, if possible.
Examples	`Coleoptera` (order) `Vespertilionidae` (family) `Manis` (genus) `Ctenomys sociabilis` (genus + specificEpithet) `Ambystoma tigrinum diaboli` (genus + specificEpithet + infraspecificEpithet) `Roptrocerus typographi (Györfi, 1952)` (genus + specificEpithet + scientificNameAuthorship) `Quercus agrifolia var. oxyadenia (Torr.) J.T. Howell` (genus + specificEpithet + taxonRank + infraspecificEpithet + scientificNameAuthorship) `×Agropogon littoralis (Sm.) C. E. Hubb.` `Mentha ×smithiana R. A. Graham` `Agrostis stolonifera L. × Polypogon monspeliensis (L.) Desf.`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/FullScientificNameString
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:scientificNameAuthorship
Term IRI	http://rs.tdwg.org/dwc/terms/scientificNameAuthorship
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/scientificNameAuthorship-2023-06-28
Label	Scientific Name Authorship
Definition	The authorship information for the dwc:scientificName formatted according to the conventions of the applicable dwc:nomenclaturalCode.
Examples	`(Torr.) J.T. Howell` `(Martinovský) Tzvelev` `(Györfi, 1952)`
ABCD equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/ParentheticalAuthorTeamAndYear + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/AuthorTeamAndYear} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeamParenthesis + DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/AuthorTeam} or {DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamOriginalAndYear + [= or] DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/AuthorTeamParenthesisAndYear}
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:scientificNameID
Term IRI	http://rs.tdwg.org/dwc/terms/scientificNameID
Modified	2017-10-06
Term version IRI	http://rs.tdwg.org/dwc/terms/version/scientificNameID-2017-10-06
Label	Scientific Name ID
Definition	An identifier for the nomenclatural (not taxonomic) details of a scientific name.
Examples	`urn:lsid:ipni.org:names:37829-1:1.3`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19

Term Name dwc:scientificNameRank
Term IRI	http://rs.tdwg.org/dwc/terms/scientificNameRank
Modified	2009-09-21
Label	Scientific Name Rank
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/taxonRank
Definition	The taxonomic rank of the most specific name in the scientificName. Recommended best practice is to use a controlled vocabulary.
Notes	Examples: "subsp.", "var.", "forma", "species", "genus"
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type	Property

Term Name dwc:sequence
Term IRI	http://rs.tdwg.org/dwc/terms/sequence
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sequence-2026-05-26
Label	Sequence
Definition	A string representing nucleotide base pairs.
Notes	Recommended best practice is to use IUPAC single character symbols (https://www.bioinformatics.org/sms/iupac.html). Use "N" for an unknown or missing nucleotide, and avoid using "?". The sequence should be written in the 5' to 3' direction.
Examples	`TCTATCCTCAATTATAGGTCATAATTCACCATCAG`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:sex
Term IRI	http://rs.tdwg.org/dwc/terms/sex
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/sex-2026-05-26
Label	Sex
Definition	A sex of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`female` `male` `hermaphrodite`
ABCD equivalence	DataSets/DataSet/Units/Unit/Sex
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:sex
Term IRI	http://rs.tdwg.org/dwc/iri/sex
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/sex-2026-05-26
Label	Sex (IRI)
Definition	A sex of a dwc:Organism.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:siteCount
Term IRI	http://rs.tdwg.org/eco/terms/siteCount
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/siteCount-2026-09-17
Label	Site Count
Definition	Total number of individual sites surveyed during an eco:Survey.
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`1` `15`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:siteNestingDescription
Term IRI	http://rs.tdwg.org/eco/terms/siteNestingDescription
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/siteNestingDescription-2026-09-17
Label	Site Nesting Description
Definition	Textual description of the hierarchical sampling design.
Notes	Site refers to the location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy.
Examples	`5 sampling sites of 3-5 plots each`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:siteNumber
Term IRI	http://rs.tdwg.org/dwc/iri/siteNumber
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/siteNumber-2026-05-26
Label	Site Number (IRI)
Definition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwciri:fieldNumber in that dwciri:siteNumber is not related strictly to one dwc:Event. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:siteNumber
Term IRI	http://rs.tdwg.org/dwc/terms/siteNumber
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/siteNumber-2026-05-26
Label	Site Number
Definition	An identifier for a named site.
Notes	Usually an institutional identifier for a specific named place as opposed to dwc:locationID, which is an identifier for the entire set of distinct information for an instance of dcterms:Location. This term differs from dwc:fieldNumber in that dwc:siteNumber is not related strictly to one dwc:Event. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`USGS CENO LOC 21387` `UCM 2025001`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:specificEpithet
Term IRI	http://rs.tdwg.org/dwc/terms/specificEpithet
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/specificEpithet-2023-06-28
Label	Specific Epithet
Definition	The name of the first or species epithet of the dwc:scientificName.
Examples	`concolor` `gottschei`
ABCD equivalence	{DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Bacterial/SpeciesEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/FirstEpithet or DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Zoological/SpeciesEpithet}
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:startDayOfYear
Term IRI	http://rs.tdwg.org/dwc/terms/startDayOfYear
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/startDayOfYear-2026-05-26
Label	Start Day Of Year
Definition	The earliest integer day of the year on which a dwc:Event occurred.
Notes	The value is 1 for January 1 and 365 for December 31, except in a leap year, in which case it is 366.
Examples	`1` (1 January) `32` (1 February) `366` (31 December) `365` (30 December in a leap year, 31 December in a non-leap year)
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DayNumberBegin
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:StartTimeOfDay
Term IRI	http://rs.tdwg.org/dwc/terms/StartTimeOfDay
Modified	2009-04-24
Label	Start Time of Day
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/eventTime
Definition	The time of day when the event began, expressed as decimal hours from midnight, local time.
Notes	Examples: "12.0" (= noon), "13.5" (= 1:30pm)
ABCD equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Property

Term Name dwc:stateProvince
Term IRI	http://rs.tdwg.org/dwc/terms/stateProvince
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/stateProvince-2023-06-28
Label	First Order Division
Definition	The name of the next smaller administrative region than country (state, province, canton, department, region, etc.) in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names. Recommended best practice is to leave this field blank if the dcterms:Location spans multiple entities at this administrative level or if the dcterms:Location might be in one or another of multiple possible entities at this level. Multiplicity and uncertainty of the geographic entity can be captured either in the term dwc:higherGeography or in the term dwc:locality, or both.
Examples	`Montana` `Minas Gerais` `Córdoba`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= State or = Province (etc.)
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:subfamily
Term IRI	http://rs.tdwg.org/dwc/terms/subfamily
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/subfamily-2023-06-28
Label	Subfamily
Definition	The full scientific name of the subfamily in which the dwc:Taxon is classified.
Examples	`Periptyctinae` `Orchidoideae` `Sphindociinae`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonName if DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/HigherTaxa/HigherTaxon/HigherTaxonRank == "subfamilia"
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34

Term Name dwc:subgenus
Term IRI	http://rs.tdwg.org/dwc/terms/subgenus
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/subgenus-2025-06-12
Label	Subgenus
Definition	The full scientific name of the subgenus in which the dwc:Taxon is classified.
Notes	A value for this term should be a complete subgenus name as required by the appropriate nomenclatural code.
Examples	`Abacetus (Parastygis)` `Dicranum subgen. Orthodicranum`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:substrate
Term IRI	http://rs.tdwg.org/dwc/terms/substrate
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/substrate-2026-09-17
Label	Substrate
Definition	A type of biotic or abiotic material to which a dwc:Organism was attached during a dwc:Occurrence.
Notes	No inference can be made from this term that a dwc:Organism interacted in any other way than being connected to some (not a particular) material resource of the substrate type (such as during parasitization or decomposition). A host-parasite relationship is better expressed as a dwc:OrganismInteraction. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`stone` `wall` `decaying wood` `wooden board fence` `animal bones`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:substrate
Term IRI	http://rs.tdwg.org/dwc/iri/substrate
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/iri/version/substrate-2026-09-17
Label	Substrate (IRI)
Definition	A type of biotic or abiotic material to which a dwc:Organism was attached during a dwc:Occurrence.
Notes	No inference can be made from this term that a dwc:Organism interacted in any other way than being connected to some (not a particular) material resource of the substrate type (such as during parasitization or decomposition). A host-parasite relationship is better expressed as a dwc:OrganismInteraction. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:subtribe
Term IRI	http://rs.tdwg.org/dwc/terms/subtribe
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/subtribe-2023-06-28
Label	Subtribe
Definition	The full scientific name of the subtribe in which the dwc:Taxon is classified.
Examples	`Plotinini` `Typhaeini`
ABCD equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Term Name dwc:superfamily
Term IRI	http://rs.tdwg.org/dwc/terms/superfamily
Modified	2023-07-07
Term version IRI	http://rs.tdwg.org/dwc/terms/version/superfamily-2023-07-07
Label	Superfamily
Definition	The full scientific name of the superfamily in which the dwc:Taxon is classified.
Notes	A taxonomic category subordinate to an order and superior to a family. According to ICZN article 29.2, the suffix `-oidea` is used for a superfamily name.
Examples	`Achatinoidea` `Cerithioidea` `Helicoidea` `Hypsibioidea` `Valvatoidea` `Zonitoidea`
ABCD equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: superfamilia)
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Term Name eco:Survey
Term IRI	http://rs.tdwg.org/eco/terms/Survey
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/Survey-2026-09-17
Label	Survey
Definition	A dwc:Event intentionally designed to characterize a defined biotic target or domain in such a way that the resulting dwc:Occurrences can be interpreted collectively to support ecological and monitoring inference (such as detectability, abundance, species co-occurence, spatial distribution, or temporal trends), rather than merely documenting individual observations or gathered material.
Notes	Many terms from the Humboldt Extension for Ecological Inventories (eco: namespace) are organized in this class, particularly those that help describe and document the sampling process.
Examples	`a botanical survey of a protected area to assess native and invasive plant species` `a wetland vegetation mapping` `a camera trap deployment in a rainforest to monitor large mammals` `a frog call survey in wetlands across breeding seasons` `a coverboard survey for reptiles in forested environments` `a pollinator survey in an agricultural landscape` `a macroinvertebrate sampling in a freshwater stream to assess water quality` `a habitat- or ecosystem-level survey (e.g., coral reef health assessment, forest biodiversity assessment)` `an environmental impact assessment (e.g., pre-construction biological baseline survey for a wind farm project)`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:surveyID
Term IRI	http://rs.tdwg.org/eco/terms/surveyID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyID-2026-05-26
Label	Survey ID
Definition	An identifier for an eco:Survey.
Notes	Recommended best practice is to use a globally unique identifier.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name ecoiri:surveySiteType
Term IRI	http://rs.tdwg.org/eco/iri/surveySiteType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/surveySiteType-2026-09-17
Label	Survey Site Type (IRI)
Definition	A spatial category of a sampling location for an eco:Survey.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:surveySiteType
Term IRI	http://rs.tdwg.org/eco/terms/surveySiteType
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveySiteType-2026-09-17
Label	Survey Site Type
Definition	A spatial category of a sampling location for an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`horizontalTransect` `verticalTransect` `arealPlot` `observationPoint`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:SurveyTarget
Term IRI	http://rs.tdwg.org/eco/terms/SurveyTarget
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/SurveyTarget-2026-05-26
Label	SurveyTarget
Definition	One or more scopes that describe a target for dwc:Occurrences in an eco:Survey.
Examples	`all bird species` `all bird species except Larus gulls, fulmars and kittiwakes` `reproductive female Ctenomys sociabilis (only)` `Oncorhynchus mykiss and Oncorhynchus clarkii (only)`, `all total lengths except < 12 inches`
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:surveyTargetDescription
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetDescription
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetDescription-2026-09-17
Label	Survey Target Description
Definition	A verbatim description of an eco:SurveyTarget.
Examples	`all passerine birds` `all flowering Rosaceae`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:surveyTargetID
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetID-2026-05-26
Label	Survey Target ID
Definition	An identifier for an eco:SurveyTarget.
Notes	Recommended best practice is to use a globally unique identifier. Note: values of this term are not meant to be unique within an eco:SurveyTarget. A full eco:SurveyTarget is composed of all records that share the same eco:surveyTargetID.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:surveyTargetRemarks
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetRemarks
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetRemarks-2026-09-17
Label	Survey Target Remarks
Definition	Comments or notes about an eco:SurveyTarget.
Examples	`Survey target scopes reflect post-facto filtering, not original survey design.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:surveyTargetType
Term IRI	http://rs.tdwg.org/eco/iri/surveyTargetType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/iri/version/surveyTargetType-2026-05-26
Label	Survey Target Type (IRI)
Definition	A category that best matches the nature of a scope in an eco:SurveyTarget.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:surveyTargetType
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetType-2026-05-26
Label	Survey Target Type
Definition	A category that best matches the nature of a scope in an eco:SurveyTarget.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`taxon` `habitat` `establishmentMeans` `growthForm` `sex` `lifeStage` `minimum length`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name ecoiri:surveyTargetUnit
Term IRI	http://rs.tdwg.org/eco/iri/surveyTargetUnit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/iri/version/surveyTargetUnit-2026-05-26
Label	Survey Target Unit (IRI)
Definition	Unit associated with a value in eco:surveyTargetValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:surveyTargetUnit
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetUnit
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetUnit-2026-05-26
Label	Survey Target Unit
Definition	Unit associated with a value in eco:surveyTargetValue.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`m` `g` `years`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name eco:surveyTargetValue
Term IRI	http://rs.tdwg.org/eco/terms/surveyTargetValue
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/terms/version/surveyTargetValue-2026-05-26
Label	Survey Target Value
Definition	A value to include or exclude in a scope categorized by eco:surveyTargetType.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`Aves` `oak savannah` `native` `tree` `female` `adult` `height` `weight`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name ecoiri:surveyTargetValue
Term IRI	http://rs.tdwg.org/eco/iri/surveyTargetValue
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/eco/iri/version/surveyTargetValue-2026-05-26
Label	Survey Target Value (IRI)
Definition	A value to include or exclude in a scope categorized by eco:surveyTargetType.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_59

Term Name ecoiri:targetDegreeOfEstablishmentScope
Term IRI	http://rs.tdwg.org/eco/iri/targetDegreeOfEstablishmentScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/targetDegreeOfEstablishmentScope-2026-09-17
Label	Target Degree of Establishment Scope
Definition	The degree of establishment of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/doe/. For details, refer to https://doi.org/10.3897/biss.3.38084 . Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/dwcem/values/e001` `http://rs.tdwg.org/dwcem/values/e005`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:targetDegreeOfEstablishmentScope
Term IRI	http://rs.tdwg.org/eco/terms/targetDegreeOfEstablishmentScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/targetDegreeOfEstablishmentScope-2026-09-17
Label	Target Degree of Establishment Scope
Definition	The degrees of establishment of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use controlled value strings from the controlled vocabulary (http://rs.tdwg.org/dwcdoe/) for dwc:degreeOfEstablishment. For details, refer to https://doi.org/10.3897/biss.3.38084. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`native` `invasive \| widespreadInvasive`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:targetGrowthFormScope
Term IRI	http://rs.tdwg.org/eco/iri/targetGrowthFormScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/targetGrowthFormScope-2026-09-17
Label	Target Growth Form Scope
Definition	The growth form or habit of the dwc:Organisms targeted for sampling during the eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:targetGrowthFormScope
Term IRI	http://rs.tdwg.org/eco/terms/targetGrowthFormScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/targetGrowthFormScope-2026-09-17
Label	Target Growth Form Scope
Definition	The growth forms or habits of the dwc:Organisms targeted for sampling during the eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`tree` `shrub \| subShrub`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:targetHabitatScope
Term IRI	http://rs.tdwg.org/eco/iri/targetHabitatScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/targetHabitatScope-2026-09-17
Label	Target Habitat Scope
Definition	The habitat targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use an IRI from a controlled vocabulary. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:targetHabitatScope
Term IRI	http://rs.tdwg.org/eco/terms/targetHabitatScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/targetHabitatScope-2026-09-17
Label	Target Habitat Scope
Definition	The habitats targeted for sampling during an eco:Survey.
Notes	Recommended best practice is to use a controlled vocabulary and separate the values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`dunes` `pineForest` `riparian` `scrub \| grassland`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:targetLifeStageScope
Term IRI	http://rs.tdwg.org/eco/iri/targetLifeStageScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/targetLifeStageScope-2026-09-17
Label	Target Life Stage Scope
Definition	The age class or life stage of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	This term is defined based on dwciri:lifeStage (http://rs.tdwg.org/dwc/terms/iri/lifeStage). Recommended best practice is to use an IRI from the same controlled vocabulary as for dwciri:lifeStage. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:targetLifeStageScope
Term IRI	http://rs.tdwg.org/eco/terms/targetLifeStageScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/targetLifeStageScope-2026-09-17
Label	Target Life Stage Scope
Definition	The age classes or life stages of the dwc:Organisms targeted for sampling during an eco:Survey.
Notes	This term is defined based on dwc:lifeStage. Recommended best practice is to use the same controlled vocabulary as for dwc:lifeStage and to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`larva` `adult \| juvenile`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:targetTaxonomicScope
Term IRI	http://rs.tdwg.org/eco/terms/targetTaxonomicScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/targetTaxonomicScope-2026-09-17
Label	Target Taxonomic Scope
Definition	The taxonomic group(s) targeted for sampling during an eco:Survey.
Notes	An eco:Survey to which the eco:targetTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all taxonomic groups surveyed in the child eco:Surveys that contributed to the parent eco:Survey. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Aves` `Aves \| Mammalia` `Procellariformes`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:targetTaxonomicScope
Term IRI	http://rs.tdwg.org/eco/iri/targetTaxonomicScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/targetTaxonomicScope-2026-09-17
Label	Target Taxonomic Scope
Definition	The taxonomic group targeted for sampling during an eco:Survey.
Notes	The eco:Survey to which the ecoiri:targetTaxonomicScope refers could be at any level of hierarchy. In the case of a higher level (parent) eco:Survey, include all taxonomic groups surveyed in the child eco:Surveys that contributed to the parent eco:Survey. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:Taxon
Term IRI	http://rs.tdwg.org/dwc/terms/Taxon
Modified	2023-09-18
Term version IRI	http://rs.tdwg.org/dwc/terms/version/Taxon-2023-09-18
Label	Taxon
Definition	A group of organisms (sensu http://purl.obolibrary.org/obo/OBI_0100026) considered by taxonomists to form a homogeneous unit.
Examples	`the genus Truncorotaloides as published by Brönnimann et al. in 1953 in the Journal of Paleontology Vol. 27(6) p. 817-820`
ABCD equivalence	no simple equivalent in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-26_15

Term Name dwc:taxonAccordingTo
Term IRI	http://rs.tdwg.org/dwc/terms/taxonAccordingTo
Modified	2009-09-21
Label	Taxon According To
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/nameAccordingTo
Definition	Information about the authorship of this taxon concept which uses the scientificName in their sense (secundum, sensu). Could be a publication (identification key), institution or team of individuals.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:taxonAttributes
Term IRI	http://rs.tdwg.org/dwc/terms/taxonAttributes
Modified	2009-10-09
Label	Taxon Attributes
	This term is deprecated and should no longer be used.
Definition	A list (concatenated and separated) of additional measurements, facts, characteristics, or assertions about the taxon.
Notes	Example: "iucnstatus=vulnerable; distribution=Neuquen, Argentina"
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/Result/TaxonIdentified/InformalNameString
Type	Property

Term Name eco:taxonCompletenessProtocols
Term IRI	http://rs.tdwg.org/eco/terms/taxonCompletenessProtocols
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/taxonCompletenessProtocols-2026-09-17
Label	Taxon Completeness Protocols
Definition	A description of or reference (publication, URL) to the methods used to determine eco:taxonCompletenessReported.
Notes	This term allows users to determine how comprehensively an area has been sampled. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`census \| based on sampling effort` `based on species accumulation curves`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:taxonCompletenessProtocols
Term IRI	http://rs.tdwg.org/eco/iri/taxonCompletenessProtocols
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/taxonCompletenessProtocols-2026-09-17
Label	Taxon Completeness Protocols
Definition	A method or protocol used to determine ecoiri:taxonCompletenessReported, denoted by an IRI.
Notes	This term allows users to determine how comprehensively an area has been sampled. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:taxonCompletenessReported
Term IRI	http://rs.tdwg.org/eco/iri/taxonCompletenessReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/taxonCompletenessReported-2026-09-17
Label	Taxon Completeness Reported
Definition	Statement about whether the taxonomic completeness of an eco:Survey was assessed.
Notes	This term is meant to alert users that the inventory was conducted in such a way that all of the target taxa (the combination of ecoiri:targetTaxonomicScope and ecoiri:excludedTaxonomicScope) should have been detectable if they were present during the dwc:Event. This term can provide data users with a qualitative measure of how comprehensively an area has been surveyed, which assists in interpreting species populations, areas of occupancy, inferring species absences, etc. This term is only relevant if the dwc:Event used restricted search or open search methods. If taxonomic completeness was assessed, the methods used or an explanation of the basis of the completeness should covered by ecoiri:taxonCompletenessProtocols. Recommended best practice is to use an IRI from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/tcr/. Terms in the ecoiri: namespace are intended to be used in RDF with non-literal objects.
Examples	`http://rs.tdwg.org/ecotcr/values/tcr01` `http://rs.tdwg.org/ecotcr/values/tcr02`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:taxonCompletenessReported
Term IRI	http://rs.tdwg.org/eco/terms/taxonCompletenessReported
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/taxonCompletenessReported-2026-09-17
Label	Taxon Completeness Reported
Definition	Statement about whether the taxonomic completeness of an eco:Survey was assessed.
Notes	This term is meant to alert users that the inventory was conducted in such a way that all of the target taxa (the combination of eco:targetTaxonomicScope and eco:excludedTaxonomicScope) should have been detectable if they were present during an eco:Survey. This term can provide data users with a qualitative measure of how comprehensively an area has been surveyed, which assists in interpreting species populations, areas of occupancy, inferring species absences, etc. This term is only relevant if an eco:Survey used restricted search or open search methods. If taxonomic completeness was assessed, the methods used or an explanation of the basis of the completeness should be stated in eco:taxonCompletenessProtocols. Recommended best practice is to use controlled value strings from the controlled vocabulary designated for use with this term, listed at http://rs.tdwg.org/dwc/doc/tcr/. This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`notReported` `reportedComplete` `reportedIncomplete`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:taxonConceptID
Term IRI	http://rs.tdwg.org/dwc/terms/taxonConceptID
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonConceptID-2023-06-28
Label	Taxon Concept ID
Definition	An identifier for the taxonomic concept to which the record refers - not for the nomenclatural details of a dwc:Taxon.
Examples	`8fa58e08-08de-4ac1-b69c-1235340b7001`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwciri:taxonFormula
Term IRI	http://rs.tdwg.org/dwc/iri/taxonFormula
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/taxonFormula-2026-05-26
Label	Taxon Formula (IRI)
Definition	A pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:taxonFormula
Term IRI	http://rs.tdwg.org/dwc/terms/taxonFormula
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonFormula-2026-05-26
Label	Taxon Formula
Definition	A string representing the pattern to use to construct a dwc:Identification from dwc:Taxon names and identification qualifiers.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`A` `not A` `A ?` `A or B` `A and B` `A x B` `A cf.` `A aff.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:TaxonID
Term IRI	http://rs.tdwg.org/dwc/terms/TaxonID
Modified	2009-04-24
Label	Taxon ID
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/taxonNameID
Definition	A global unique identifier for the taxon (name in a classification).
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:taxonID
Term IRI	http://rs.tdwg.org/dwc/terms/taxonID
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonID-2026-05-26
Label	Taxon ID
Definition	An identifier for a dwc:Taxon.
Examples	`8fa58e08-08de-4ac1-b69c-1235340b7001` `32567` `https://www.gbif.org/species/212`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:taxonNameID
Term IRI	http://rs.tdwg.org/dwc/terms/taxonNameID
Modified	2009-07-06
Label	Taxon Name ID
	This term is deprecated and should no longer be used.
Definition	A unique identifier for the scientificName.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:taxonomicStatus
Term IRI	http://rs.tdwg.org/dwc/terms/taxonomicStatus
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonomicStatus-2023-06-28
Label	Taxonomic Status
Definition	The status of the use of the dwc:scientificName as a label for a taxon. Requires taxonomic opinion to define the scope of a dwc:Taxon. Rules of priority then are used to define the taxonomic status of the nomenclature contained in that scope, combined with the experts opinion. It must be linked to a specific taxonomic reference that defines the concept.
Notes	Recommended best practice is to use a controlled vocabulary.
Examples	`invalid` `misapplied` `homotypic synonym` `accepted`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:taxonRank
Term IRI	http://rs.tdwg.org/dwc/terms/taxonRank
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonRank-2026-05-26
Label	Taxon Rank
Definition	The taxonomic rank of the most specific name in the dwc:scientificName.
Notes	Recommended best practice is to use a controlled vocabulary. The taxon ranks of algae, fungi and plants are defined in the International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code Articles H3.2, H4.4 and H.3.1).
Examples	`subspecies` `varietas` `forma` `species` `genus` `nothogenus` `nothospecies` `nothosubspecies`
ABCD equivalence	DataSets/DataSet/Units/Unit/Identifications/Identification/TaxonIdentified/ScientificName/NameAtomised/Botanical/Rank
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:taxonRemarks
Term IRI	http://rs.tdwg.org/dwc/terms/taxonRemarks
Modified	2017-10-06
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonRemarks-2017-10-06
Label	Taxon Remarks
Definition	Comments or notes about the taxon or name.
Examples	`this name is a misspelling in common use`
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:taxonSortOrder
Term IRI	http://rs.tdwg.org/dwc/terms/taxonSortOrder
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/taxonSortOrder-2026-09-17
Label	Taxon Sort Order
Definition	A numerical position of a dwc:Taxon in a dwc:taxonFormula.
Notes	The number signifies which dwc:Taxon in the related dwc:taxonFormula this record refers to (e.g., `1` refs to the `A` in the dwc:taxonFormula "A x B").
Examples	`1` `2`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:tectonicUnits
Term IRI	http://rs.tdwg.org/dwc/terms/tectonicUnits
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/tectonicUnits-2026-09-17
Label	Tectonic Units
Definition	The combination of all tectonic unit names for the rock from which a dwc:MaterialEntity was collected.
Notes	Recommended best practice is to use an authoritative tectonic unit lexicon such as the Tectonic Map of Switzerland (TK500). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`Upper Helvetic` `Wildhorn Nappe Complex` `Sublage Nappe`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:toDigitalSpecimen
Term IRI	http://rs.tdwg.org/dwc/iri/toDigitalSpecimen
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/iri/version/toDigitalSpecimen-2025-06-12
Label	To Digital Specimen
Definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	Use to link a dwc:MaterialEntity instance subject to a Digital Specimem entity.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name eco:totalAreaSampledUnit
Term IRI	http://rs.tdwg.org/eco/terms/totalAreaSampledUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/totalAreaSampledUnit-2026-09-17
Label	Total Area Sampled Unit
Definition	The units associated with eco:totalAreaSampledValue
Notes	Recommended best practice is to use a controlled vocabulary. For units containing exponents, use characters from the Unicode Latin-1 Supplement character set (hex 00B2 for squared and 00B3 for cubed). This term has an equivalent in the ecoiri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`km²`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_51
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name ecoiri:totalAreaSampledUnit
Term IRI	http://rs.tdwg.org/eco/iri/totalAreaSampledUnit
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/iri/version/totalAreaSampledUnit-2026-09-17
Label	Total Area Sampled Unit
Definition	The units associated with eco:totalAreaSampledValue
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-03-26_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:totalAreaSampledValue
Term IRI	http://rs.tdwg.org/eco/terms/totalAreaSampledValue
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/totalAreaSampledValue-2026-09-17
Label	Total Area Sampled Value
Definition	A numeric value for the total area, volume or distance surveyed during the dwc:Survey.
Notes	This value is always less than or equal to the eco:geospatialScopeAreaValue because it reflects the portion of the geospatialScope that was actually sampled. An eco:totalAreaSampledValue must have a corresponding eco:totalAreaSampledUnit.
Examples	`0.8`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:toTaxon
Term IRI	http://rs.tdwg.org/dwc/iri/toTaxon
Modified	2015-03-27
Term version IRI	http://rs.tdwg.org/dwc/iri/version/toTaxon-2015-03-27
Label	To Taxon
Definition	Use to link a dwc:Identification instance subject to a taxonomic entity such as a taxon, taxon concept, or taxon name use.
Notes	A "convenience property" that replaces Darwin Core literal-value terms related to taxonomic entities. See Section 2.7.4 of the Darwin Core RDF Guide for details.
ABCD equivalence	not in ABCD
Type	Property

Term Name dwc:treatments
Term IRI	http://rs.tdwg.org/dwc/terms/treatments
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/treatments-2026-09-17
Label	Treatments
Definition	Description of any processes or curatorial actions taken specifically to mitigate damage to a dwc:MaterialEntity.
Notes	Includes both proactive and reactive actions.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:tribe
Term IRI	http://rs.tdwg.org/dwc/terms/tribe
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/tribe-2023-06-28
Label	Tribe
Definition	The full scientific name of the tribe in which the dwc:Taxon is classified.
Examples	`Ortaliini` `Arethuseae`
ABCD equivalence	ScientificNameIdentified/HigherTaxon/HigherTaxonRank (enumeration value: )
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40

Term Name dc:type
Term IRI	http://purl.org/dc/elements/1.1/type
Modified	2025-06-12
Term version IRI	http://dublincore.org/usage/terms/history/#type-006
Label	Type
Definition	The nature or genre of the resource.
Notes	Must be populated with a value from the DCMI type vocabulary (https://www.dublincore.org/specifications/dublin-core/dcmi-type-vocabulary/2010-10-11/).
Examples	`StillImage` `MovingImage` `Sound` `PhysicalObject` `Event` `Text`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_20
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dcterms:type
Term IRI	http://purl.org/dc/terms/type
Modified	2008-01-14
Label	Type
	This term is deprecated and should no longer be used.
Is replaced by	http://purl.org/dc/elements/1.1/type
Definition	The nature or genre of the resource.
Notes	To provide a string literal value for type, use dc:type rather than this term. In accordance with the Darwin Core RDF guide, rdf:type should be used instead of this term to indicate an IRI value for type.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2009-12-07_1
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_20
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-02-24_55

Term Name dwc:typeOfType
Term IRI	http://rs.tdwg.org/dwc/terms/typeOfType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/typeOfType-2026-05-26
Label	Type Of Type
Definition	A category of nomenclatural type of a dwc:MaterialEntity.
Notes	The term dwc:typeOfType must be used in combination with dwc:typifiedName. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typeOfType can only have a single value. Recommended best practice is to use a controlled vocabulary such as the GBIF Nomenclatural Type Status Vocabulary. This term has an equivalent in the tcs: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype` `isotype`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/TypeStatus
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:typeStatus
Term IRI	http://rs.tdwg.org/dwc/iri/typeStatus
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/typeStatus-2025-07-10
Label	Type Status (IRI)
Definition	A nomenclatural type (type status, typified scientific name, publication) applied to the subject.
Notes	Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:typeStatus
Term IRI	http://rs.tdwg.org/dwc/terms/typeStatus
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/typeStatus-2023-06-28
Label	Type Status
Definition	A list (concatenated and separated) of nomenclatural types (type status, typified scientific name, publication) applied to the subject.
Notes	Recommended best practice is to separate the values in a list with space vertical bar space ( `\|` ). This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`holotype of Ctenomys sociabilis. Pearson O. P., and M. I. Christie. 1985. Historia Natural, 5(37):388` `holotype of Pinus abies \| holotype of Picea abies`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2014-10-30_16

Term Name dwc:typifiedName
Term IRI	http://rs.tdwg.org/dwc/terms/typifiedName
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/typifiedName-2026-05-26
Label	Typified Name
Definition	A scientific name for which a specimen or other name is the type.
Notes	The term dwc:typifiedName must be used in combination with dwc:typeOfType. Together they make up the type status of a specimen. Note that relatively very few specimens are nomenclatural types (types of names), so in most cases this term will have no value. Unlike dwc:typeStatus, dwc:typifiedName can only have a single value, so a dwc:MaterialEntity can only have a single dwc:typifiedName.
Examples	`Polysiphonia amphibolis Womersley`
ABCD equivalence	DataSets/DataSet/Units/Unit/SpecimenUnit/NomenclaturalTypeDesignations/NomenclaturalTypeDesignation/TypifiedName
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name chrono:uncalibratedChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/uncalibratedChronometricAge
Modified	2020-09-14
Term version IRI	http://rs.tdwg.org/chrono/terms/version/uncalibratedChronometricAge-2020-09-14
Label	Uncalibrated Chronometric Age
Definition	The output of a dating assay before it is calibrated into an age using a specific conversion protocol.
Examples	`1510 +/- 25 14C yr BP`, `16.26 Ma +/- 0.016`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33

Term Name dwc:UsagePolicy
Term IRI	http://rs.tdwg.org/dwc/terms/UsagePolicy
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/UsagePolicy-2026-05-26
Label	Usage Policy
Definition	Information about rights, usage, and attribution statements applicable to an entity.
Notes	This is a convenience class to group related properties.
ABCD equivalence	not in ABCD
Type	Class
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:usagePolicyID
Term IRI	http://rs.tdwg.org/dwc/terms/usagePolicyID
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/usagePolicyID-2026-09-17
Label	Usage Policy ID
Definition	An identifier for a dwc:UsagePolicy.
Examples	`https://localcontextshub.org/projects/54be05d7-aa5c-4886-abd9-dc45b2fa8df4/`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:verbatimAssertionType
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimAssertionType
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimAssertionType-2026-05-26
Label	Verbatim Assertion Type
Definition	A string representing the type of dwc:Assertion as it appeared in an original record.
Notes	This term is meant to allow the capture of an unaltered original name for a dwc:assertionType. This term is meant to be used in addition to dwc:assertionType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name chrono:verbatimChronometricAge
Term IRI	http://rs.tdwg.org/chrono/terms/verbatimChronometricAge
Modified	2020-09-14
Term version IRI	http://rs.tdwg.org/chrono/terms/version/verbatimChronometricAge-2020-09-14
Label	Verbatim Chronometric Age
Definition	The verbatim age for a specimen, whether reported by a dating assay, associated references, or legacy information.
Notes	For example, this could be the radiocarbon age as given in an AMS dating report. This could also be simply what is reported as the age of a specimen in legacy collections data.
Examples	`27 BC to 14 AD`, `stratigraphically pre-1104`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-04-27_33
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:verbatimCoordinates
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimCoordinates
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinates-2026-05-26
Label	Verbatim Coordinates
Definition	Verbatim original spatial coordinates of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`41 05 54S 121 05 34W` `17T 630000 4833400`
ABCD equivalence	{DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/CoordinatesText or DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesUTM/UTMText}
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimCoordinateSystem
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimCoordinateSystem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimCoordinateSystem-2026-05-26
Label	Verbatim Coordinate System
Definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`decimal degrees` `degrees decimal minutes` `degrees minutes seconds` `UTM`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesGrid/GridCellSystem
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:verbatimCoordinateSystem
Term IRI	http://rs.tdwg.org/dwc/iri/verbatimCoordinateSystem
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/verbatimCoordinateSystem-2026-05-26
Label	Verbatim Coordinate System (IRI)
Definition	A coordinate format for dwc:verbatimLatitude and dwc:verbatimLongitude or dwc:verbatimCoordinates.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimDepth
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimDepth
Modified	2017-10-06
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimDepth-2017-10-06
Label	Verbatim Depth
Definition	The original description of the depth below the local surface.
Examples	`100-200 m`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Depth/MeasurementOrFactText
Type	Property

Term Name dwc:verbatimElevation
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimElevation
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimElevation-2026-05-26
Label	Verbatim Elevation
Definition	An original description of the elevation of a dcterms:Location.
Examples	`100-200 m`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/Altitude/MeasurementOrFactText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimEventDate
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimEventDate
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimEventDate-2023-06-28
Label	Verbatim EventDate
Definition	The verbatim original representation of the date and time information for a dwc:Event.
Examples	`spring 1910` `Marzo 2002` `1999-03-XX` `17IV1934`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/DateTime/DateText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:verbatimIdentification
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimIdentification
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimIdentification-2026-09-17
Label	Verbatim Identification
Definition	A string representing the classification as it appeared in the original record.
Notes	This term is meant to allow the capture of an unaltered original identification/determination, including identification qualifiers, hybrid formulas, uncertainties, etc. This term is meant to be used in addition to dwc:geologicalMaterialName or dwc:scientificName (and dwc:identificationQualifier etc.), not instead of it.
Examples	`Peromyscus sp.` `Ministrymon sp. nov. 1` `Anser anser × Branta canadensis` `Pachyporidae?` `Potentilla × pantotricha Soják` `Aconitum pilipes × A. variegatum` `Lepomis auritus x cyanellus`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:verbatimLabel
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimLabel
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimLabel-2026-05-26
Label	Verbatim Label
Definition	A verbatim original representation of the written information affixed or related to a dwc:MaterialEntity.
Notes	The content of this term should include no embellishments, prefixes, headers or other additions made to the text. Abbreviations must not be expanded and supposed misspellings must not be corrected. Lines or breakpoints between blocks of text that could be verified by seeing the original labels or images of them may be used. Examples of material entities include preserved specimens, fossil specimens, and material samples. Best practice is to use UTF-8 for all characters. Best practice is to add comment “verbatimLabel derived from human transcription” in dwc:materialEntityRemarks. Examples can be found at https://dwc.tdwg.org/examples/verbatimLabel.
ABCD equivalence	Marks/Mark/MarkText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimLatitude
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimLatitude
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimLatitude-2026-05-26
Label	Verbatim Latitude
Definition	A verbatim original latitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`41 05 54.03S`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLatitude
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimLocality
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimLocality
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimLocality-2026-05-26
Label	Verbatim Locality
Definition	An original textual description of a dcterms:Location.
Examples	`25 km NNE Bariloche por R. Nac. 237`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/LocalityText
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimLongitude
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimLongitude
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimLongitude-2026-05-26
Label	Verbatim Longitude
Definition	A verbatim original longitude of a dcterms:Location.
Notes	The coordinate ellipsoid, geodeticDatum, or full Spatial Reference System (SRS) for these coordinates should be stored in dwc:verbatimSRS and the coordinate system should be stored in dwc:verbatimCoordinateSystem.
Examples	`121d 10' 34" W`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/SiteCoordinateSets/SiteCoordinates/CoordinatesLatLon/VerbatimLongitude
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verbatimMass
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimMass
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimMass-2026-09-17
Label	Verbatim Mass
Definition	The verbatim original representation of the mass of a dwc:MaterialEntity, including original units of measurement.
Examples	`11.01 Lbs` `105.07 g` `2.45 kg`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:verbatimMeasurementType
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimMeasurementType
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimMeasurementType-2025-06-12
Label	Verbatim Measurement Type
Definition	A string representing the type of measurement or fact as it appeared in the original record.
Notes	This term is meant to allow the capture of an unaltered original name for a measurement or fact type. This term is meant to be used in addition to dwc:measurementType, not instead of it.
Examples	`water_temp` `Fish biomass` `sampling net mesh size`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:verbatimScientificNameRank
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimScientificNameRank
Modified	2009-09-21
Label	Verbatim Scientific Name Rank
	This term is deprecated and should no longer be used.
Is replaced by	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Definition	The taxonomic rank of the most specific name in the scientificName as it appears in the original record.
Notes	Examples: "Agamospecies", "sub-lesus", "prole", "apomict", "nothogrex".
ABCD equivalence	not in ABCD
Type	Property

Term Name eco:verbatimSiteDescriptions
Term IRI	http://rs.tdwg.org/eco/terms/verbatimSiteDescriptions
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/verbatimSiteDescriptions-2026-09-17
Label	Verbatim Site Descriptions
Definition	Original textual description of the site(s).
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`Wet flatwoods \| Wet depression surrounded by mesic longleaf pine flatwoods \| Ground cover of thick Andropogon spp., Sporobolus floridanus, Vaccinium spp, Rhynchospora spp., Centella erecta, Panicum rigidulum.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name eco:verbatimSiteNames
Term IRI	http://rs.tdwg.org/eco/terms/verbatimSiteNames
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/verbatimSiteNames-2026-09-17
Label	Verbatim Site Names
Definition	A list (concatenated and separated) of original site names.
Notes	Site refers to the dcterms:Location at which observations are made or samples/measurements are taken. The site can be at any level of hierarchy. Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`East Coastal Fringe \| St. Marks Wildlife Management Area` `S1 \| S2 \| C1 \| C2 \| R14 \| R22 \| W1`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwciri:verbatimSRS
Term IRI	http://rs.tdwg.org/dwc/iri/verbatimSRS
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/iri/version/verbatimSRS-2025-06-12
Label	Verbatim SRS (IRI)
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes	Recommended best practice is to use an IRI for the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary IRI for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary IRI for the name or code of the ellipsoid, if known. Otherwise use an IRI for the value corresponding to `not recorded`.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwc:verbatimSRS
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimSRS
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimSRS-2025-06-12
Label	Verbatim SRS
Definition	The ellipsoid, geodetic datum, or spatial reference system (SRS) upon which coordinates given in dwc:verbatimLatitude and dwc:verbatimLongitude, or dwc:verbatimCoordinates are based.
Notes	Recommended best practice is to use the EPSG code of the SRS, if known. Otherwise use a controlled vocabulary for the name or code of the geodetic datum, if known. Otherwise use a controlled vocabulary for the name or code of the ellipsoid, if known. If none of these is known, use the value `not recorded`. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EPSG:4326` `WGS84` `NAD27` `Campo Inchauspe` `European 1950` `Clarke 1866` `not recorded`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name eco:verbatimTargetScope
Term IRI	http://rs.tdwg.org/eco/terms/verbatimTargetScope
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/verbatimTargetScope-2026-09-17
Label	Verbatim Target Scope
Definition	The verbatim original description of an eco:Survey scope.
Notes	Recommended best practice is first to populate explicit scope terms to the fullest extent possible (e.g., eco:targetTaxonomicScope). It is not recommended to use this term in assessing absence or completeness.
Examples	`small mammals` `freshwater macroinvertebrates` `dead animals`, `ground-living insects`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:verbatimTaxonRank
Term IRI	http://rs.tdwg.org/dwc/terms/verbatimTaxonRank
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verbatimTaxonRank-2023-06-28
Label	Verbatim Taxon Rank
Definition	The taxonomic rank of the most specific name in the dwc:scientificName as it appears in the original record.
Examples	`Agamospecies` `sub-lesus` `prole` `apomict` `nothogrex` `sp.` `subsp.` `var.`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-12-11_54

Term Name dwc:vernacularName
Term IRI	http://rs.tdwg.org/dwc/terms/vernacularName
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/vernacularName-2026-05-26
Label	Vernacular Name
Definition	A common or vernacular name.
Examples	`cóndor andino` `death cap` `rainbow trout` `Gänsegeier` `smoky quartz`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2019-12-01_19
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwc:verticalDatum
Term IRI	http://rs.tdwg.org/dwc/terms/verticalDatum
Modified	2025-06-12
Term version IRI	http://rs.tdwg.org/dwc/terms/version/verticalDatum-2025-06-12
Label	Vertical Datum
Definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`EGM84` `EGM96` `EGM2008` `PGM2000A` `PGM2004` `PGM2006` `PGM2007` `EPSG:7030` `not recorded`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-06-12_44

Term Name dwciri:verticalDatum
Term IRI	http://rs.tdwg.org/dwc/iri/verticalDatum
Modified	2025-07-10
Term version IRI	http://rs.tdwg.org/dwc/iri/version/verticalDatum-2025-07-10
Label	Vertical Datum (IRI)
Definition	The vertical datum used as the reference upon which the values in the elevation terms are based.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2021-07-15_34
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50

Term Name dwc:vitality
Term IRI	http://rs.tdwg.org/dwc/terms/vitality
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/terms/version/vitality-2026-05-26
Label	Vitality
Definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes	Recommended best practice is to use a controlled vocabulary. This term has an equivalent in the dwciri: namespace that allows only an IRI as a value, whereas this term allows for any string literal value.
Examples	`alive` `dead` `mixedLot` `uncertain` `notAssessed`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name dwciri:vitality
Term IRI	http://rs.tdwg.org/dwc/iri/vitality
Modified	2026-05-26
Term version IRI	http://rs.tdwg.org/dwc/iri/version/vitality-2026-05-26
Label	Vitality (IRI)
Definition	An indication of whether a dwc:Organism was alive or dead at the time of collection or observation.
Notes	Recommended best practice is to use a controlled vocabulary. Terms in the dwciri: namespace are intended to be used in RDF with non-literal objects.
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-06-28_40
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2023-09-13_41
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2025-07-10_50
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-05-26_58

Term Name eco:voucherInstitutions
Term IRI	http://rs.tdwg.org/eco/terms/voucherInstitutions
Modified	2026-09-17
Term version IRI	http://rs.tdwg.org/eco/terms/version/voucherInstitutions-2026-09-17
Label	Voucher Institutions
Definition	A list (concatenated and separated) of the names or acronyms of the institutions where vouchers collected during an eco:Survey were deposited.
Notes	Recommended best practice is to separate multiple values in a list with space vertical bar space ( \| ).
Examples	`FMNH` `AMNH \| MVZ` `Nairobi National Museum`
ABCD equivalence	not in ABCD
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_42
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2026-09-17_62

Term Name dwc:waterBody
Term IRI	http://rs.tdwg.org/dwc/terms/waterBody
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/waterBody-2023-06-28
Label	Water Body
Definition	The name of the water body in which the dcterms:Location occurs.
Notes	Recommended best practice is to use a controlled vocabulary such as the Getty Thesaurus of Geographic Names.
Examples	`Indian Ocean` `Baltic Sea` `Hudson River` `Lago Nahuel Huapi`
ABCD equivalence	DataSets/DataSet/Units/Unit/Gathering/NamedAreas/NamedArea/AreaName with NamedAreas/NamedArea/AreaClass= Water body
Type	Property
Executive Committee decision	http://rs.tdwg.org/decisions/decision-2024-02-28_43

Term Name dwc:year
Term IRI	http://rs.tdwg.org/dwc/terms/year
Modified	2023-06-28
Term version IRI	http://rs.tdwg.org/dwc/terms/version/year-2023-06-28
Label	Year
Definition	The four-digit year in which the dwc:Event occurred, according to the Common Era Calendar.
Examples	`1160` `2008`
ABCD equivalence	accessible from DataSets/DataSet/Units/Unit/Gathering/ISODateTimeBegin
Type	Property

On this page